Saccharomyces cerevisiae'de Tek Kopya Gen Lokus Kromatin Saflaştırması

Özet

Bu protokol, tomurcuklanan maya, Saccharomyces cerevisiae'den doğal kromatin bağlamında ilgilenilen tek kopyalı bir gen lokusunu saflaştırmak için bölgeye özgü rekombinasyona dayalı lokusa özgü bir kromatin izolasyon yöntemi sunar.

Özet

Ökaryotik kromatinin temel organizasyon birimi, bir histon oktamerinin etrafına ~1.7 kez sarılmış DNA'yı içeren nükleozom çekirdek parçacığıdır (NCP). Kromatin, NCP'lerin ve transkripsiyon faktörleri, kromatin yeniden şekillenmesi ve modifiye edici enzimler dahil olmak üzere çok sayıda başka protein kompleksinin varlığı olarak tanımlanır. Bu protein-DNA etkileşimlerinin, hücre döngüsünün farklı aşamalarında spesifik genomik lokuslar düzeyinde nasıl düzenlendiği hala belirsizdir. Bunun başlıca nedeni, bu tür dinamik etkileşimlerin hassas ölçümlerini elde etmeyi zorlaştıran mevcut teknik sınırlamalardır. Burada, doğal kromatin durumunda ilgilenilen tek kopyalı bir gen lokusunu izole etmek için bölgeye özgü rekombinasyonu verimli bir tek adımlı afinite saflaştırma protokolü ile birleştiren geliştirilmiş bir yöntemi açıklıyoruz. Yöntem, hedef lokusun genomik kromatin üzerinde sağlam bir şekilde zenginleştirilmesine izin vererek, bu tekniği protein etkileşimlerini tarafsız ve sistematik bir şekilde, örneğin kütle spektrometrisi ile tanımlamak ve ölçmek için etkili bir strateji haline getirir. Bu tür bileşimsel analizlere ek olarak, bu yöntemle saflaştırılan doğal kromatin, muhtemelen nükleozom konumlandırma ve histon modifikasyonları ile ilgili in vivo durumu yansıtır ve bu nedenle, mayadaki hemen hemen her genomik lokustan türetilen kromatinin daha ileri yapısal ve biyokimyasal analizlerine uygundur.

Giriş

Ökaryotik genomların kromatine dinamik organizasyonu, DNA'yı çekirdeğin sınırlarına sığacak şekilde sıkıştırırken, gen ekspresyonu için yeterli dinamikleri ve düzenleyici faktörler için erişilebilirliği sağlar. Kısmen, bu çok yönlülüğe, histon oktamer^1'in etrafına ~1.7 kez sarılmış 147 bp DNA'ya sahip bir çekirdek parçacığı içeren kromatinin temel birimi olan nükleozom aracılık eder. Nükleozom, N ve C terminal histon kuyruklarında çok sayıda histon varyantı ve posttranslasyonel modifikasyon (PTM'ler) ile bileşimine göre oldukça dinamik bir yapıdır. Ayrıca, ökaryotik kromatin, transkripsiyon faktörleri, DNA ve RNA işleme makineleri, mimari prote....

Protokol

Bu protokolde kullanılan tüm malzeme ve aletlerle ilgili ayrıntılar için Malzeme Tablosuna bakın. Kullanılan çözümlerin, arabelleklerin ve ortamların listesi için Tablo 1'e bakın.

1. Rekombinant maya suşu yapısı

1. Rekombinasyona yetkin bir maya suşu oluşturmak için, SbfI ile sindirilmiş plazmid K238'i, ilgilenilen lokusta entegre LexA bağlanma bölgeleri ve RS rekombinasyon bölgeleri olan bir maya suşuna dönüştürün^13,14.
   NOT: Dönüştürülmüş SbfI kısıtlama fragmanı, ekspresyon kasetinin homolog rekombinasyon ile genomik ente....

Tartışmalar

Belirli bir hedef genomik bölgenin faktörlerinin ve kromatin manzarasının tanımlanması, kromatin araştırmalarında büyük bir zorluk oluşturmaya devam etmektedir¹⁸. Bu protokol, maya kromozomlarından farklı kromatin alanlarını spesifik olarak çıkarmak ve saflaştırmak için etkili bir sistemi tanımlar. Bildiğimiz kadarıyla, bu tek aşamalı saflaştırmanın saflığı ve verimi, lokusa özgü kromatin saflaştırma yöntemlerinin birçok sınırlamasının üstesinden gelir, b.......

Malzemeler

Name	Company	Catalog Number	Comments
Yeast strains
Control Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR			Section 1, see references 13 and 14
Recombination Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; RS_LEXA_NS-3_ARS316_NS+3_RS; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR			Section 1, see reference 13 and 14
Plasmid
K238 plasmid			Section 1, see reference 13 Storage: Store at -20 °C
K071 Spike-in plasmid DNA			Section 7.1, see reference 13 Storage: Store at -20 °C
Reagents
Acetone	Carl Roth	5025.1	Section 2 Storage: Store at room temperature
Ammonium acetate (NH4Ac)	Sigma Aldrich	A7262	Section 6 and 7.1 Storage: Store at room temperature
Ammonium solution (NH4OH) 25%	Merck Millipore	533003	Section 6 Storage: Store at room temperature
Ammonium sulfate	Santa Cruz	Sc-29085	Section 2 Storage: Store at room temperature
Bacto agar	BD (VWR)	90000-760	Section 3 Storage: Store at room temperature
Bacto peptone	BD (VWR)	211820	Section 3 Storage: Store at room temperature
β-Mercaptoethanol	Sigma Aldrich	07604	Section 7.2 Storage: Store at 4 °C
Chemiluminescent substrate kit	ThermoFisher	34580	Section 7.2 Storage: Store at 4 °C
Di-Sodium Hydrogen phosphate dodecahydrate	Merck	1.06579.1000	Section 2 and 7.1 Storage: Store at room temperature
Dithiothreitol (DTT)	ThermoFisher	15508013	Section 4 Storage: Store at 4 °C
Ethanol	Merck	100983	Section 7.1 Storage: Store at room temperature
Ethylenediaminetetraacetic acid (EDTA)	Sigma Aldrich	ED	Section 7.1 Storage: Store at room temperature
Galactose (20% (w/v) stock)	Sigma Aldrich	G0625-1KG  /  5KG	Section 3 Storage: Store at room temperature
Gel loading dye (6x)	BioLabs	B7024A	Section 7.1 Storage: Store at -20 °C
Glusose	Sigma-Aldrich	G8270	Section Storage: Store at room temperature
Glycine	Carl Roth	.0079.4	Section 2 Storage: Store at room temperature
Glycogen (5 mg/mL)	Invitrogen	AM9510	Section 7.1 Storage: Store at -20 °C
Hydrochloric acid (HCl)	PanReac AppliChem	182109.1211	Section 2, 4 and 7.1 Storage: Store at room temperature
Magnesium Acetate (MgAc)	Bernd Kraft	15274.2600/C035	Section 4 Storage: Store at room temperature
Magnesium chloride (MgCl2)	Sigma Aldrich	M8266	Section 6 Storage: Store at room temperature
Nu PAGE LDS sample buffer (4x)	Invitrogen	2399549	Section 7.2 Storage: Store at room temperature
Phenol/Chloroform/Isoamyl alcohol (25:24:1 v/v)	Invitrogen	15593-031	Section 7.1 Storage: Store at 4 °C
Potassium chloride (KCl)	Sigma	P9541	Section 4 Storage: Store at room temperature
Radioactively labeled α-32P dATP (3,000 Ci/mmol, 10 mCi/mL)	Hartmann Analytic	SRP-203	Section 7.1 Storage: Store at 4 °C
RadPrime labeling system	ThermoFisher	18428-011	Section 7.1 Storage: Store at -20 °C
Raffinose (20% (w/v) stock)	SERVA	34140.03	Section 3 Storage: Store at room temperature
Sodium chloride (NaCl)	Merck	K53710504142	Section 7.1 Storage: Store at room temperature
Sodium citrate (Na3C6H5O7)	Sigma-Aldrich	71402	Section 7.1 Storage: Store at room temperature
Sodium hydroxide (NaOH)	Sigma Aldrich	S5881	Section 7.1 Storage: Store at room temperature
Sodium n-dodecyl sulfate (SDS) (5% stock (w/v) )	Alfa Aesar	A11183	Section 7.1 Storage: Store at room temperature
Sodium phosphate monobasic	Sigma-Aldrich	71496	Section 2 and 7.1 Storage: Store at room temperature
Sodium azide	Santa Cruz Biotechnology	sc-208393	Section 2 Storage: Store at -20 °C
Triethylamine	Sigma Aldrich	90340	Section 2 Storage: Store at room temperature
Tris base	Chem Cruz	SC-3715B	Section 2 and 4 Storage: Store at room temperature
Triton X-100	Sigma Aldrich	X100	Section 2 and 4 Storage: Store at room temperature
Tween-20	Bernd Kraft	18014332	Section 4 Storage: Store at room temperature
Yeast extract	BD (VWR)	212720	Section 3 Storage: Store at room temperature
Yeast mating factor alpha (1 µg/mL stock )	Biomol	Y2016.5	Section 3 Storage: Store at -20 °C
Yeast Synthetic Drop-out medium Supplements without LEUCINE	Sigma Aldrich	Y1376	Section 1, see reference 14
Enzymes
HpaI restriction enzyme (5,000 U/mL)	NEB	R0105S	Section 7.1 Storage: Store at -20 °C
Protease and Phosphatase Inhibitor Cocktail (100x)	ThermoFisher Scientific	78446	Section 4 Storage: Store at4 °C
Proteinase K (10 mg/mL)	SERVA	33756	Section 7.1 Storage: Store at -20 °C
RNase A (10 mg/mL)	ThermoFisher	EN0531	Section 7.1 Storage: Store at -20 °C
TEV protease (10000 U/µL)	NEB	P8112S	Section 5 Storage: Store at -20 °C
Materials
BcMag Epoxy-Activated Magnetic Beads	Bioclone Inc.	FC-102	Section 2 Storage: Store at 4 °C
Dry ice			Section 4
Low-binding centrifuge tubes 2.0 mL	Eppendorf	22431102	Section 4
Microspin G-25 Columns	Cytiva	27-5325-01	Section 7.1 Storage: Store at room temperature
Parafilm	Merck	P7793	Section 4
Positive nylon membrane	Biozol	11MEMP0001	Section 7.1 Storage: Store at room temperature
PVDF transfer membrane	Immobilon-Merck Millipore	IPVH00010	Section 7.2 Storage: Store at room temperature
SDS-PAGE gel 4-12% bis-tris (15 well, 1.5 mm)	Invitrogen	NP0336BOX	Section 7.2 Storage: Store at 4 °C
Syringe (25 mL) with luer fitting	Henke Sass Wolf	4200-000V0	Section 3
Whatman paper (Grade 3MM CHR Cellulose Western Blotting Paper Sheet)	Cytiva	3030-917	Section 7.1 Storage: Store at room temperature
Antibodies
Anti-LexA, rabbit polyclonal IgG, DNA binding region antibody	Merck Millipore	06-719	Section 7.2 Storage: Store at -20 °C
Goat Anti-Rabbit IgG (H+L), Horseradish peroxidase conjugate	Invitrogen	G21234	Section 7.2 Storage: Store at -20 °C
Peroxidase Anti-Peroxidase (PAP) antibody produced in rabbit for the detection of TAP-tagged proteins	Sigma Aldrich	P1291-500UL	Section 7.2 Storage: Store at -20 °C
Rabbit IgG antibodies	Sigma	I5006-100MG	Section 2 Storage: Store at 4 °C
Primers (10 µM)
ARS316: fwd 5'- CGGCATTATCGTACACAACCT, rev 5'- GTTCTTCGTTGCCTACATTTTCT			Section 7.1
K071 Spike-in plasmid DNA: fwd: 5'-TTTTCGCTGCTTGTCCTTTT, rev 5'- CATTTTCGTCCTCCCAACAT			Section 7.1
PCR fragment from yeast genomic DNA as a template  for ARS316 amplification (for southern blot): fwd 5’- AAATTCTGCCCTTGATTCGT                                                  rev 5’- TTTGTTTATCTCATCACTAAT			Section 7.1
PDC1: fwd 5'- CATGATCAGATGGGGCTTCA, rev 5'-ACCGGTGGTAGCGACTCTGT			Section 7.1
Equipment
Coffee grinder	Gastroback	42601	Section 4
Dewar flask	NAL GENE	4150-2000	Section 3
DynaMag TM-2 magnetic rack	Invitrogen	12321D	Section 4, 5 and 6
Hybridization oven	Hybaid Mini10	Ri418	Section 2
Microcentrifuge	Eppendorf	5424R	Section 4 and 7.1
UV-crosslinker	Analytikjena	95-0174-02	Section 7.1