Electroporation-Based CRISPR-Cas9-Mediated Gene Knockout in THP-1 Cells and Single-Cell Clone Isolation

Summary

The THP-1 cell line is widely used as a model to investigate the functions of human monocytes/macrophages across various biology-related research areas. This article describes a protocol for efficient CRISPR-Cas9-based engineering and single-cell clone isolation, enabling the production of robust and reproducible phenotypic data.

Abstract

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including their interplay with significant human pathogens such as the human immunodeficiency virus (HIV). Compared to other immortalized cell lines of myeloid origin, THP-1 cells retain many intact inflammatory signaling pathways and display phenotypic characteristics that more closely resemble those of primary monocytes, including the ability to differentiate into macrophages when treated with phorbol-12-myristate 13-acetate (PMA). The use of CRISPR-Cas9 technology to engineer THP-1 cells through targeted gene knockout (KO) provides a powerful approach to better characterize immune-related mechanisms, including virus-host interactions. This article describes a protocol for efficient CRISPR-Cas9-based engineering using electroporation to deliver pre-assembled Cas9:sgRNA ribonucleoproteins into the cell nucleus. Using multiple sgRNAs targeting the same locus at slightly different positions results in the deletion of large DNA fragments, thereby increasing editing efficiency, as assessed by the T7 endonuclease I assay. CRISPR-Cas9-mediated editing at the genetic level was validated by Sanger sequencing followed by Inference of CRISPR Edits (ICE) analysis. Protein depletion was confirmed by immunoblotting coupled with a functional assay. Using this protocol, up to 100% indels in the targeted locus and a decrease of over 95% in protein expression were achieved. The high editing efficiency makes it convenient to isolate single-cell clones by limiting dilution.

Introduction

THP-1 is a human monocyte-derived cell line isolated from a patient suffering from acute leukemia (AML), which displays phenotypic features closely resembling those of primary monocytes¹. As compared to primary monocyte-derived macrophages, which do not divide and display both limited lifespan and inter-/intra-donor variability in phenotype, THP-1 cells can be cultured virtually forever and have a more homogeneous behavior that favors results reproducibility^2,3,4,5,6. Notably, THP-1 ....

Protocol

The details of the reagents and the equipment used in this study are listed in the Table of Materials.

1. Guide design with CRISPOR (Figure 1.1)

NOTE: SnapGene Viewer software may be used in steps 4, 7, and 10 to annotate the editing target site and the location of the PCR primer hybridization within the gene of interest.

1. Go to the Ensembl website (www.ensembl.org). In the Search box, select a species and enter the name of the gene of interest. Click on Go. Select the result that cor....

Discussion

Here, a protocol is described to obtain a successful CRISPR-mediated editing of the THP-1 cell line. The approach relies on the transfer of pre-assembled sgRNA/Cas9 RNPs by electroporation/nucleofection. This strategy was chosen to limit the off-target effects that potentially arise upon lentiviral-mediated integration of the sgRNA/Cas9 cassette, yielding persistent expression of the nuclease. Multiple sgRNAs targeting the gene of interest were selected to achieve reliable and efficient editing, which increases the likel.......

Materials

Name	Company	Catalog Number	Comments
0.2 µm syringe filter	ClearLine	146560	_
0.4 % trypan blue	Beckman Coulter	383200	_
1.5 mL tube	Eppendorf	3810X	_
24-well plate	Corning	353047	_
6x TriTrack DNA Loading Dye	Thermo scientific	R1161	_
75 cm² Culture Flask Vented Cap	Corning	353136	_
8-Strip PCR Tubes with Caps	Life technologies	AM12230	_
96-well plates Flat bottom	Corning	353072	_
96-well plates Round bottom	Corning	353077	_
Agarose	Euromedex	D5	_
ATGpr	_	_	https://atgpr.dbcls.jp/
ChemiDoc Imaging System	BIO-RAD	12003153	_
Counting slide	NanoEntek	DHC-N04	_
CRISPOR	_	_	http://crispor.gi.ucsc.edu/
DPBS	Gibco	14190094	_
Ensembl	EMBL-EBI	_	https://www.ensembl.org/index.html
Fetal Bovine Serum	Sigma-Aldrich	F7524	_
FlowJo	BD Life Sciences	v10.10	_
GeneRuler 100 bp Plus DNA Ladder	Thermo scientific	SM0323	_
Genome Data Viewer	NCBI	_	https://www.ncbi.nlm.nih.gov/gdv/
GraphPad Prism	Dotmatics	_	Version 9.3.1
Herculase II Fusion DNA Polymerases	Agilent	600679	_
ICE CRISPR Analysis Tool	Synthego	_	https://www.synthego.com/products/bioinformatics/crispr-analysis
Image Lab Touch	BIO-RAD	_	Version 2.4.0.03
NEBuffer 2	New England Biolabs	B7002S	Included with T7EI M0302S
Neon Kit, 10 µL	Invitrogen	MPK1025K	Electroporation kit containing tips, tubes, buffer R and E
Neon Transfection System	Invitrogen	MPK5000	_
NetStart 1.0	_	_	https://services.healthtech.dtu.dk/services/NetStart-1.0/
Nuclease-free Water	Synthego	_	_
PCR primer (EGFP)	Eurofins	_	Fw : GGAATGCAAGGTCTGTTGAATG ; Rev : CACCTTGATGCCGTTCTTCT
PCR primer (SAMHD1)	Eurofins	_	Fw : CGGGATTGATTTGAGGACGA ; Rev : GGGTGGCAAGTTAGTGAAGA
Penicillin-streptomycin (10,000 U/mL)	Gibco	15140122	_
PFA	Electron Microscopy Sciences	15714	_
PMA	Sigma-Aldrich	P8139	_
PrimerQuest	IDT	_	https://eu.idtdna.com/pages/tools/primerquest
QIAquick PCR Purification Kit	Qiagen	28104	_
QuickExtract DNA Extraction Solution	Biosearch Technologies	QE09050	_
RPMI 1640, GlutaMAX	Gibco	61870010	_
SnapGene Viewer	Dotmatics	_	Version 7
SpCas9 2NLS Nuclease	Synthego	_	_
SYBR Safe DNA Gel Stain	Invitrogen	S33102	_
Synthetic sgRNA (EGFP)	Synthego	_	#1 : CGCGCCGAGGUGAAGUUCGA ; #2 : UUCAAGUCCGCCAUGCCCGA ; #3 : CAACUACAAGACCCGCGCCG
Synthetic sgRNA (SAMHD1)	Synthego	_	#1 : AUCGCAACGGGGACGCUUGG ; #2 : GCAGUCAAGAACCUCGGCGC ; #3 : CCAUCCCGACUACAAGACAU
Syringe Plastipak Luer Lock	BD	301229	_
T100 Thermal Cycler	BIO-RAD	1861096	_
T7 endonuclease I	New England Biolabs	M0302S	_
TAE buffer UltraPure, 10x	Invitrogen	15558026	400 mM Tris-Acetate, 10 mM EDTA
THP-1 cells	ATCC	TIB-202	_
Trypsin-EDTA (0,05 %)	Gibco	25300054	_
ZE5 Cell Analyzer	BIO-RAD	12014135	_