This work was supported by GuangDong Basic and Applied Basic Research Foundation (2023A1515110760).

Six 7/8-week-old female Sprague-Dawley rats weighing 200-250 g were used in this work. The rats were housed in a climate-controlled animal facility with ad libitum access to food and water. All experimental procedures involving animals were conducted in adherence to the Institutional Guidelines for the Care and Use of Laboratory Animals and were approved by the institutional review board for animal experiments at the Research Ethics Committee of the Meizhou People&#39;s Hospital.
The ...

<ol>
	<li>Jabbour, H. N., Kelly, R. W., Fraser, H. M., Critchley, H. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endocrine+regulation+of+menstruation.">Endocrine regulation of menstruation.</a> Endocr Rev. 27 (1), 17-46 (2006).</li><li>Garcia-Alonso, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+the+temporal+and+spatial+dynamics+of+the+human+endometrium+in+vivo+and+in+vitro.">Mapping the temporal and spatial dynamics of the human endometrium in vivo and in vitro.</a> Nat Genet. 53 (12), 1698-1711 (2021).</li><li>Li, M., Izpisua Belmonte, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organoids+-+preclinical+models+of+human+disease.">Organoids - preclinical models of human disease.</a> N Engl J Med. 380 (6), 569-579 (2019).</li><li>Mulaudzi, P. E., Abrahamse, H., Crous, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+on+three+dimensional+organoid+studies+for+stem+cell+therapy+in+regenerative+medicine.">Insights on three dimensional organoid studies for stem cell therapy in regenerative medicine.</a> Stem Cell Rev Rep. 20 (2), 509-523 (2024).</li><li>Boretto, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+organoids+from+mouse+and+human+endometrium+showing+endometrial+epithelium+physiology+and+long-term+expandability.">Development of organoids from mouse and human endometrium showing endometrial epithelium physiology and long-term expandability.</a> Development. 144 (10), 1775-1786 (2017).</li><li>Turco, M. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term,+hormone-responsive+organoid+cultures+of+human+endometrium+in+a+chemically+defined+medium.">Long-term, hormone-responsive organoid cultures of human endometrium in a chemically defined medium.</a> Nat Cell Biol. 19 (5), 568-577 (2017).</li><li>Tempest, N., Maclean, A., Hapangama, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endometrial+stem+cell+markers:+current+concepts+and+unresolved+questions.">Endometrial stem cell markers: current concepts and unresolved questions.</a> Int J Mol Sci. 19 (10), 3240 (2018).</li><li>He, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+maintenance+of+human+endometrial+epithelial+stem+cells+and+their+therapeutic+effects+on+intrauterine+adhesion.">Long-term maintenance of human endometrial epithelial stem cells and their therapeutic effects on intrauterine adhesion.</a> Cell Biosci. 12 (1), 175 (2022).</li><li>Katsuda, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conversion+of+terminally+committed+hepatocytes+to+culturable+bipotent+progenitor+cells+with+regenerative+capacity.">Conversion of terminally committed hepatocytes to culturable bipotent progenitor cells with regenerative capacity.</a> Cell Stem Cell. 20 (1), 41-55 (2017).</li><li>Murphy, A. R., Campo, H., Kim, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+modelling+endometrial+diseases.">Strategies for modelling endometrial diseases.</a> Nat Rev Endocrinol. 18 (12), 727-743 (2022).</li><li>Boretto, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patient-derived+organoids+from+endometrial+disease+capture+clinical+heterogeneity+and+are+amenable+to+drug+screening.">Patient-derived organoids from endometrial disease capture clinical heterogeneity and are amenable to drug screening.</a> Nat Cell Biol. 21 (8), 1041-1051 (2019).</li><li>Esfandiari, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endometriosis+organoids:+prospects+and+challenges.">Endometriosis organoids: prospects and challenges.</a> Reprod Biomed Online. 45 (1), 5-9 (2022).</li></ol>

In this study, we have described a straightforward method for isolating and culturing rat endometrial epithelial stem cells (reESCs) and refined the previously established ex vivo system for human endometrial epithelial stem cells8. Our approach utilizes a small molecule culture medium containing Y27632, A8301, and CHIR99021 as core components to enable stable and long-term ex vivo culture. Moreover, we successfully generated rat endometrial organoids in real time using reESCs. T...

The endometrium, a versatile and regenerative tissue in the human body, undergoes periodic shedding, regeneration, and differentiation under the influence of ovarian hormones1. Abnormalities in the endometrium are linked to various female reproductive system diseases, such as endometriosis, endometrial cancer, and infertility2. The lack of reliable research models for the endometrium hampers in-depth studies of the pathogenesis, clinical diagnosis, and treatment of these diseases. While cell lines and animal models are commonly utilized for endometrial research, challenges such as phenotypic instability in cell lines, interspecies differences in animal models, and other limitations make it difficult to replicate the complex physiological structure and dynamic functional changes in the human endometrium3.
Organoids are three-dimensional structures formed by culturing stem cells in an extracellular environment, possessing self-renewal and self-organization capabilities. They can mimic the structure and function of physiological and pathological tissues and are recognized as preclinical models of human diseases4. In 2017, successful construction of mouse and human endometrial organoids was achieved by embedding fragmented free endometrial tissue obtained through enzymatic digestion into an extracellular matrix scaffold, followed by adding a mixture of specific growth factors and signaling factors for cultivation5. The results demonstrated that ex vivo endometrial organoids exhibit long-term and stable proliferative capacity, maintaining the glandular structure, cell polarity, and functional characteristics of the endometrial epithelium, including mucus secretion and hormone response6. However, the ex vivo culture of adult stem cells forming the endometrial organoids requires gland-like structural support, leading to challenges such as loss of stemness and difficulties in passaging7.
Currently, the cultivation of endometrial organoids relies on the tissue block digestion culture method. In a previous study, our research team cultured human endometrial epithelial stem cells for an extended period in vitro using a primary culture medium primarily composed of Y27632, which we employed to construct endometrial organoids8. Building on this success, we isolated and cultured endometrial epithelial stem cells from rat endometrial tissue using a small molecule compound culture medium, establishing a long-term in vitro culture system. Furthermore, we utilized rat endometrial epithelial stem cells (reESCs) to generate rat endometrial organoids. The development of this model will enhance future in vitro and in vivo studies of endometrial-related diseases in conjunction with rat models.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Anti-CD15 (SSEA-1)</td>
			<td>Abcam</td>
			<td>ab135377</td>
			<td>Rabbit, 1:200 (IHC)</td>
		</tr>
		<tr>
			<td>Anti-Estrogen Receptor alpha</td>
			<td>Abcam</td>
			<td>ab32063</td>
			<td>Rabbit, 1:200 (IHC)</td>
		</tr>
		<tr>
			<td>Anti-pan Cytokeratin</td>
			<td>Abcam</td>
			<td>ab7753</td>
			<td>Mouse, 1:250 (IHC)</td>
		</tr>
		<tr>
			<td>Anti-Progesterone Receptor</td>
			<td>Abcam</td>
			<td>ab101688</td>
			<td>Rabbit, 1:200 (IHC)</td>
		</tr>
		<tr>
			<td>Anti-Ki67</td>
			<td>Abcam</td>
			<td>ab279653</td>
			<td>Mouse, 1:250 (IHC)</td>
		</tr>
		<tr>
			<td>A8301</td>
			<td>TargetMol</td>
			<td>909910-43-6</td>
			<td></td>
		</tr>
		<tr>
			<td>&#946;-Estradiol</td>
			<td>Merck</td>
			<td>E8875</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell Counting Kit-8</td>
			<td>Beyotime</td>
			<td>C0038</td>
			<td></td>
		</tr>
		<tr>
			<td>CD9</td>
			<td>BioLegend</td>
			<td>109819</td>
			<td>1:20 (FC), Pacific Blue</td>
		</tr>
		<tr>
			<td>CD24</td>
			<td>BioLegend</td>
			<td>101806</td>
			<td>1:20 (FC), FITC</td>
		</tr>
		<tr>
			<td>CD31</td>
			<td>BioLegend</td>
			<td>303120</td>
			<td>1:20 (FC), APC</td>
		</tr>
		<tr>
			<td>CD45</td>
			<td>BioLegend</td>
			<td>301703</td>
			<td>1:20 (FC), PE</td>
		</tr>
		<tr>
			<td>CHIR99021</td>
			<td>TargetMol</td>
			<td>CT99021</td>
			<td></td>
		</tr>
		<tr>
			<td>Cultrex Organoid Harvesting Solution</td>
			<td>R&#38;D Systems</td>
			<td>3700-100-01</td>
			<td></td>
		</tr>
		<tr>
			<td>Cy3 TSA Fluorescence System Kit</td>
			<td>APExBIO</td>
			<td>K1051</td>
			<td></td>
		</tr>
		<tr>
			<td>Cy5 TSA Fluorescence System Kit</td>
			<td>APExBIO</td>
			<td>K1052</td>
			<td></td>
		</tr>
		<tr>
			<td>DAPI</td>
			<td>Sigma</td>
			<td>D9542</td>
			<td>1 &#956;g/mL</td>
		</tr>
		<tr>
			<td>DMEM/F-12</td>
			<td>Invitrogen</td>
			<td>11330032</td>
			<td></td>
		</tr>
		<tr>
			<td>EpCAM</td>
			<td>BioLegend</td>
			<td>369803</td>
			<td>1:20 (FC), PerCP</td>
		</tr>
		<tr>
			<td>Fluorescein TSA Fluorescence System Kit</td>
			<td>APExBIO</td>
			<td>K1050</td>
			<td></td>
		</tr>
		<tr>
			<td>Goat anti-Rabbit IgG, Alexa Fluor 488</td>
			<td>Invitrogen</td>
			<td>A-11008</td>
			<td>1:500</td>
		</tr>
		<tr>
			<td>Goat anti-Mouse IgG, Alexa Fluor 555</td>
			<td>Invitrogen</td>
			<td>A-21422</td>
			<td>1:500</td>
		</tr>
		<tr>
			<td>Goat Anti-rabbit IgG/HRP antibody</td>
			<td>APExBIO</td>
			<td>bs-0295G-HRP</td>
			<td></td>
		</tr>
		<tr>
			<td>Knockout serum replacement</td>
			<td>Invitrogen</td>
			<td>10828028</td>
			<td></td>
		</tr>
		<tr>
			<td>Matrigel</td>
			<td>Corning</td>
			<td>356234</td>
			<td></td>
		</tr>
		<tr>
			<td>PrimeScript RT Master Mix</td>
			<td>Takara</td>
			<td>RR063A</td>
			<td></td>
		</tr>
		<tr>
			<td>Progesterone</td>
			<td>Merck</td>
			<td>57-83-0</td>
			<td></td>
		</tr>
		<tr>
			<td>Sprague-Dawley rat&#160;</td>
			<td>Shanghai JieSiJie Laboratory Animals Co., LTD, China</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>SSEA-1</td>
			<td>BioLegend</td>
			<td>323047</td>
			<td>1:20 (FC), APC</td>
		</tr>
		<tr>
			<td>TB Green Fast qPCR Mix</td>
			<td>Takara</td>
			<td>RR820A</td>
			<td></td>
		</tr>
		<tr>
			<td>TriZOL</td>
			<td>Invitrogen</td>
			<td>15596026CN</td>
			<td>RNA extraction</td>
		</tr>
		<tr>
			<td>u-Slide 8-well plates</td>
			<td>Ibidi</td>
			<td>80827</td>
			<td></td>
		</tr>
		<tr>
			<td>Y27632</td>
			<td>TargetMol</td>
			<td>146986-50-7</td>
			<td></td>
		</tr>
		<tr>
			<td>qPCR primers of target genes&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Genes</td>
			<td>Company</td>
			<td>Sequences</td>
			<td></td>
		</tr>
		<tr>
			<td>rat GAPDH F</td>
			<td>Sangon biotech</td>
			<td>GACATGCCGCCTGGAGAAAC</td>
			<td></td>
		</tr>
		<tr>
			<td>rat GAPDH R</td>
			<td>Sangon biotech</td>
			<td>AGCCCAGGATGCCCTTTAGT</td>
			<td></td>
		</tr>
		<tr>
			<td>rat Nanog F</td>
			<td>Sangon biotech</td>
			<td>GACTAGCAACGGCCTGACTCA</td>
			<td></td>
		</tr>
		<tr>
			<td>rat Nanog R&#160;</td>
			<td>Sangon biotech</td>
			<td>CTGCAATGGATGCTGGGATA</td>
			<td></td>
		</tr>
		<tr>
			<td>rat Sox2 F</td>
			<td>Sangon biotech</td>
			<td>ATTACCCGCAGCAAAATGAC</td>
			<td></td>
		</tr>
		<tr>
			<td>rat Sox2 R</td>
			<td>Sangon biotech</td>
			<td>ATCGCCCGGAGTCTAGTTCT</td>
			<td></td>
		</tr>
		<tr>
			<td>rat Oct4 F</td>
			<td>Sangon biotech</td>
			<td>CCCAGCGCCGTGAAGTTGGA</td>
			<td></td>
		</tr>
		<tr>
			<td>rat Oct4 R</td>
			<td>Sangon biotech</td>
			<td>ACCTTTCCAAAGAGAACGCCCA 
			GG</td>
			<td></td>
		</tr>
	</tbody>
</table>

generation and characterization of rat uterus organoids from rat endometrial epithelial stem cells

Endometrial organoids offer valuable insights into the development and pathophysiology of endometrial diseases and serve as platforms for drug testing. While human and mouse endometrial organoids have been developed, research on rat endometrial organoids remains limited. Given that rats can better simulate certain endometrial pathologies, such as intrauterine adhesions, this study aimed to establish rat endometrial organoids. We present a detailed protocol for the isolation and culture of rat endometrial epithelial stem cells (reESCs) and the generation of rat endometrial organoids. Using a refined reESCs expansion medium, we successfully isolated and stably expanded reESCs, demonstrating their long-term culture potential. The reESC-generated organoids exhibited typical structural and functional characteristics of the endometrium, including hormone responsiveness. Our results showed that rat endometrial organoids could be cultured over a long term with stable proliferation, maintaining the glandular structure, cell polarity, and functional characteristics of the endometrial epithelium. This novel rat-derived endometrial organoid model provides a valuable platform for studying endometrial diseases and testing therapeutic interventions, with potential applications across various mammalian species.

The reESCs and rat uterus organoids were established from six female Sprague-Dawley rats weighing between 200 g and 250 g following the protocol outlined in Figure 1. Drawing on the success of the long-term culture of human endometrial epithelial stem cells, the REEM formulation predominantly consisted of Y27632, A8301, and CHIR99021. To stabilize the reESCs in vitro, we initially isolated endometrial cells from rat endometrium using enzymatic and mechanical techniques. Flow cytomet...

Here, we present a protocol to isolate and culture rat endometrial epithelial stem cells (reESCs), generating rat endometrial organoids. This method facilitates in vitro studies of endometrial diseases, enabling gene editing and other cellular manipulations.

Generation and Characterization of Rat Uterus Organoids from Rat Endometrial Epithelial Stem Cells

Endometrial organoids offer valuable insights into the development and pathophysiology of endometrial diseases and serve as platforms for drug testing. ...

generation-characterization-rat-uterus-organoids-from-rat-endometrial

Generation and Characterization of Rat Uterus Organoids from Rat Endometrial Epithelial Stem Cells

Abstract