RNA Interference in the Egg Parasitoid, Trichogramma dendrolimi Matsumura

Summary

The manipulation of RNA interference (RNAi) presents a formidable challenge in many parasitoid species with diminutive size, such as Trichogramma wasps. This study delineated an efficient RNAi method in Trichogramma denrolimi. The present methodology provides a robust model for investigating gene regulation in Trichogramma wasps.

Abstract

The egg parasitoids, Trichogramma spp, are recognized as efficient biological control agents against various lepidopteran pests in agriculture and forests. The immature stages of Trichogramma offspring develop within the host egg, exhibiting remarkable diminutiveness (approximately 0.5 mm in adult length). RNA-interference (RNAi) methodology has emerged as a crucial tool for elucidating gene functions in numerous organisms. However, manipulating RNAi in certain small parasitoid species, such as Trichogramma, has generally posed significant challenges. In this study, we present an efficient RNAi method in Trichogramma denrolimi. The outlined procedure encompasses the acquisition and isolation of individual T. dendrolimi specimens from host eggs, the design and synthesis of double-stranded RNA (dsRNA), the in vitro transplantation and cultivation of T. dendrolimi pupae, the micro-injection of dsRNA, and the subsequent assessment of target gene knockdown through RT-qPCR analysis. This study furnishes a comprehensive, visually detailed procedure for conducting RNAi experiments in T. dendrolimi, thereby enabling researchers to investigate the gene regulation in this species. Furthermore, this methodology is adaptable for RNAi studies or micro-injections in other Trichogramma species with minor adjustments, rendering it a valuable reference for conducting RNAi experiments in other endoparasitic species.

Introduction

Trichogramma spp. are a group of egg parasitoids that have been extensively utilized as highly efficient biological control agents against a wide spectrum of lepidopteran pests in agricultural and forest ecosystems worldwide^1,2,3,4. The application of mass-reared Trichogramma provides an environmentally friendly approach for the sustainable management of pests^5,6,7. Understanding the molecular biology of Trichogramma wasps....

Protocol

NOTE: See the Table of Materials for details related to all materials, instruments, software, and reagents used in this protocol.

1. Collection and maintenance of insect culture

1. Adhere a group of ~5,000 eggs of Corcyra cephalonica (Stainton) onto a 9 cm by 16 cm card using a 1:5 (v/v) solution of gum arabic powder and water^25,26.
   NOTE: Avoid attaching too many host eggs to t.......

Discussion

Trichogramma wasps are recognized as effective biological control agents, specifically targeting a range of lepidopteran pests in agriculture and forestry¹. These diminutive wasps undergo their immature stages within the host egg, a characteristic that presents challenges in conducting RNAi experiments^5,18. This study offers a comprehensive visual guide for conducting RNAi experiments in T. denrolimi. Given the shared bio.......

Materials

Name	Company	Catalog Number	Comments
2x ES Taq MasterMix (Dye)	Cowin Biotech, China	CW0690H	To amplify the dsRNA sequences
20x PBS Buffer, DEPC treated (7.2-7.6)	Sangon Biotech, China	B540627-0500	To dilute dsRNA
Agar strip	Shishi Globe Agar Industries Co.,Ltd, China	n/a	To make culture medium
Ampicillin sodium	Sangon Biotech, China	A610028	To make culture medium
Bioer Constant temperature metal bath	BIOER, China	MB-102	To synthesis dsRNA
Borosilicate glass capillary	WPI, USA	1B100-4	To pull capillary glass needle
Clean bench	Airtech, China	SW-CJ-1FD	To extract RNA
Double distilled water	Sangon Biotech, China	A500197-0500	To dilute cDNA
Environmental Testing chamber	Panasonic, Japan	MLR-352H-PC	To culture T. denrolimi
Eppendorf Centrifuge	Eppendrof, Germany	5418R	To store RNA content
Eppendorf FemtoJet 4i	Eppendrof, Germany	FemtoJet 4i	To inject T. denrolimi
Eppendorf Refrigerated Centrifuge	Eppendrof, Germany	5810R	Centrifuge
Ethanol solution (75%, RNase-free)	Aladdin, China	M052131-500ml	To extract RNA
Gel Extraction Kit	Omega, USA	D25000-02	To extract cDNA
GUM Arabic	Solarbio, China	CG5991-500g	To make egg card
Isopropyl alchohol	Aladdin, China	80109218	To extract RNA
Laser-Based Micropipette Puller	SUTTER, USA	P-2000	To pull capillary glass needle
Microloader	Eppendrof, Germany	20 µL	To load dsRNA
Multi-sample tissue grinder	LICHEN, China	LC-TG-24	To grind T. denrolimi
Needle Grinder	SUTTER, USA	BV-10-E	To grind capillary glass needle
Nuclease-Free Water	Sangon Biotech, China		To dilute RNA
OLYMPUS Microscope	OLYMPUS, Japan	XZX16	To observe T. denrolimi
PCR machine	Bio-rad, USA	S-1000	For DNA amplification
PowerPac Basic	Bio-rad, USA	PowerPacTM Basic	To detect the quality of dsRNA
Primer of dsGFP (Forward)			[TAATACGACTCACTATAGGG] ACAAACCAAGGCAAGTAATA
Primer of dsGFP (Reverse)			[TAATACGACTCACTATAGGG] CAGAGGCATCTTCAACG
Primer of Ferhch for qPCR (Forward)			TGAAGAGATTCTGCGTTCTGCT
Primer of Ferhch for qPCR (Reverse)			CTGTAGGAACATCAGCAGGCTT
Primer of Ferhch for RNAi (Reverse)			[TAATACGACTCACTATAGGG]AG TAGCCATCATCTTTCC
Primer of Ferhch for RNAi(Forward)			[TAATACGACTCACTATAGGG] ACACTGTCAATCGTCCTG
Primer of FoxO for qPCR (Forward)			CTACGCCGATCTCATAACGC
Primer of FoxO for qPCR (Reverse)			TGCTGTCGCCCTTGTCCT
PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time)	TaKaRa, Japan	RR047A
Quantitative Real-time PCR	Bio-rad, USA	CFX 96 Touch	To perform reverse transcriptase polymerase chain reaction (RT-PCR)
Real-time PCR (TaqMan) Primer and Probes Design Tool			https://www.genscript.com/tools/real-time-pcr-taqman-primer-design-tool/
T7 RiBoMAX Express RNAi System	Promega, USA	P1700	To synthesis dsRNA  in vitro
TB Green Premix Ex TaqTM (Til RnaseH Plus)	TaKaRa, Japan	RR820A	To perform RT-qPCR
Trichloromethane	KESHI, China	GB/T682-2002	To extract RNA
TRIzol Reagent	Ambion, USA	15596018	To extract total RNA content from samples
Ultra-low Temperature Freezer	Thermo, USA	Forma 911