Genler belirlenmesi için VIGS-aracılığı ile İleri Genetik Tarama konakçı olmayan Direnç ilgilendim

Özet

Virus-induced gene silencing is an useful tool for identifying genes involved in nonhost resistance of plants. We demonstrate the use of bacterial pathogens expressing GFPuv in identifying gene silenced plants susceptible to nonhost pathogens. This approach is easy, fast and facilitates large scale screening and similar protocol can be applied to studying various other plant-microbe interactions.

Özet

Bakteriyel patojenlere karşı bitkilerin konakçı olmayan hastalık direnci karmaşık bir savunma yollar ile kontrol edilir. Bu mekanizmanın anlaşılması patojenlerin geniş bir karşı dayanıklı hastalığa dirençli bitkilerin geliştirilmesi için önemlidir. Virüs kaynaklı gen susturulması (VIGS) tabanlı ileri genetik tarama konakçı olmayan direnç aktarmanın bitki savunma genlerin belirlenmesi için yararlı bir yaklaşımdır. Tütün çıngırak virüsü (TRV) tabanlı VIGS vektör bugüne kadar en verimli VIGS vektör ve verimli bir şekilde kullanılmaktadır Nicotiana benthamiana endojen hedef genlerin susturmak için.

Bu yazıda, N. bir cDNA kütüphanesi tek tek klonların susturmak için bir ileri genetik tarama yaklaşımı göstermek benthamiana ve konakçı olmayan patojenlere karşı tehlikeye konakçı olmayan direnç için gen susturulması bitkilerin yanıt değerlendirilmesi, Pseudomonas syringae pv. domates T1, P. syringae pv. glycInea ve X campestris pv. vesicatoria. Bu bakteriyel patojenler ifade GFPuv proteine ​​tasarlanmıştır ve susturuldu hedef gen konakçı olmayan direnç aktarmanın söz konusu ise kendi yeşil Florasanl koloniler konakçı olmayan patojen aşılanmış bitkilerde UV ışık altında çıplak gözle görülebilir. Bu konakçı olmayan patojenlere duyarlı gen susturulması bitkilerin güvenilir ve daha hızlı kimlik kolaylaştırır. Bundan başka, umut verici bir aday gen bilgi TRV vektör bitki geni uç sıralanmasıyla bilinebilir. Burada konakçı olmayan direnç ile ilgili genleri tanımlamak için VIGS-aracılı ileri genetik yüksek verimlilik yeteneği göstermektedir. Yaklaşık, 100 cDNAs ayrı ayrı sonra bir hafta içinde incelenebilir yaklaşık iki üç hafta ve birkaç konakçı olmayan bakteriyel patojenler karşı konakçı olmayan direnç önemleri de susturulabilir. Bu yazıda, bu tarama ile ilgili ayrıntılı adımlar numaralandırmak. VIGS-aracılı ileri genetik Screening yaklaşım, konakçı olmayan direnç katılan genlerin belirlenmesi için değil, aynı zamanda, çeşitli bitki türlerinde çeşitli biyotik ve abiyotik stres tolerans kazandıran genler incelemek için sadece uzatılabilir.

Giriş

Konakçı olmayan direnç belirli bir patojen ^1,2 yarışları karşı tüm bitki türlerinin direncidir. Bu geniş spektrum ve bitkiler ^2,3 dayanıklı hastalık direnci verir. Bununla birlikte, özellikle de bakteriyel patojenlere karşı mekanizması, iyi ⁴ anlaşılmış değildir. Uzlaşma konakçı olmayan direnç ve konakçı olmayan direnç ^5-9 sırasında farklı şekilde ifade genlerin tanımlanması için yüksek verimlilik transkript profil daha önce bakteriyel konakçı olmayan direnç diseksiyon için kullanılan iki ana yaklaşım olduğunu mutantlar veya susturulması bitkiler için tarama. Konakçı olmayan direnç birçok gen, gen tanımlama için bir yüksek verimlilik fonksiyonel genomik yaklaşım katılımı ile karmaşık bir mekanizma (lar) ⁴ tarafından kontrol edildiği için konakçı olmayan direnç mekanizması (ler) daha iyi anlamasını önemlidir.

Virüs kaynaklı gen susturulması (VIGS) başarıyla endojen bitki susturmak için kullanılmıştırBirçok bitki türünün ^10,11 genlerin. Nicotiana benthamiana VIGS ^10,12 ve taslak genom dizisi için en uygun tesislerinden biri şimdi ¹³ kullanılabilir. Tütün çıngırak virüsü (TRV) tabanlı VIGS yaygın olarak ters genetik aracı olarak kullanılmıştır konakçı olmayan direnç ^2,4,14 ilgili genler karakterize etmek. Bu VIGS vektörler ve türevleri Arabidopsis Biyolojik Kaynak Merkezi (ABRC aracılığıyla mevcuttur http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html ). VIGS da bitki bağışıklık ^15-17, özellikle konakçı olmayan direnç ^6,18 katılan genlerin belirlenmesi için ileri genetik aracı olarak kullanılmıştır. Hiperduyarlı cevap (İK)-aracılık ettiği özel bir konakçı olmayan patojene karşı bitkileri kaynaklı hücre ölümü değerlendirilmesi ve hastalığa bağlı hücre ölümü değerlendirmek özellikle TANIMLAMA için kullanılan iki ana tahlillerdirg duyarlı gen bitkiler susturuldu. Ancak, İK hücre ölümü tek tip-II konakçı olmayan patojenlere karşı indüklenir değil, tip I konakçı olmayan patojenler ² karşı. Bu nedenle, İK deneyleri evrensel özellikle tip-I konakçı olmayan patojenlerin geniş bir karşı, bitkiler tarafından kullanılan konakçı olmayan direnç stratejilerini belirlemek için kullanılamaz. Ayrıca, bir genin susturulması bitki konakçı olmayan direnç kısmi kaybı her zaman hastalık belirtileri ⁶ ve dolayısıyla hastalık puanlama konakçı olmayan direnç ödün bitkilerin belirlenmesi için kullanılamaz yol açmaz. Aksine, genin susturulması konakçı olmayan bitkilerde patojen büyüme değerlendirilmesi genin susturulması konakçı olmayan bitkilerde direnç kaybı eğitim için daha iyi bir yöntemdir.

Geleneksel büyüme deneyi ^6,19, genin susturulması konakçı olmayan bitkilerde bakteri üremesi değerlendirmek için hızlı bir yöntem ile karşılaştırıldığında, ileri genetik taraması için gereken zamanı kısaltır. Daha önce bakteri gözlemlemek için bir yöntem raporultraviyole altında çıplak gözle yapraklarda l patojen büyüme (UV) açık yeşil floresan proteininin (GFP) ¹⁹ ifade bakteri kullanarak. Bu yazıda biz konakçı olmayan direnci için tehlikeye gen susturulması bitki kolay tanımlama için konakçı olmayan bakteriyel patojenler ifade GFPuv yararlılığını göstermektedir. Bu metodoloji duyarlı bitkilerin belirlenmesi için doğru ve yüksek verimli görüntüleme için müsait.

Protokol

1. Plant Growth and Target Gene Silencing

1. Plant growth conditions:
   1. Sow N. benthamiana seeds on soil-less potting mixture, Metro-Mix 350 and germinate the seeds in a growth chamber. Any other soil or soil-less medium can also be used instead of Metro-Mix.
   2. Transplant three-week old seedlings into individual pots and grow them in a greenhouse maintained at 21±2 °C along with other growth conditions as detailed in previous literature¹². Two to three days after transplanting, plants can be used for TRV inoculation.
2. Growing TRV2 clones:
   TRV is a bipartite virus and its genome consists of RNA1 and RNA2. RNA1 encodes an RNA-dependent RNA polymerase and a movement protein^20,21. RNA2 encodes a coat protein (CP) and two nonstructural proteins from the subgenomic RNAs²¹. Both RNA1 and RNA2 are required for the formation of matured virus particles and their spread^20,21. cDNA library construction in TRV2 vector is described in previous literature^22,23. Briefly, VIGS library used in this study was constructed from the RNA extracted from leaf tissues exposed to various biotic and abiotic elicitors.
   1. Take out Agrobacterium (GV2260 strain) containing the cDNA clones in TRV2 vector (a 96-well plate) from the freezer. Gradually thaw them and after the cultures reach room temperature, inoculate the individual Agrobacterium culture onto Luria-Bertani (LB) agar plate with rifampicin (10 μg/ml) and kanamycin (50 μg/ml) using a 96-pin replicator.
   2. Incubate the plates at 28 °C for two days. We usually grow four replicate colonies for each clone so that adequate Agrobacterium inoculum is available for prick inoculation of two plants. Perform all the steps under sterile conditions.
3. VIGS:
   1. Grow Agrobacterium (GV2260) carrying TRV1 at 28 °C in LB liquid medium with antibiotics mentioned above. Harvest cells by centrifugation from overnight grown cultures, re-suspend in the inoculation buffer (10 mM MES, pH 5.5; 200 μM acetosyringone), and incubate for 3 hr at room temperature on a shaker at 50 rpm.
   2. Harvest the cells by centrifugation and re-suspend in 5 mM MES buffer (pH 5.5) and inoculate (OD₆₀₀ = 0.3) into abaxial side of 3-4 N. benthamiana leaves using a needleless syringe. Detailed inoculation procedure is demonstrated in previous literature²⁴. Later, at the site of TRV1 inoculation, inoculate respective TRV2 colonies by pricking the leaves with a toothpick.
   3. Maintain the plants with adequate nutrition as vigorous growth is important for efficient VIGS¹². About two weeks post inoculation the transcripts of targeted genes will begin to reduce and the plants are ready for pathogen inoculation at three weeks after TRV inoculation.

2. Preparation of Nonhost Pathogen Cultures and Plant Inoculation

1. Details of pathogens used in this study:
   Pseudomonas syringae pv. tabaci, P. syringae pv. tomato T1, P. syringae pv. glycinea and Xanthomonas campestris pv. vesicatoria are used in this study. Grow P. syringae strains in King's B (KB) liquid medium supplemented with rifampicin (10 μg/ml), kanamycin (50 μg/ml) at 28 °C for 12 hr. Grow X. campestris pv. vesicatoria in LB liquid medium for 16 hr. All pathogens harbor a plasmid that can express GFPuv as described in previous literature¹⁹.
2. Preparation of pathogen cultures for plant inoculation:
   1. Harvest bacterial cells by centrifugation and confirm the presence of green fluorescence using long wavelength UV lamp in the dark. Wash the cells twice with sterile water and re-suspend them to the desired concentration using sterile water.
   2. Inoculate the respective pathogen(s) on to abaxial side of target gene silenced leaves (5^th to 8^th) as spots (about 1.5 cm diameters). Several nonhost pathogens can be simultaneously tested for their growth in the target gene silenced plants. Simultaneously inoculate the host pathogen as this can be used as a positive control for viewing in planta bacterial growth. Also inoculate vector control (TRV::00) plants.

3. Observation of in planta Growth of Bacterial Pathogens

1. Expose the inoculated leaves to a long wavelength UV light in the dark. Bacterial colonies can be viewed as green fluorescent dots in the abaxial side of the leaf in the background of red fluorescence emitted by leaf surface.
2. Observe pathogen growth from 2 days post inoculation (dpi) to 5 dpi. Everyday observation during this time interval is necessary.
3. After the first screen, short list the clones whose silencing results in growth of one or more nonhost pathogen(s).
4. Repeat VIGS for the selected clones and again test the response of gene silenced plants to nonhost pathogen(s). This second level of screening is done to remove the false positives obtained during the first screen.

4. Confirmation of Shortlisted Plants for Compromised Nonhost Resistance

1. Silence the cDNA clones selected from the screen as described above. Inoculate the whole plant with nonhost pathogen(s) by submerging the plants with respective pathogen cultures with 0.01% (v/v) Silwet L-77 and subjecting the submerged plants to vacuum for 3 - 5 min. Quantify the bacterial growth by conventional growth assay^6,18,19 as described below.
2. At 0 hr post inoculation (hpi), 3 dpi and 5 dpi, collect two leaf samples from five biological replicates for each nonhost pathogen(s) inoculated leaves using a leaf punch (0.5 cm²). Grind the leaf samples, serial dilute and plate the sap on KB agar medium supplemented with appropriate antibiotics and incubate at 28 °C for 2 days. Count the bacterial colonies using a colony counter and calculate the bacterial growth in the leaves as described in previous literature⁶.
3. Plants susceptible to nonhost pathogen(s) should show higher number of pathogen growth compared to vector control.

5. Sequencing the Insert and Identification of Target Gene

1. Perform colony PCR for the selected clone using attB1 and attB2 primers or using the primers flanking the cloning site in the TRV2 vector. Run the PCR product on the gel and check for amplification of the single band.
2. Plant gene insert in the TRV2 vector can be sequenced using attB primers or primers flanking the cloning site.
3. Perform BLAST using the sequence and identify the gene details.
4. Obtain full length gene sequence along with the un-translated regions (UTRs).
5. Select 300-400 bp fragments from three different regions of the sequence and clone them into TRV2 vector. Independently perform VIGS using all three VIGS constructs and confirm the compromise of nonhost resistance in all three gene silenced plants.

Sonuçlar

Major aim of this study is to demonstrate a method for easy and accurate identification of gene silenced N. benthamiana plants that are compromised for nonhost resistance. There are four major steps in this methodology. First step is to individually silence large number of genes using TRV-VIGS. We had silenced about 5,000 genes^6,18 over a period of about 1.5 years using the protocol depicted in Figure 1. Some of the gene silenced plants showed various phenotypic alterations includin...

Tartışmalar

Plant immunity limits the growth of nonhost pathogens and hence, little or no green fluorescence is emitted from vector control plant leaves inoculated with nonhost pathogen under long wavelength UV light (Figure 3D). However, when a gene involved in nonhost resistance is silenced, the gene silenced plants favor the growth of nonhost pathogen and green fluorescence is seen (Figure 3E). This is the basic principle involved in the method described in this manuscript. This methodology has...

Malzemeler

Name	Company	Catalog Number	Comments
96-well U-bottom plates	Becton Dickinson Labware (Franklin Lakes, NJ, USA)	35-3077
96-pin replicator stainless steel	Nalge Nunc International (Naperville, IL, USA)	250520
High Intensity UV Inspection Lamps, Model B-100ap	Thomas scientific (Swedesboro, NJ, USA)	6283K50	Manufacturer ID 95-0127-01
Stuart SC6 colony counter	Bibby Scientific Limited, Staffordshire, UK	SC6PLUS
Soil-less potting mixture, Metro-Mix 350	SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)
Primers: attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT) attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)	Integrated DNA Technologies, Inc (Coralville, IA, USA)	Custom synthesized
MES, Monohydrate	VWR international (Radnor, PA, USA)	CAS No. 145224-94-8
Acetosyringone (Dimethoxy-4’-hydroxyacetophenone)	Sigma Aldrich (St. Louis, MO, USA)	D134406
Vac-In-Stuff (Silwet L-77)	Lehle Seeds (Round Rock, TX, USA)	VIS-30