Sign In

A subscription to JoVE is required to view this content. Sign in or start your free trial.

In This Article

  • Summary
  • Abstract
  • Introduction
  • Protocol
  • Representative Results
  • Discussion
  • Acknowledgements
  • Materials
  • References
  • Reprints and Permissions

Summary

В этом протоколе представлен локусоспецифический метод выделения хроматина, основанный на сайт-специфической рекомбинации, для очистки однокопийного гена, представляющего интерес в его нативном контексте хроматина, от почковавшихся дрожжей Saccharomyces cerevisiae.

Abstract

Основной организационной единицей эукариотического хроматина является частица ядра нуклеосомы (NCP), которая состоит из ДНК, обернутой ~1,7 раза вокруг октамера гистона. Хроматин определяется как сущность NCP и многих других белковых комплексов, включая транскрипционные факторы, ремоделирование хроматина и модифицирующие ферменты. До сих пор неясно, как эти белок-ДНК-взаимодействия организуются на уровне специфических геномных локусов на разных стадиях клеточного цикла. В основном это связано с текущими техническими ограничениями, которые затрудняют получение точных измерений таких динамических взаимодействий. В этой статье мы опишем усовершенствованный метод, сочетающий сайт-специфичную рекомбинацию с эффективным одноступенчатым протоколом аффинной очистки для выделения интересующего нас однокопийного гена в его нативном хроматиновом состоянии. Этот метод позволяет надежно обогащать целевой локус с помощью геномного хроматина, что делает этот метод эффективной стратегией для идентификации и количественной оценки белковых взаимодействий непредвзятым и систематическим образом, например, с помощью масс-спектрометрии. В дополнение к такому анализу состава, нативный хроматин, очищенный этим методом, вероятно, отражает ситуацию in vivo в отношении позиционирования нуклеосом и модификаций гистонов и, следовательно, поддается дальнейшему структурному и биохимическому анализу хроматина, полученного практически из любого геномного локуса у дрожжей.

Introduction

Динамическая организация эукариотических геномов в хроматин уплотняет ДНК, чтобы она помещалась в пределах ядра, обеспечивая при этом достаточную динамику для экспрессии генов и доступность регуляторных факторов. Отчасти эта универсальность опосредована нуклеосомой, основной единицей хроматина, которая состоит из основной частицы со 147.н. ДНК, обернутой ~1,7 раза вокруг октамера гистонов1. Нуклеосома представляет собой очень динамичную структуру по отношению к своему составу, с многочисленными вариантами гистонов и посттрансляционными модификациями (ПТМ) на N- и C-концевых хвостах гистонов. Кроме того, эукариотический хроматин взаимодействует ....

Protocol

Смотрите Таблицу материалов для получения подробной информации, связанной со всеми материалами и инструментами, используемыми в этом протоколе. В таблице 1 приведен список используемых решений, буферов и носителей.

1. Построение штамма рекомбинантн.......

Representative Results

Очистка домена хроматина ARS316 ~1,4 kb была опосредована конститутивно экспрессируемым белком-адаптером LexA-TAP. В качестве отрицательного контроля мы проводили очистки с использованием изогенного штамма, экспрессирующего LexA-TAP, но не содержащего интегрированных RS и LexA-связывающих сайтов.

Discussion

Идентификация факторов и хроматинового ландшафта конкретной целевой области генома по-прежнему представляет собой серьезную проблему в исследованиях хроматина18. Этот протокол описывает эффективную систему специфического удаления и очистки различных доменов хроматина.......

Acknowledgements

Работа в лаборатории S.H. поддерживалась DFG через SFB1064 (идентификатор проекта 213249687), Европейским исследовательским советом (ERC Starting Grant 852798 ConflictResolution) и Обществом Гельмгольца.

....

Materials

NameCompanyCatalog NumberComments
Yeast strains
Control Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecRSection 1, see references 13 and 14
Recombination Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; RS_LEXA_NS-3_ARS316_NS+3_RS; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecRSection 1, see reference 13 and 14
Plasmid
K238 plasmidSection 1, see reference 13
Storage: Store at -20 °C
K071 Spike-in plasmid DNASection 7.1, see reference 13
Storage: Store at -20 °C
Reagents
AcetoneCarl Roth5025.1Section 2
Storage: Store at room temperature
Ammonium acetate (NH4Ac)Sigma AldrichA7262Section 6 and 7.1
Storage: Store at room temperature
Ammonium solution (NH4OH) 25%Merck Millipore533003Section 6
Storage: Store at room temperature
Ammonium sulfateSanta CruzSc-29085Section 2
Storage: Store at room temperature
Bacto agarBD (VWR)90000-760Section 3
Storage: Store at room temperature
Bacto peptoneBD (VWR)211820Section 3
Storage: Store at room temperature
β-MercaptoethanolSigma Aldrich07604Section 7.2
Storage: Store at 4 °C
Chemiluminescent substrate kitThermoFisher34580Section 7.2
Storage: Store at 4 °C
Di-Sodium Hydrogen phosphate dodecahydrateMerck1.06579.1000Section 2 and 7.1
Storage: Store at room temperature
Dithiothreitol (DTT)ThermoFisher15508013Section 4
Storage: Store at 4 °C
EthanolMerck100983Section 7.1
Storage: Store at room temperature
Ethylenediaminetetraacetic acid (EDTA)Sigma AldrichEDSection 7.1
Storage: Store at room temperature
Galactose (20% (w/v) stock)Sigma AldrichG0625-1KG  /  5KGSection 3
Storage: Store at room temperature
Gel loading dye (6x)BioLabsB7024ASection 7.1
Storage: Store at -20 °C
GlusoseSigma-AldrichG8270Section
Storage: Store at room temperature
GlycineCarl Roth.0079.4Section 2
Storage: Store at room temperature
Glycogen (5 mg/mL)InvitrogenAM9510Section 7.1
Storage: Store at -20 °C
Hydrochloric acid (HCl)PanReac AppliChem182109.1211Section 2, 4 and 7.1
Storage: Store at room temperature
Magnesium Acetate (MgAc)Bernd Kraft15274.2600/C035Section 4
Storage: Store at room temperature
Magnesium chloride (MgCl2)Sigma AldrichM8266Section 6
Storage: Store at room temperature
Nu PAGE LDS sample buffer (4x)Invitrogen2399549Section 7.2
Storage: Store at room temperature
Phenol/Chloroform/Isoamyl alcohol (25:24:1 v/v)Invitrogen15593-031Section 7.1
Storage: Store at 4 °C
Potassium chloride (KCl)SigmaP9541Section 4
Storage: Store at room temperature
Radioactively labeled α-32P dATP (3,000 Ci/mmol, 10 mCi/mL)Hartmann AnalyticSRP-203Section 7.1
Storage: Store at 4 °C
RadPrime labeling systemThermoFisher18428-011Section 7.1
Storage: Store at -20 °C
Raffinose (20% (w/v) stock)SERVA34140.03Section 3
Storage: Store at room temperature
Sodium chloride (NaCl)MerckK53710504142Section 7.1
Storage: Store at room temperature
Sodium citrate (Na3C6H5O7)Sigma-Aldrich71402Section 7.1
Storage: Store at room temperature
Sodium hydroxide (NaOH)Sigma AldrichS5881Section 7.1
Storage: Store at room temperature
Sodium n-dodecyl sulfate (SDS) (5% stock (w/v) )Alfa AesarA11183Section 7.1
Storage: Store at room temperature
Sodium phosphate monobasicSigma-Aldrich71496Section 2 and 7.1
Storage: Store at room temperature
Sodium azideSanta Cruz Biotechnologysc-208393Section 2
Storage: Store at -20 °C
 TriethylamineSigma Aldrich90340Section 2
Storage: Store at room temperature
Tris baseChem CruzSC-3715BSection 2 and 4
Storage: Store at room temperature
Triton X-100Sigma AldrichX100Section 2 and 4
Storage: Store at room temperature
Tween-20Bernd Kraft18014332Section 4
Storage: Store at room temperature
Yeast extractBD (VWR)212720Section 3
Storage: Store at room temperature
Yeast mating factor alpha (1 µg/mL stock ) BiomolY2016.5Section 3
Storage: Store at -20 °C
Yeast Synthetic Drop-out medium Supplements without LEUCINESigma AldrichY1376Section 1, see reference 14
Enzymes
HpaI restriction enzyme (5,000 U/mL)NEBR0105SSection 7.1
Storage: Store at -20 °C
Protease and Phosphatase Inhibitor Cocktail (100x)ThermoFisher Scientific78446Section 4
Storage: Store at4 °C
Proteinase K (10 mg/mL)SERVA33756Section 7.1
Storage: Store at -20 °C
RNase A (10 mg/mL) ThermoFisherEN0531Section 7.1
Storage: Store at -20 °C
TEV protease (10000 U/µL)NEBP8112SSection 5
Storage: Store at -20 °C
Materials
BcMag Epoxy-Activated Magnetic BeadsBioclone Inc.FC-102Section 2
Storage: Store at 4 °C
Dry iceSection 4
Low-binding centrifuge tubes 2.0 mLEppendorf22431102Section 4
Microspin G-25 ColumnsCytiva27-5325-01Section 7.1
Storage: Store at room temperature
ParafilmMerckP7793Section 4
Positive nylon membraneBiozol11MEMP0001Section 7.1
Storage: Store at room temperature
PVDF transfer membraneImmobilon-Merck MilliporeIPVH00010Section 7.2
Storage: Store at room temperature
SDS-PAGE gel 4-12% bis-tris (15 well, 1.5 mm)Invitrogen NP0336BOXSection 7.2
Storage: Store at 4 °C
Syringe (25 mL) with luer fittingHenke Sass Wolf4200-000V0Section 3
Whatman paper (Grade 3MM CHR Cellulose Western Blotting Paper Sheet)Cytiva3030-917Section 7.1
Storage: Store at room temperature
Antibodies
Anti-LexA, rabbit polyclonal IgG, DNA binding region antibodyMerck Millipore06-719Section 7.2
Storage: Store at -20 °C
Goat Anti-Rabbit IgG (H+L), Horseradish peroxidase conjugateInvitrogenG21234Section 7.2
Storage: Store at -20 °C
Peroxidase Anti-Peroxidase (PAP) antibody produced in rabbit for the detection of TAP-tagged proteinsSigma AldrichP1291-500ULSection 7.2
Storage: Store at -20 °C
Rabbit IgG antibodiesSigmaI5006-100MGSection 2
Storage: Store at 4 °C
Primers (10 µM)
ARS316: fwd 5'- CGGCATTATCGTACACAACCT, rev 5'- GTTCTTCGTTGCCTACATTTTCTSection 7.1
K071 Spike-in plasmid DNA: fwd: 5'-TTTTCGCTGCTTGTCCTTTT, rev 5'- CATTTTCGTCCTCCCAACATSection 7.1
PCR fragment from yeast genomic DNA as a template  for ARS316 amplification (for southern blot): fwd 5’- AAATTCTGCCCTTGATTCGT                                                  rev 5’- TTTGTTTATCTCATCACTAATSection 7.1
PDC1: fwd 5'- CATGATCAGATGGGGCTTCA, rev 5'-ACCGGTGGTAGCGACTCTGTSection 7.1
Equipment
Coffee grinderGastroback42601Section 4
Dewar flaskNAL GENE4150-2000Section 3
DynaMag TM-2 magnetic rackInvitrogen12321DSection 4, 5 and 6
Hybridization ovenHybaid Mini10Ri418Section 2
MicrocentrifugeEppendorf5424RSection 4 and 7.1
UV-crosslinkerAnalytikjena95-0174-02Section 7.1

References

  1. Kornberg, R. D., Lorch, Y. Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome. Cell. 98 (3), 285-294 (1999).
  2. Gauchier, M., van Mierlo, G., Vermeulen, M., Déjardin, J. Purif....

Explore More Articles

JoVE201

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2025 MyJoVE Corporation. All rights reserved