A subscription to JoVE is required to view this content. Sign in or start your free trial.
פרוטוקול זה מציג שיטת בידוד כרומטין ספציפית ללוקוס המבוססת על רקומבינציה ספציפית לאתר כדי לטהר מוקד גן בעל עניין של עותק יחיד בהקשר הכרומטין הטבעי שלו משמרים ניצנים, Saccharomyces cerevisiae.
היחידה הארגונית הבסיסית של הכרומטין האיקריוטי היא חלקיק הליבה הנוקלאוזומי (NCP), המורכב מדנ"א עטוף ~1.7 פעמים סביב אוקטמר היסטון. כרומטין מוגדר כישות של NCPs וקומפלקסים חלבוניים רבים אחרים, כולל גורמי שעתוק, עיצוב מחדש של כרומטין ושינוי אנזימים. עדיין לא ברור כיצד אינטראקציות חלבון-דנ"א אלה מתוזמרות ברמה של אתרים גנומיים ספציפיים במהלך שלבים שונים של מחזור התא. זה בעיקר בשל המגבלות הטכניות הנוכחיות, אשר מקשות על השגת מדידות מדויקות של אינטראקציות דינמיות כאלה. כאן, אנו מתארים שיטה משופרת המשלבת רקומבינציה ספציפית לאתר עם פרוטוקול טיהור זיקה יעיל בצעד אחד כדי לבודד מוקד גן בעל עניין בעותק יחיד במצב הכרומטין הטבעי שלו. השיטה מאפשרת העשרה איתנה של מוקד המטרה על פני כרומטין, מה שהופך טכניקה זו לאסטרטגיה יעילה לזיהוי וכימות אינטראקציות חלבונים באופן בלתי משוחד ושיטתי, למשל על ידי ספקטרומטריית מסות. בהמשך לניתוחי הרכב כאלה, כרומטין טבעי שטוהר בשיטה זו משקף ככל הנראה את המצב in vivo בנוגע למיקום נוקלאוזומים ושינויים בהיסטון, ולכן ניתן לבצע ניתוחים מבניים וביוכימיים נוספים של כרומטין הנגזר כמעט מכל מוקד גנומי בשמרים.
הארגון הדינמי של גנומים אאוקריוטים לכרומטין דוחס את הדנ"א כך שיתאים לגבולות הגרעין תוך הבטחת דינמיקה מספקת לביטוי גנים ונגישות לגורמים רגולטוריים. בין השאר, רב-תכליתיות זו מתווכת על ידי הנוקלאוזום, היחידה הבסיסית של כרומטין, המורכבת מחלקיק ליבה עם 147 bp של DNA עטוף ~ 1.7 פעמים סביב אוקטמר היסטון1. הנוקלאוזום, הוא מבנה דינמי מאוד ביחס להרכבו, עם גרסאות היסטון רבות ושינויים פוסט-תרגומיים (PTM) על זנבות ההיסטון N ו-C. יתר על כן, כרומטין אאוקריוטי מקיים אינטראקציה עם מספר רב של מרכיבים חיוניים אחרים, כגון גורמי שעתוק, מכונות עיבוד DNA ו- RNA, חלבונים ארכיטקטוניים, אנזימים המעורבים בעיצוב מחדש ושינוי של כרומטין, ומולקולות RNA הקשורות לכרומטין. מכונ....
עיין בטבלת החומרים לקבלת פרטים הקשורים לכל החומרים והמכשירים המשמשים בפרוטוקול זה. ראה טבלה 1 לקבלת רשימה של הפתרונות, המאגרים והמדיה שבהם נעשה שימוש.
1. בניית זן שמרים רקומביננטי
הטיהור של תחום הכרומטין ARS316 ~ 1.4 kb תווך על ידי חלבון מתאם LexA-TAP המתבטא באופן מכונן . כדי לשמש כבקרה שלילית, ביצענו טיהור באמצעות זן איזוגני המבטא LexA-TAP אך אינו מכיל אתרים משולבים של RS ו-LexA. איור 3 מדגים את תוצאות ניתוח הדנ"א מניסוי טיהור סטנדרטי שבוצע הן על קבוצת הבקרה והן על זן ב?.......
זיהוי הגורמים ונוף הכרומטין של אזור גנומי מטרה ספציפי ממשיך להוות אתגר מרכזי במחקר הכרומטין18. פרוטוקול זה מתאר מערכת יעילה לכריתה וטיהור ספציפית של תחומי כרומטין נפרדים מכרומוזומי שמרים. למיטב ידיעתנו, הטוהר והתשואה של טיהור חד-שלבי זה מתגברים על רבות מהמגבלות של שיטות טיהו?.......
למחברים אין ניגודי עניינים לחשוף.
העבודה במעבדת S.H. נתמכה על ידי DFG באמצעות SFB1064 (מזהה פרויקט 213249687), מועצת המחקר האירופית (ERC Starting Grant 852798 ConflictResolution) והלמהולץ Gesellschaft.
....Name | Company | Catalog Number | Comments |
Yeast strains | |||
Control Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR | Section 1, see references 13 and 14 | ||
Recombination Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; RS_LEXA_NS-3_ARS316_NS+3_RS; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR | Section 1, see reference 13 and 14 | ||
Plasmid | |||
K238 plasmid | Section 1, see reference 13 Storage: Store at -20 °C | ||
K071 Spike-in plasmid DNA | Section 7.1, see reference 13 Storage: Store at -20 °C | ||
Reagents | |||
Acetone | Carl Roth | 5025.1 | Section 2 Storage: Store at room temperature |
Ammonium acetate (NH4Ac) | Sigma Aldrich | A7262 | Section 6 and 7.1 Storage: Store at room temperature |
Ammonium solution (NH4OH) 25% | Merck Millipore | 533003 | Section 6 Storage: Store at room temperature |
Ammonium sulfate | Santa Cruz | Sc-29085 | Section 2 Storage: Store at room temperature |
Bacto agar | BD (VWR) | 90000-760 | Section 3 Storage: Store at room temperature |
Bacto peptone | BD (VWR) | 211820 | Section 3 Storage: Store at room temperature |
β-Mercaptoethanol | Sigma Aldrich | 07604 | Section 7.2 Storage: Store at 4 °C |
Chemiluminescent substrate kit | ThermoFisher | 34580 | Section 7.2 Storage: Store at 4 °C |
Di-Sodium Hydrogen phosphate dodecahydrate | Merck | 1.06579.1000 | Section 2 and 7.1 Storage: Store at room temperature |
Dithiothreitol (DTT) | ThermoFisher | 15508013 | Section 4 Storage: Store at 4 °C |
Ethanol | Merck | 100983 | Section 7.1 Storage: Store at room temperature |
Ethylenediaminetetraacetic acid (EDTA) | Sigma Aldrich | ED | Section 7.1 Storage: Store at room temperature |
Galactose (20% (w/v) stock) | Sigma Aldrich | G0625-1KG / 5KG | Section 3 Storage: Store at room temperature |
Gel loading dye (6x) | BioLabs | B7024A | Section 7.1 Storage: Store at -20 °C |
Glusose | Sigma-Aldrich | G8270 | Section Storage: Store at room temperature |
Glycine | Carl Roth | .0079.4 | Section 2 Storage: Store at room temperature |
Glycogen (5 mg/mL) | Invitrogen | AM9510 | Section 7.1 Storage: Store at -20 °C |
Hydrochloric acid (HCl) | PanReac AppliChem | 182109.1211 | Section 2, 4 and 7.1 Storage: Store at room temperature |
Magnesium Acetate (MgAc) | Bernd Kraft | 15274.2600/C035 | Section 4 Storage: Store at room temperature |
Magnesium chloride (MgCl2) | Sigma Aldrich | M8266 | Section 6 Storage: Store at room temperature |
Nu PAGE LDS sample buffer (4x) | Invitrogen | 2399549 | Section 7.2 Storage: Store at room temperature |
Phenol/Chloroform/Isoamyl alcohol (25:24:1 v/v) | Invitrogen | 15593-031 | Section 7.1 Storage: Store at 4 °C |
Potassium chloride (KCl) | Sigma | P9541 | Section 4 Storage: Store at room temperature |
Radioactively labeled α-32P dATP (3,000 Ci/mmol, 10 mCi/mL) | Hartmann Analytic | SRP-203 | Section 7.1 Storage: Store at 4 °C |
RadPrime labeling system | ThermoFisher | 18428-011 | Section 7.1 Storage: Store at -20 °C |
Raffinose (20% (w/v) stock) | SERVA | 34140.03 | Section 3 Storage: Store at room temperature |
Sodium chloride (NaCl) | Merck | K53710504142 | Section 7.1 Storage: Store at room temperature |
Sodium citrate (Na3C6H5O7) | Sigma-Aldrich | 71402 | Section 7.1 Storage: Store at room temperature |
Sodium hydroxide (NaOH) | Sigma Aldrich | S5881 | Section 7.1 Storage: Store at room temperature |
Sodium n-dodecyl sulfate (SDS) (5% stock (w/v) ) | Alfa Aesar | A11183 | Section 7.1 Storage: Store at room temperature |
Sodium phosphate monobasic | Sigma-Aldrich | 71496 | Section 2 and 7.1 Storage: Store at room temperature |
Sodium azide | Santa Cruz Biotechnology | sc-208393 | Section 2 Storage: Store at -20 °C |
Triethylamine | Sigma Aldrich | 90340 | Section 2 Storage: Store at room temperature |
Tris base | Chem Cruz | SC-3715B | Section 2 and 4 Storage: Store at room temperature |
Triton X-100 | Sigma Aldrich | X100 | Section 2 and 4 Storage: Store at room temperature |
Tween-20 | Bernd Kraft | 18014332 | Section 4 Storage: Store at room temperature |
Yeast extract | BD (VWR) | 212720 | Section 3 Storage: Store at room temperature |
Yeast mating factor alpha (1 µg/mL stock ) | Biomol | Y2016.5 | Section 3 Storage: Store at -20 °C |
Yeast Synthetic Drop-out medium Supplements without LEUCINE | Sigma Aldrich | Y1376 | Section 1, see reference 14 |
Enzymes | |||
HpaI restriction enzyme (5,000 U/mL) | NEB | R0105S | Section 7.1 Storage: Store at -20 °C |
Protease and Phosphatase Inhibitor Cocktail (100x) | ThermoFisher Scientific | 78446 | Section 4 Storage: Store at4 °C |
Proteinase K (10 mg/mL) | SERVA | 33756 | Section 7.1 Storage: Store at -20 °C |
RNase A (10 mg/mL) | ThermoFisher | EN0531 | Section 7.1 Storage: Store at -20 °C |
TEV protease (10000 U/µL) | NEB | P8112S | Section 5 Storage: Store at -20 °C |
Materials | |||
BcMag Epoxy-Activated Magnetic Beads | Bioclone Inc. | FC-102 | Section 2 Storage: Store at 4 °C |
Dry ice | Section 4 | ||
Low-binding centrifuge tubes 2.0 mL | Eppendorf | 22431102 | Section 4 |
Microspin G-25 Columns | Cytiva | 27-5325-01 | Section 7.1 Storage: Store at room temperature |
Parafilm | Merck | P7793 | Section 4 |
Positive nylon membrane | Biozol | 11MEMP0001 | Section 7.1 Storage: Store at room temperature |
PVDF transfer membrane | Immobilon-Merck Millipore | IPVH00010 | Section 7.2 Storage: Store at room temperature |
SDS-PAGE gel 4-12% bis-tris (15 well, 1.5 mm) | Invitrogen | NP0336BOX | Section 7.2 Storage: Store at 4 °C |
Syringe (25 mL) with luer fitting | Henke Sass Wolf | 4200-000V0 | Section 3 |
Whatman paper (Grade 3MM CHR Cellulose Western Blotting Paper Sheet) | Cytiva | 3030-917 | Section 7.1 Storage: Store at room temperature |
Antibodies | |||
Anti-LexA, rabbit polyclonal IgG, DNA binding region antibody | Merck Millipore | 06-719 | Section 7.2 Storage: Store at -20 °C |
Goat Anti-Rabbit IgG (H+L), Horseradish peroxidase conjugate | Invitrogen | G21234 | Section 7.2 Storage: Store at -20 °C |
Peroxidase Anti-Peroxidase (PAP) antibody produced in rabbit for the detection of TAP-tagged proteins | Sigma Aldrich | P1291-500UL | Section 7.2 Storage: Store at -20 °C |
Rabbit IgG antibodies | Sigma | I5006-100MG | Section 2 Storage: Store at 4 °C |
Primers (10 µM) | |||
ARS316: fwd 5'- CGGCATTATCGTACACAACCT, rev 5'- GTTCTTCGTTGCCTACATTTTCT | Section 7.1 | ||
K071 Spike-in plasmid DNA: fwd: 5'-TTTTCGCTGCTTGTCCTTTT, rev 5'- CATTTTCGTCCTCCCAACAT | Section 7.1 | ||
PCR fragment from yeast genomic DNA as a template for ARS316 amplification (for southern blot): fwd 5’- AAATTCTGCCCTTGATTCGT rev 5’- TTTGTTTATCTCATCACTAAT | Section 7.1 | ||
PDC1: fwd 5'- CATGATCAGATGGGGCTTCA, rev 5'-ACCGGTGGTAGCGACTCTGT | Section 7.1 | ||
Equipment | |||
Coffee grinder | Gastroback | 42601 | Section 4 |
Dewar flask | NAL GENE | 4150-2000 | Section 3 |
DynaMag TM-2 magnetic rack | Invitrogen | 12321D | Section 4, 5 and 6 |
Hybridization oven | Hybaid Mini10 | Ri418 | Section 2 |
Microcentrifuge | Eppendorf | 5424R | Section 4 and 7.1 |
UV-crosslinker | Analytikjena | 95-0174-02 | Section 7.1 |
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
ABOUT JoVE
Copyright © 2025 MyJoVE Corporation. All rights reserved