S. Zhang is funded by China Scholarship Council. The authors are very grateful to former people working on polyketomycin project in this lab and Prof. Dr. Hans-Peter Fiedler, University of T&#252;bingen, for providing the polyketomycin producer. The research was supported by the DFG (RTG 1976).

Antibiyotik Mülkiyet ile Doğal Ürün 1. Kimlik <ol><li> &quot;OSMAC (bir suş-çok bileşikleri) yaklaşımı&quot; 13 aşağıdaki farklı koşullar altında bir mikroorganizmanın (örneğin zaman, sıcaklık, pH, medya) Yetiştirmek. bir bileşiğin üretimi gözlendiği bir orta seçin. </li><li> Aşağıdaki koşullar altında Streptomyces diastatochromogenes Tü6028 yetiştirmek <ol><li> MS plakaları üzerinde Streptomyces diastatochromogenes Tü6026 suşu büyütün (soya unu 20 g D-mannitol, 20 g, MgCl2 10 mM,% 1.5 ağar, musluk suyu 1 L). bir spiral bir Erlenmeyer şişesi içinde, küçük bir 20 mL sıvı TSB ortamı içinde, bu soyu sporlarının döngü (ön kültür ortamı triptik soya suyu 30 g, musluk suyu 1 L, pH 7.2) aşılamak. bir döner sallayıcı (28 ° C, 180 rpm, 2 gün) çalkalanır. </li><li> 100 ml HA ortamında (glükoz 4 g, maya ekstresi, 4 g, malt ana kültürü inoküleön kültürün 2 mL, 10 g, musluk suyu 1 L, pH 7.2) ekstrakte edin. Kültür, 180 rpm&#39;de bir döner sallayıcı üzerinde 6 gün boyunca 28 ° C &#39;de streyn. </li></ol></li><li> Ham ekstrenin hazırlanması <ol><li> santrifüj Hasat hücreleri (10 dk, 3000 xg). </li><li> Bir sonraki adımlar için bir davlumbaz altında organik çözücüler anlaştım. </li><li> miselyumdan bileşiği ekstre için, tekrar süspansiyon aseton iki kat hacminde hücre ve 30 dakika, 180 rpm&#39;de bir tüp içinde çalkalanır. Ticari filtre kağıdından sıvı filtre edin ve 40 ° C ve 550 bar, döner bir buharlaştırıcı ile aseton buharlaştırılır. : etil asetat, 20 mL su içinde çözülür özü (1: 1) ve 180 rpm&#39;de 30 dakika için bir ayırma hunisi içerisinde çalkalayın. </li><li> kültür ortamından bileşiği ekstre için, 1 N HCI ilave edilerek pH 4.0 kültür suyu ayarlayın. 100 ml etil asetat ilave edin ve 30 dakika, 180 rpm&#39;de bir ayırma hunisinde sallayın. </li><li> Etil asetat fazı toplayın ve çürüme ile buharlaşması<html> 40 ° C&#39;de ve 240 barda li buharlaştırma. </li></ol></li><li> HPLC ile yapılan ham ekstrakt analizi <ol><li> , 1 mL MeOH içinde çözülür özleri 0.45 um gözenek boyutlu filtre içinden filtre ve yüksek performanslı sıvı kromatografisi (HPLC) 14 çalıştırın. </li><li> Polyketomycin durumunda, bir C18 Kolon öncesi (4.6 x 20 mm 2) ve bir C18 kolonu (4.6 x 100 mm x 2) HPLC sistemi donatılması. H% 20 ile% 95 arasında değişen asetonitril +% 0.5 asetik asit arasındaki bir doğrusal eğimi kullanarak 2 O +% 0.5 asetik asit (akış hızı: 0.5 ml dak-1). Not: Polyketomycin 25.9 dakikalık bir tutma süresine sahip (Şekil 1A bakınız). UV / vis spektrumu 262 nm ve 359 nm 242 nm, 282 nm, 446 nm ve minimum de maksimumu vardır (Şekil 1B bakınız). Negatif modus 863,2 [MH] + bir kitle - (Şekil 1C bakınız) tespit edilebilir. </li></ol></li></ol>&quot;Src =&quot; / files / ftp_upload / 54952 / 54952fig1.jpg &quot;/&gt; Şekil 1: Polyketomycin LC / MS analizi. 6 gün Streptomyces diastatochromogenes Tü6028 büyütüldükten sonra ham ekstre (A) olarak hazırlanmıştır HPLC kromatogramı (λ = 430 nm). Polyketomycin / vis spektrumları Polyketomycin 25.9 dakika (B), bir UV Tutma süresi vardır. Negatif yöntemlerinde de Polyketomycin (C) Kütle spektrumu. M / z 863,2 ile ana pik [MH] + -. <a href="http://ecsource.jove.com/files/ftp_upload/54952/54952fig1large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <ol start="5"><li> Antibiyotik aktivitesinin tanımlanması disk difüzyon deneyi kullanılarak <ol><li> Gram-pozitif bakteriler, Bacillus subtilis gibi test suşları inoküle (LB ortamında LB 20 g, musluk suyu 1 L pH 7.4) ve TSB ortamı diğer Streptomyces soyları (; triptik soya suyu 30 g, musluk suyu 1 L, pH 7.2), Gram-negatif bakteriler Escherichia LB ortamında coli () ve YPD ortamı olarak ortam mantar suşları (; maya özü, 10 g, pepton 20 g, glukoz 20 g, musluk suyu 1 L, pH 7,4). Test suşu ön kültürün 100 mcL alın ve ilgili agar plakaları üzerine onları yayıldı. </li><li> steril kağıt diskler üzerinde metanol (alternatif olarak, su ya da DMSO) ve pipet 20-50 uL 500 uL ham ekstresi ya da saflaştırılmış bileşik içinde çözülür. tezgaha altında 30 dakika süreyle kuru kağıt diskler ve test kültürleri ile plakalar üzerine koydu. Bir negatif kontrol (çözücü) ve pozitif kontrol hazırlanması (antibiyotik, örneğin apramisin [1 mg]). </li><li> Test suşları gözle görülür yetiştirilen kadar yeterli koşullar altında inkübe ve belirgin olursa, inhibisyon zonu belirler. E. coli ve Bacillus sp inkübe edin. 16 saat 37 ° C&#39;de, Streptomyces sp. 2-4 gün süreyle 28 ° C &#39;de, mantar soyu (kesin testi soy esas bağlıdır)t, 2 gün boyunca 30 ° C). </li></ol></li></ol> Bileşik 2. Büyük çaplı ekstraksiyon, arıtılması ve yapısının açıklanması <ol><li> (Suya 1 L, pH 7.2 dokunun glikoz 4 g, maya özü 4 g, malt özü 10 g) 5 L HA ortamında S. diastatochromogenes Yetiştirmek. 150 ml HA ihtiva eden ortam 30 x 500 mL&#39;lik Erlenmeyer şişelerinde ön-kültüre bırakılmıştır 2 mL inoküle. 180 rpm&#39;de döner çalkalayıcıda, 6 gün boyunca 28 ° C&#39;de soy inkübe edin. </li><li> santrifüj Hasat hücreleri (10 dk, 15.000 xg, RT) ve etil asetat kullanılarak özü bileşikleri (bölüm 1.3). </li></ol><img alt="şekil 2" src="/files/ftp_upload/54952/54952fig2.jpg" /> Şekil 2: yapı aydınlatmalarında için iş akışı. proses soyunun (1) işleme, (2) ekstraksiyon, katı faz ekstraksiyonu (SPE), ince tabaka kromatografisi (TLC), preparatif yüksek performanslı sıvı kromatografisi (HPLC), boyut (3) ile saflaştırma içermesidirkütle analizi (MS), nükleer manyetik rezonans (NMR) ve X-ışını ölçümleri ile dışlama kromatografisi (SEC) ve (4) yapısının açıklanması,. <a href="http://ecsource.jove.com/files/ftp_upload/54952/54952fig2large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <ol start="3"><li> Polyketomycin saflaştırılması Not: arıtılması ve yapısının açıklanması işlemi, Şekil 2&#39;de gösterilmektedir. <ol><li> H2O içinde% 30 ila% 100 MeOH kadar% 10 -stepwise MeOH gradyanı, her durum için, 100 mL kullanılarak bir C 18 katı faz ekstraksiyonu (SPE), kolon Ham özü fraksiyonlanması. </li><li> (1: 7) ve elüsyon sistemi hazırlayıcı ince-tabaka kromatografisi (TLC), 15 ile CH2C! 2 / MeOH ayrıca, bileşimin ihtiva fraksiyonu saflaştırılır. </li><li> Hazırlayıcı HPLC 16 ile bileşiğin saflaştınlır. ve, bir C18 Kolon öncesi (9.4 x 20 mm 5 um) ile HPLC sistemi donatmakAna kolonu (5 um, 9.4 x 150 mm). H% 20 ila% 95 2 O +% 0.5 asetik asit kadar asetonitril +% 0.5 asetik asit meyili kullanarak (akış hızı: 2.0 mL / dakika). </li><li> Çözücüler ve diğer küçük safsızlıkları uzaklaştırmak için, MeOH 17 bir kolon kullanılarak boyut dışlama kromatografisi ile son saflaştırma adımı gerçekleştirmek. Nihai saf bileşiği toplamak ve 40 ° C ve 240 bar, döner buharlaştırma ile MeOH buharlaşır. </li></ol></li><li> yapı aydınlatılması <ol><li> DMSO-d6 içinde (makineye bağlı olarak) 600-700 uL saf bileşiği (en fazla 2 mg), kayıt 1D NMR (1H, 13 ° C) ve 2D NMR (HSQC, HMBC, 1H 1 H çözülür bir NMR spektrometresi 18 COSY) spektrumları. DMSO-d6 kullanılarak δ değerleri (ppm) cinsinden kimyasal deplasmanlar ifade eder. </li><li> Yüksek çözünürlüklü kütle spektrumu (HRESI-MS) yüksek çözünürlük kullanarak polyketomycin 19. kaydedinkütle spektrometresi. </li><li> NMR ve MS veri analizi 10 sonuçlarının yorumlanması ile yapısını aydınlatmak. </li></ol></li></ol> 3. Yeni İzole Bileşik Biyosentetik Modeli Propose <ol><li> İzole bileşiğin yapısını analiz ve biyosentezi dahil olabilir enzimler, tahmin. Poliketid (tip I, II ya da III), ribozomal olmayan peptid sentezi, lantipeptide terpenoid veya şeker metabolizması yolu 8 bunları atar. </li><li> Örnek polyketomycin <ol><li> tetrasiklik parçasının, iki monosakkaritler ve dimetil salisilik asit: bariz tek kısımlarının içine yapısını Subdivide. </li><li> kısımlardan türetilen durumunda, bu bul: tetrasiklik kısmı bir poliketit sentaz türünden türetilmiş olabilir II ve dimetil salisilik asit yarımı yinelemeli bir poliketit sentaz tip I ile elde edilebilir 6-deoxysugars iki şeker bölümlerine, , synthesi olabilirZed biyosentez sırasında TDP-glukoz-4,6-dehidrataz ve iki glikosiltransferazların muhtemelen bağlanmış ilgili glikozdan (bakınız Şekil 3) 8. </li><li> kümede varsayılan genleri tahmin. birimlerini bağlayan olarak, hem de değiştirme ve molekül dikiş olarak, tek kısımların sentezinde rol oynayan enzimlerin düşünün. Polyketomycin biyosentetik gen kümesi muhtemelen (genişletici birimleri bağlamak için bu nedenle en az bir ACP, KS α und KS β) bir poliketid sentaz tip II kodlayan genleri içeren bir iteratif poliketid sentaz tip I (en azından ACP, AT, KS), bir TDP-glukoz-4,6-dehidrataz (adım için gerekli: glikoz → deoksiglukoz) ve iki glıkosıltransferaz (aglikona iki şeker monomerleri bağlayan) 8. </li></ol></li></ol><img alt="Şekil 3," src="/files/ftp_upload/54952/54952fig3.jpg" /> Şekil 3: Polyketomycin divId deki YapıTek Yapı Taşları içine ed. Polyketomycin β-D-amicetose ve α-L-axenose (MDP-glukoz-4,6, iki deoksi şeker kısımları ile bağlantılı bir tetrasiklik decaketid (PKS tip II) ve dimetil salisilik asit (yinelemeli PKS tip I) oluşmaktadır ) dehidrataz ve iki glikosiltransferaz gerektirir. <a href="http://ecsource.jove.com/files/ftp_upload/54952/54952fig3large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> 4. Genomu Sıralama / Madencilik <ol><li> Yeni nesil dizileme <ol><li> Illumina, 454, piro veya katı 20 gibi gelecek nesil dizileme teknolojileri ile genomik DNA sekansı. Tek hizalayın bir referans dizisi okur veya de novo araya. NOT: S. diastatochromogenes Tü6028 genomu Bielefeld Üniversitesi Biyoteknoloji Merkezi (CeBiTec) de sıralandı. Tüm taslak genomuna monte edilmiştir okur7.9 Mb. </li></ol></li><li> genom madenciliği <ol><li> Örnek NCBI Prokaryotik Genom Açıklaması Boru Hattı 21,22 için, RAST 23,24,25, Prokka (hızlı prokaryotik genom açıklama) 26 veya GenDB 27 (hızlı açıklama alt teknolojisini kullanarak) kullanımı ile açık okuma çerçeveleri (ORF) ara. Bu programlar da onların işlevlerini öneriyoruz. S. analizi 7.000 &#39;den fazla ORF belirlenmesine yol açmıştır Tü6028 taslak genom dizisi diastatochromogenes. </li><li> Run özel BLAST (Temel Lokal Hizalama Arama Aracı) analizi, diğer benzer genlerin ve katalitik etki 28,29,30 ile hizalanmalarda gibi daha fazla bilgi almak için. </li><li> AntiSMASH 31,32,33, NaPDoS 34 ve NRPSpredictor 35,36 gibi ikincil metabolit gen küme çalışma programlarının belirlenmesi için. Streptomyces diastatochromogenes antiSMASH 31,32,33 kimliğin taslak genomunda22 gen kümeleri fied. </li><li> enzimatik yol (lar) için olası bir gen kümeleri (poliketid sintazı (tip I, II ya da III), ribozomal olmayan peptid sintetaz, lanthipeptide terpenoid, şeker metabolizması ...) analiz eder. bileşiğin sentezinde rol oynayabilecek genleri içeren küme (ler) ara (Bölüm 3). S. diastatochromogenes açıklamalı küme 2 poliketid sentaz tip II genleri, üç poliketid sentaz tip I genleri, bir TDP-glikoz-4,6-dehidrataz gen ve iki glıkosıltransferaz genleri (bakınız Şekil 4) içerir. </li><li> küme içinde tek genler odaklanın. PKS tip I ve NRPS açiltransferazlar ve adenylation etki özgüllüğü ve böylece tek genişletici birimleri dahil edilmesi için, tahmin edilebilir. Ayrıca molekülü ile birleşmiş genişletici biriminin sırasını karşılaştırın. antiSMASH 31,32,33 ayrıca MIBiG veritabanına 37 bir bağlantı ile, zaten bilinen bileşiklerin benzer kümeleri gösterir. </li&gt; <li> bu bileşikler ile bileşiğin yapısını karşılaştırmak ve benzerlikleri kontrol edin. </li></ol></li></ol><img alt="Şekil 4," src="/files/ftp_upload/54952/54952fig4.jpg" /> Şekil 4: S. Polyketomycin Biyosentetik Gen Kümesi ve Diğer Kümeleri Genel Bakış antiSMASH Çıktı Tü6028 diastatochromogenes. (A) S. genomu tahmin biyosentetik gen kümeleri genel Tü6028 diastatochromogenes; Hedeflenen genleri ile (B) Küme 2 Polyketomycin biyosentetik gen kümesi. <a href="http://ecsource.jove.com/files/ftp_upload/54952/54952fig4large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> Biyosentetik Gen Cluster 5. Doğrulama <ol><li> bileşiğin biyosentezi için açık ve önemli (esansiyel) fonksiyonları ile bir genin arayın. polyketo doğrulanması içinPKS tip II ketosintaz a kodlayan gen pokPI bil gen kümesi, çerçeve -deletion dışı bir (Şekil 5B bakınız) tarafından seçilen ve inaktive edildi. Seçenek olarak ise, bir iç fragmanının klonlanmasıyla geni kesme (Şekil 5C bakınız). </li></ol><img alt="Şekil 5," src="/files/ftp_upload/54952/54952fig5.jpg" /> Şekil 5: Tek Crossover tarafından Gen Kümesi doğrulanması. (A), yerel genin işlevsel bir protein çevirisi yol açar; Intihar vektörü içine içi silme olan genin (B) klonlanması hedeflenen gen ve fonksiyonel olmayan proteininin bunu takip eden çeviride bir çerçeve kayması ile sonuçlanan tek bir geçit yol; Intihar vektörü içine genin bir iç fragmanının (C) klonlanması geni ve işlevsel olmayan bir protein daha sonra bir çeviri kesme yol açar. oriT: t kökeniransfer; antibiyotik R: antibiyotik direnci. <a href="http://ecsource.jove.com/files/ftp_upload/54952/54952fig5large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <ol start="2"><li> Tek geçiş yapısının klonlanması <ol><li> Primerleri pokPI_for ve pokPI_rev ile PCR 38 tarafından pokPI ihtiva eden bir parça yükseltmek. </li><li> İntihar vektörüne klon PCR ürünü, pKC1132 39 (R apramisin [50 mg / ml]). Intihar vektörü Streptomyces suşu içinde replike mümkün değildir ve bu nedenle apramisin karşı koymak için homolog rekombinasyon ile hedef gen içine entegre sahiptir. Isı şok dönüşümü 40 tarafından host klonlama E. coli içine vektör aktarın. </li><li> Alkalin lizis 41 ile vektör izole edin. </li><li> fragmanı içinde kesen bir tek kesici kısıtlama enzimi ile vektör DNA sindiremez. pokPI genE ile sindirildi Enzim Kpn I </li><li> 5 &#39;→ 3&#39; polimeraz aktivitesi ve 3 &#39;→ 5&#39; eksonükleaz aktivitesi olan büyük DNA polimeraz I (Klenow) fragmanı ile sindirilmiş vektör DNA&#39;sı tedavi edin. Yapışkan uçların kuntleştırılmesını ve sonra religasyon dört bazdan kaybına neden olur. Plazmid DNA, 41 yalıtma ve sınırlama sindirim ve sıralama ile daha analiz, tek koloniler toplama, E. coli XL1 Blue içine adımlar dönüşüm bu üslerin kaybı olup olmadığını kontrol edin. </li></ol></li><li> Tek geçit çekimi Streptomyces içine inşa <ol><li> Isı şok dönüşümü 40 E. coli ET12567 pUZ8002 42 (kanamisin R) içine silinmesi ile pokPI genini (pKC1132_ pokPI del) içeren intihar vektörü aktarın. 100 mL LB ortamında inkübe hücreleri (kanamisin 50 ug ml -1, apramisin 50 mg ml -1 </sup&gt;) Karışımı gece boyunca 37 ° C. santrifüj ile hasat hücreleri (3,000 xg, 10 dakika, 4 ° C) ve 50 ml LB ortamı içinde yeniden süspanse edilerek hücreler iki kez yıkayın. Son olarak, LB ortamı 2 x 500 uL tekrar süspansiyon hücreleri. </li><li> Mix 500 uL E. coli pUZ8002 pKC1132_ pokPI del 500 uL Streptomyces diastatochromogenes kültürü ile (alternatif sporlar kullanın). MS plakaları üzerinde karışım (soya unu 20 g D-mannitol, 20 g, MgCl2 10 mM,% 1.5 ağar, musluk suyu 1 L) yayıldı. 28 ° C&#39;de 20 saat süreyle inkübe edin. </li><li> apramisin (1.25 mg) ve 1 mL su içinde çözülmüş fosfomisin (5 mg) ile her plaka Yerleşimi ve kurumaya bırakın. exconjugants görünene kadar 28 ° C &#39;de pek çok gün süre ile inkübe edin. </li></ol></li><li> Tek geçiş mutantlar kontrol <ol><li> 20 ml TSB ortamı (50 mg mL apramisin-1) tek exconjugants inoküle ve üç gün boyunca 180 rpm&#39;de 28 ° C&#39;de inkübe.</li><li> Genomik DNA 43 yalıtmak ve PCR ile pokPI geninin kesintiye kontrol edin. </li><li> 100 ml HA ortam içinde belirlenmiş gen kesintisiz Streptomyces vahşi tip suş ile tek klonlar inoküle ve 28 ° C ve 180 rpm&#39;de 6 gün süreyle inkübe edilir. Ham özü (bölüm 1.3) ayıklayın. HPLC-MS analizi ile bileşik üretimini kontrol edin (bölüm 1.4). HPLC kromatogramı karşılık gelen tepe ve bileşik kütlesi daha fazla tespit olmamalıdır (bakınız Şekil 6). </li></ol></li></ol><img alt="Şekil 6," src="/files/ftp_upload/54952/54952fig6.jpg" /> Şekil 6: İnaktif pokPI Gene S. diastatochromogenes HPLC analizi. S. ham ekstre HPLC kromatogramıdır (λ = 430 nm) kesintiye pokPI -gen (aşağıda) WT (üst) ve mutant suşu diastatochromogenes. mutant suş artık polyketomycin üretmez.<a href="http://ecsource.jove.com/files/ftp_upload/54952/54952fig6large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a>

<ol>
	<li>Fleming, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+antibacterial+action+of+cultures+of+a+penicillin,+with+special+reference+to+their+use+in+isolation+of+B.+influenzae.">On the antibacterial action of cultures of a penicillin, with special reference to their use in isolation of B. influenzae.</a> Br J Exp Pathol. 10 (3), 226-236 (1929).</li><li>Lemke, A., Kiderlen, A. F., Kayser, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amphotericin+B.">Amphotericin B.</a> Appl. Microbiol. Biotechnol. 68 (2), 151-162 (2005).</li><li>Kirkpatrick, P., Raja, A., LaBonte, J., Lebbos, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Daptomycin.">Daptomycin.</a> Nat. Rev. Drug Discov. 2 (12), 943-944 (2003).</li><li>Zakeri, B., Wright, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+biology+of+tetracycline+antibiotics.">Chemical biology of tetracycline antibiotics.</a> Biochem. cell Biol. 86 (2), 124-136 (2008).</li><li>Schatz, A., Bugle, E., Waksman, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptomycin,+a+Substance+Exhibiting+Antibiotic+Activity+Against+Gram-Positive+and+Gram-Negative+Bacteria.">Streptomycin, a Substance Exhibiting Antibiotic Activity Against Gram-Positive and Gram-Negative Bacteria.</a> Exp. Biol. Med. 55 (1), 66-69 (1944).</li><li>Burg, R. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avermectins,+new+family+of+potent+anthelmintic+agents:+producing+organism+and+fermentation.">Avermectins, new family of potent anthelmintic agents: producing organism and fermentation.</a> Antimicrob. Agents Chemother. 15 (3), 361-367 (1979).</li><li>Egerton, J. R., Ostlind, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avermectins,+new+family+of+potent+anthelmintic+agents:+efficacy+of+the+B1a+component.">Avermectins, new family of potent anthelmintic agents: efficacy of the B1a component.</a> Antimicrob. Agents Chemother. 15 (3), 372-378 (1979).</li><li>Walsh, C. T., Fischbach, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+products+version+2.0:+connecting+genes+to+molecules.">Natural products version 2.0: connecting genes to molecules.</a> J. Am. Chem. Soc. 132 (8), 2469-2493 (2010).</li><li>Momose, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyketomycin,+a+new+antibiotic+from+Streptomyces+sp.+MK277-AF1.+II.+Structure+determination.">Polyketomycin, a new antibiotic from Streptomyces sp. MK277-AF1. II. Structure determination.</a> J. Antibiot. (Tokyo). 51 (1), 26-32 (1998).</li><li>Paululat, T., Zeeck, A., Gutterer, J. M., Fiedler, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biosynthesis+of+polyketomycin+produced+by+Streptomyces+diastatochromogenes.T&#252;6028.">Biosynthesis of polyketomycin produced by Streptomyces diastatochromogenes.T&#252;6028.</a> J. Antibiot. (Tokyo). 52 (2), 96-101 (1999).</li><li>Momose, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyketomycin,+a+new+antibiotic+from+Streptomyces.+sp.+MK277-AF1.+I.+Taxonomy,+production,+isolation,+physico-chemical+properties+and+biological+activities.">Polyketomycin, a new antibiotic from Streptomyces. sp. MK277-AF1. I. Taxonomy, production, isolation, physico-chemical properties and biological activities.</a> J. Antibiot. (Tokyo). 51 (1), 21-25 (1998).</li><li>Daum, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organisation+of+the+biosynthetic+gene+cluster+and+tailoring+enzymes+in+the+biosynthesis+of+the+tetracyclic+quinone+glycoside+antibiotic+polyketomycin.">Organisation of the biosynthetic gene cluster and tailoring enzymes in the biosynthesis of the tetracyclic quinone glycoside antibiotic polyketomycin.</a> Chembiochem. 10 (6), 1073-1083 (2009).</li><li>Bode, H. B., Bethe, B., H&#246;fs, R., Zeeck, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Big+effects+from+small+changes:+possible+ways+to+explore+nature's+chemical+diversity.">Big effects from small changes: possible ways to explore nature's chemical diversity.</a> Chembiochem. 3 (7), 619-627 (2002).</li><li>Wolfender, J. -. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HPLC+in+Natural+Product+Analysis:+The+Detection+Issue.">HPLC in Natural Product Analysis: The Detection Issue.</a> Planta Med. 75 (07), 719-734 (2009).</li><li>Stahl, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Thin-layer chromatography. A laboratory handbook. , (1967).</li><li>Snyder, L. R., Kirkland, J. J., Glajch, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparative+HPLC+Separation.">Preparative HPLC Separation.</a> Pract. HPLC Method Dev. , 616-642 (2012).</li><li>Granath, K. A., Kvist, B. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+weight+distribution+analysis+by+gel+chromatography+on+sephadex.">Molecular weight distribution analysis by gel chromatography on sephadex.</a> J. Chromatogr. A. 28, 69-81 (1967).</li><li>Jackman, L. M., Sternhell, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+Nuclear+Magnetic+Resonance+Spectroscopy+in+Organic+Chemistry.">Application of Nuclear Magnetic Resonance Spectroscopy in Organic Chemistry.</a> Int. Ser. Org. Chem. , (1969).</li><li>Xian, F., Hendrickson, C. L., Marshall, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+resolution+mass+spectrometry.">High resolution mass spectrometry.</a> Anal. Chem. 84 (2), 708-719 (2012).</li><li>Metzker, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequencing+technologies+-+the+next+generation.">Sequencing technologies - the next generation.</a> Nat. Rev. Genet. 11 (1), 31-46 (2010).</li><li>Tatusova, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prokaryotic+Genome+Annotation+Pipeline.">Prokaryotic Genome Annotation Pipeline.</a> NCBI Handb. 2nd Ed. , (2013).</li><li>Angiuoli, S. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+an+online+repository+of+Standard+Operating+Procedures+(SOPs)+for+(meta)genomic+annotation.">Toward an online repository of Standard Operating Procedures (SOPs) for (meta)genomic annotation.</a> OMICS. 12 (2), 137-141 (2008).</li><li>Aziz, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RAST+Server:+rapid+annotations+using+subsystems+technology.">The RAST Server: rapid annotations using subsystems technology.</a> BMC Genomics. 9, 75 (2008).</li><li>Overbeek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+SEED+and+the+Rapid+Annotation+of+microbial+genomes+using+Subsystems+Technology+(RAST).">The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST).</a> Nucleic Acids Res. 42, 206-214 (2014).</li><li>Brettin, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RASTtk:+a+modular+and+extensible+implementation+of+the+RAST+algorithm+for+building+custom+annotation+pipelines+and+annotating+batches+of+genomes.">RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes.</a> Sci. Rep. 5, 8365 (2015).</li><li>Seemann, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prokka:+rapid+prokaryotic+genome+annotation.">Prokka: rapid prokaryotic genome annotation.</a> Bioinformatics. 30 (14), 2068-2069 (2014).</li><li>Meyer, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GenDB--an+open+source+genome+annotation+system+for+prokaryote+genomes.">GenDB--an open source genome annotation system for prokaryote genomes.</a> Nucleic Acids Res. 31 (8), 2187-2195 (2003).</li><li>Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basic+local+alignment+search+tool.">Basic local alignment search tool.</a> J. Mol. Biol. 215 (3), 403-410 (1990).</li><li>Madden, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BLAST+Sequence+Analysis+Tool.">The BLAST Sequence Analysis Tool.</a> NCBI Handb. 2nd Ed. , (2003).</li><li>Marchler-Bauer, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CDD:+NCBI's+conserved+domain+database.">CDD: NCBI's conserved domain database.</a> Nucleic Acids Res. 43, 222-226 (2014).</li><li>Medema, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH:+rapid+identification,+annotation+and+analysis+of+secondary+metabolite+biosynthesis+gene+clusters+in+bacterial+and+fungal+genome+sequences.">antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences.</a> Nucleic Acids Res. 39, 339-346 (2011).</li><li>Blin, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH+2.0--a+versatile+platform+for+genome+mining+of+secondary+metabolite+producers.">antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers.</a> Nucleic Acids Res. 41, 204-212 (2013).</li><li>Weber, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH+3.0+-+a+comprehensive+resource+for+the+genome+mining+of+biosynthetic+gene+clusters.">antiSMASH 3.0 - a comprehensive resource for the genome mining of biosynthetic gene clusters.</a> Nucleic Acids Res. 43, 237-243 (2015).</li><li>Ziemert, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+natural+product+domain+seeker+NaPDoS:+a+phylogeny+based+bioinformatic+tool+to+classify+secondary+metabolite+gene+diversity.">The natural product domain seeker NaPDoS: a phylogeny based bioinformatic tool to classify secondary metabolite gene diversity.</a> PLoS One. 7 (3), 34064 (2012).</li><li>Rausch, C., Weber, T., Kohlbacher, O., Wohlleben, W., Huson, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specificity+prediction+of+adenylation+domains+in+nonribosomal+peptide+synthetases+(NRPS)+using+transductive+support+vector+machines+(TSVMs).">Specificity prediction of adenylation domains in nonribosomal peptide synthetases (NRPS) using transductive support vector machines (TSVMs).</a> Nucleic Acids Res. 33 (18), 5799-5808 (2005).</li><li>R&#246;ttig, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NRPSSpredictor2--a+web+server+for+predicting+NRPS+adenylation+domain+specificity.">NRPSSpredictor2--a web server for predicting NRPS adenylation domain specificity.</a> Nucleic Acids Res. 39, 362-367 (2011).</li><li>Medema, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Minimum+Information+about+a+Biosynthetic+Gene+cluster.">Minimum Information about a Biosynthetic Gene cluster.</a> Nat. Chem. Biol. 11 (9), 625-631 (2015).</li><li>Mullis, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+enzymatic+amplification+of+DNA+in+vitro:+the+polymerase+chain+reaction.">Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction.</a> Cold Spring Harb. Symp. Quant. Biol. 51, 263-273 (1986).</li><li>Bierman, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmid+cloning+vectors+for+the+conjugal+transfer+of+DNA+from+Escherichia+coli+to+Streptomyces+spp.">Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp.</a> Gene. 116 (1), 43-49 (1992).</li><li>Froger, A., Hall, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+plasmid+DNA+into+E.+coli.using+the+heat+shock+method.">Transformation of plasmid DNA into E. coli.using the heat shock method.</a> J. Vis. Exp. (6), e253 (2007).</li><li>Bimboim, H. C., Doly, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+alkaline+extraction+procedure+for+screening+recombinant+plasmid+DNA.">A rapid alkaline extraction procedure for screening recombinant plasmid DNA.</a> Nucleic Acids Res. 7 (6), 1513-1523 (1979).</li><li>MacNeil, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Streptomyces+avermitilis.+genes+required+for+avermectin+biosynthesis+utilizing+a+novel+integration+vector.">Analysis of Streptomyces avermitilis. genes required for avermectin biosynthesis utilizing a novel integration vector.</a> Gene. 111 (1), 61-68 (1992).</li><li>Pospiech, A., Neumann, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+versatile+quick-prep+of+genomic+DNA+from+Gram-positive+bacteria.">A versatile quick-prep of genomic DNA from Gram-positive bacteria.</a> Trends Genet. 11 (6), 217-218 (1995).</li><li>Makitrynskyy, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pleiotropic+regulatory+genes+bldA,+adpA+and+absB+are+implicated+in+production+of+phosphoglycolipid+antibiotic+moenomycin.">Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin.</a> Open Biol. 3 (10), 130121 (2013).</li><li>Kalan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cryptic+polyene+biosynthetic+gene+cluster+in+Streptomyces+calvus+is+expressed+upon+complementation+with+a+functional+bldA+gene.">A cryptic polyene biosynthetic gene cluster in Streptomyces calvus is expressed upon complementation with a functional bldA gene.</a> Chem. Biol. 20 (10), 1214-1224 (2013).</li><li>Gessner, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changing+Biosynthetic+Profiles+by+Expressing+bldA+in+Streptomyces+Strains.">Changing Biosynthetic Profiles by Expressing bldA in Streptomyces Strains.</a> ChemBioChem. 16 (15), 2244-2252 (2015).</li></ol>

The authors have nothing to disclose.

Bu laboratuvarda Streptomyces diastatochromogenes bir genomik kosmid kütüphanesi oluşturulur ve bir son derece zaman alıcı bir işlem yoluyla polyketomycin gen kümesinin tanımlanması ile sonuçlanan, birçok yıl önce elenmiştir. Tek gen karakterizasyonu hedefli gen silme ve elde edilen mutantlar 12 analizi ile mümkün oldu. Son zamanlarda, S. diastatochromogenes bir taslak genom dizisi polyketomycin biyosentetik gen kümesinin hızlı tanımlanmasına olanak elde edilmiştir. Taslak genom dizisi hala birçok kontig içermesine rağmen biz kolayca, biyosentetik genleri tespit olabilir. Tarif edilen işlem ay içinde elde edilebilir. Bununla birlikte, işlem bir çok aşamaları içerir. Tek adımlar sonraki aşamalara ilerlemesini engelleyen, birkaç kez başarısız olabilir: Streptomyces cinsinin biyolojik olarak aktif bileşiklerin üretimi için kapasitesi ile tanınır. genellikle 20&#39;den fazla bios taşırkengenellikle, bir ya da iki bileşiğin laboratuar koşullarında üretilen ynthetic gen kümeleri. Sessiz gen kümeleri uyanmak OSMAC yaklaşımı (farklı koşullar altında bir gerginlik ekimi) uygulaması bazen yeterli olmayabilir. Böyle pleiotropik regülatör genlerin ADPA 44 ve bldA 45,46 gibi düzenleyici genlerin, genetik manipülasyon, diğer sekonder metabolitlerin üretimini aktive etmek için etkili bir yöntemdir. NMR analizi ile, örneğin bileşiğin yapısının aydınlatılması için, arıtılmış, bileşiğin, genellikle en fazla 2 mg gereklidir. Bu nedenle, en fazla 10 L fermentasyon sıklıkla gerekmektedir. oksijen, pH ve sıcaklık koşulları sağlamak için mümkün olan bir fermentasyon olmadan, kültür ve daha sonra ekstre bu miktar ele küçük laboratuarda zor olabilir. saflaştırma sırasında bileşiğin, oksidasyonu, radyasyon ya da ısı ile değiştirilebilir.Ayrıca, daha çok arıtma aşamaları daha yüksek degradasyon şansı kullanılır. doğal bir ürün yapısını ve genomunda kümeleri analiz ederken, bazen uygun kümeyi tanımlamak o kadar kolay değildir. sadece bir taslak genom dizisi varsa Birincisi, kümenin bir kısmı eksik olabilir. İkincisi, biyosentezi için gerekli olan tüm genler kümede değildir. Üçüncü olarak, zaman zaman, bir küme çok sayıda kilobaz birbirinden ayrılan iki parçaya bölünür. Dördüncüsü, uygun gen kümesi olan bir karar vermek zor olabilir. modüllerin sayısına göre genişletme birimleri sayısını hesaplamak ya da seçerek etki analizi ile tek genişletici birimlerini tanımlamak mümkündür büyük PKS tipi I veya NRPS sistemleri durumunda, kolayca ortaya çıkar. Bununla birlikte, lineer olmayan çalışma durumunda sentezlenen bileşiklerin tahmini, özellikle stra ise, genellikle mümkün değildir enzimleri40&#39;dan fazla gen kümeleri vardır. Beşinci olarak, doğal oldukça karmaşık ve henüz bilinmeyen bileşikler doludur. Genellikle biyosentez farklı yollar bir karışımıdır. Yeni bileşik başka bileşiğe ilişkin henüz tespit veya değilse, bir biyosentez modeli önermek ve bunu kanıtlamak için, kümeyi tanımlamak zor olabilir. küme tespit edildikten sonra, tek geçit tekniği hipotezi doğrulamak için bir iyi ve hızlı bir yöntemdir. PCR, bir intihar vektörü, konjugasyon, pozitif klonların seçimi ve üretim tahlil klonlama gereken tek adımlardır. Bu tekniğin bir dezavantajı, kromozomuna vektörü bütünleştirilmesi nedeniyle daha da rekombinasyon olayları stabil değildir olmasıdır. Bu nedenle, daha fazla tek genler analiz etmek amacıyla, hassas gen silme gerekmektedir. Ayrıca genetik düzeyde Streptomyces suşları manipüle etmek zor olabilir. açıklanan prosedür t atanabilirStreptomyces suşu ya da başka bir mikroorganizma tarafından üretilen herhangi bir O bileşiği. Bir biyosentetik gen küme ve sentezlenen bileşik hakkında bilgi bize çok ilaca dirençli patojenlere karşı mücadele için onları geliştirmek amacıyla mevcut molekülleri değiştirmek için daha fazla fırsat verir.

bitkiler ve mikroorganizmalar Doğal ürünler her zaman klinik ilaç geliştirme ve araştırma için önemli bir kaynak olmuştur. İlk antibiyotik Penisilin Alexander Fleming 1 tarafından bir mantar 1928 yılında keşfedildi. Günümüzde bir çok doğal ürün, klinik tedavisinde kullanılır. Farklı bioactivities ikincil metabolitlerin çeşitli üreten onun yeteneği için bilinen bir cins Streptomyces olduğunu. Streptomyces Gram-pozitif bakteriler ve Actinobacteria&#39;lar sınıfından ve sipariş Actinomycetales aittir. Klinik olarak kullanılan antibiyotiklere yaklaşık üçte ikisi 3 ya da tetrasiklin 4 daptomisin, amfoterisin 2 gibi özellikle Streptomyces, Actinomycetales türetilmiştir. İki Nobel ödülleri Streptomyces antibiyotik araştırma alanında verildi. İlki Streptomisin keşfi, ilk bir için Selman Waksman gittitüberküloza karşı etkili tibiotic. 5 2015 yılında, Nobel Fizyoloji veya Tıp Ödülü parçası olarak, S. avermitilis &#39;dan avermektin keşfi de layık görüldü. Avermektin parazitik hastalıkların 6,7 tedavisi için kullanılır. Örneğin Streptomyces gibi mikroorganizmalar doğal ürünlerin keşfi için geleneksel bir yaklaşım, genellikle, farklı büyüme koşulları altında suşunun kültivasyonunda, hem de çıkarma ve ikincil metabolitlerin analizini içerir. Biyoaktivite tahlilleri (antibakteriyel ve anti-kanser etkinlik için örneğin deneyleri) bileşik aktivitesi tespit etmek için gerçekleştirilir. Son olarak, ilgi konusu bileşiği izole edilir ve kimyasal yapısı açıklanacaktır. Doğal ürünlerin yapıları genellikle karmaşık molekülleri oluşturan tek kısımların oluşmaktadır. Bloğa bina lider birkaç, ancak sınırlı, büyük biyosentez yolları vardırdoğal ürünlerin sentezi için kullanılan ks. büyük biyosentez yolları şeker kısımları giden poliketit yolları, amino asitler kullanılarak terpenoid ve alkaloidler, yollar giden yollar ve yollar vardır. Her yol, belirli enzimlerin 8 bir dizi ile karakterize edilir. bileşiğin yapısına bağlı olarak, bu biyosentetik enzimleri tahmin edilebilir. Günümüzde, yeni nesil dizileme ve biyoinformatik analizi ile birlikte bir bileşiğin ayrıntılı yapısal analiz sorumlu biyosentetik gen kümesi tanımlamak için yardımcı olabilir. Küme bilgiler daha doğal ürün araştırma için yeni yollar açıyor. Bu gen, silme ya da değiştirme ve diğer yollardan gelen genler ile kombinasyon biyosentezi doğal ürün verimini, hedeflenen bileşik modifikasyonu geliştirmek için heterolog ekspresyonunu içerir. Polyketomycin kültür sıvısından, bağımsız olarak izole edilmiştiriki suş, Streptomyces sp. MK277-AF1 9 ve Streptomyces diastatochromogenes Tü6028 10. Yapı, NMR ve X-ışını analizi ile açıklığa kavuşturulmuştur. Polyketomycin β-D-amicetose ve α-L-axenose iki deoksi şeker kısımları ile bağlantılı bir tetrasiklik decaketid ve dimetil salisilik asit oluşmaktadır. Hatta MRSA 11 gibi Gram-pozitif çok ilaca dirençli suşlara karşı, sitotoksik antibiyotik aktivitesi gösterir. S. diastatochromogenes Tü6028 bir genomik kozmid kütüphanesi oluşturulur ve yıllar önce tarandı. 41 genleri ihtiva eden, 52.2 kb bir boyuta sahip polyketomycin gen kümesini belirli bir gen probları kullanılarak, yoğun çalışma 12 birkaç ay sonra tespit edilmiştir. Son zamanlarda, S. diastatochromogenes taslak genom sekansı polyketomycin biyosentetik gen kümesinin hızlı tanımlama giden elde edildi. Bu genel olarak, bir yöntem iden yardımcıdoğal bir ürün Tify ve biyosentetik gen kümesinin bir örnek olarak polyketomycin kullanılarak, tarif edilecektir açıklamaktadır. Burada Streptomyces diastatochromogenes Tü6028 tarafından üretilen polyketomycin için gösterilen kendi biyosentetik gen kümesi doğal üründen yol tek adımları açıklar. Protokol antibiyotik özelliklere sahip doğal bir ürün belirlenmesini ve saflaştırılmasını içermektedir. Daha fazla yapısal analiz ve biyosentetik gen kümesinin belirlenmesi için genom madencilik kurşun elde edilen sonuçlar ile karşılaştırılması. Bu prosedür, bir Streptomyces türü veya herhangi bir başka mikroorganizmadan türetilmiş herhangi bir başka bileşik uygulanabilir.

<table border="0" cellpadding="0" cellspacing="0" width="1334">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">agar</td>
			<td style="width:397px;">Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">5210.4</td>
			<td style="width:360px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">agarose</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6352.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">D-mannitol&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">4175.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">glucose&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6780.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">LB&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X964.3</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">malt extract&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X976.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">MgCl2</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">2189.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Peptone&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">soy flour&#160;</td>
			<td style="width:397px;">W.Schoenemberger GmbH, Magstadt, Germany</td>
			<td style="width:231px;"></td>
			<td>Hensec-Vollsoja</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">tryptic soy broth</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X938.3</td>
			<td>Caso-Bouillon</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">yeast extract&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">2363.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Solvents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetic acid</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">3738.5</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetone&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">9372.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetonitrile</td>
			<td style="width:397px;">Avantor Performance Materials B.V., Deventer, The Netherlands</td>
			<td>JT-9012-03</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Dichlorofrom&#160;</td>
			<td>Fisher Scientific GmbH, Schwerte, Germany</td>
			<td>1530754</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">DMSO (Dimethyl sulfoxide)</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">4720.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">DMSO-d6 (Dimethyl sulfoxide-d6) 99.9atom%D</td>
			<td style="width:397px;">ARMAR Chemicals, D&#246;ttingen, Switzerland</td>
			<td style="width:231px;">15200.204</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Ethyl acetate</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td>6784.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Hydrochloric acid</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6331.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Methanol</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">7342.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Enzymes</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">restriction enzymes</td>
			<td colspan="2">New England Biolabs GmbH, Frankfurt am Main, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">polymerase&#160;</td>
			<td colspan="2">New England Biolabs GmbH, Frankfurt am Main, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA Polymerase I Large (Klenow) Fragment</td>
			<td>Promega GmbH, Mannheim, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Antibiotics</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">apramycin</td>
			<td>AppliChem GmbH, Darmstadt, Germany&#160;</td>
			<td style="width:231px;">A7682.0005</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">fosfomycin</td>
			<td>Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany</td>
			<td style="width:231px;">P5396-50G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">kanamycin</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">T832.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Plasmid/Vectors</td>
			<td style="width:397px;"></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pKC1132</td>
			<td style="width:397px;">Bierman et al. 1992</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Primer&#160;</td>
			<td style="width:397px;"></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pokPI_for</td>
			<td>TGATGGTGCCGCTGGCCATGG</td>
			<td rowspan="2" style="width:231px;">Primer to amplify fragment containing pokPI gene</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pokPI_rev</td>
			<td>AGCGTTCACTGTTCCGCCCGAC</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Bacterial strains</td>
			<td style="width:397px;"></td>
			<td style="width:231px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Bacillus subtilis COHN ATCC6051</td>
			<td></td>
			<td>Gram-positive test strain&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Escherichia coli ET12567 pUZ8002&#160;</td>
			<td>MacNeil et al., 1992</td>
			<td>strain for conjugation&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Escherichia coli XL1 Blue</td>
			<td style="width:397px;">Agilient Technologies, Santa Clara, USA</td>
			<td colspan="2">Gram-negative test strain + cloning host&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Streptomyces diastatochromogenes T&#252;6028</td>
			<td style="width:397px;">Paululat et al., 1999</td>
			<td>Polyketomycin producer</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Online services</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">antismash (Antibiotics and Secondary Metabolite Analysis Shell)</td>
			<td style="width:397px;">http://antismash.secondarymetabolites.org/</td>
			<td colspan="2">Detection of secondary metabolite gene cluster</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">BLAST (Basic Local Alignment Search Tool)</td>
			<td style="width:397px;">http://blast.ncbi.nlm.nih.gov/Blast.cgi</td>
			<td colspan="2">finds regions of similarity between biological sequences</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">GenDB</td>
			<td style="width:397px;">https://www.uni-giessen.de/fbz/fb08/Inst/bioinformatik/software/gendb</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">MiBIG (Minimum Information about a Biosynthetic Gene cluster)</td>
			<td style="width:397px;">http://mibig.secondarymetabolites.org/</td>
			<td colspan="2">Database of biosyntetic gene clusters</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NaPDoS</td>
			<td style="width:397px;">http://napdos.ucsd.edu/</td>
			<td colspan="2">Detection of seconary metabolite gene cluster</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">NCBI Prokaryotic Genome Annotation Pipeline</td>
			<td style="width:397px;">http://www.ncbi.nlm.nih.gov/genome/annotation_prok/</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NRPSpredictor</td>
			<td style="width:397px;">http://nrps.informatik.uni-tuebingen.de/</td>
			<td>Detection of NRPS domains</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Prokka (rapid prokaryotic genome annotation)</td>
			<td style="width:397px;">http://www.vicbioinformatics.com/software.prokka.shtml</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">RAST (rapid annotation using subsystems technology)</td>
			<td style="width:397px;">http://rast.nmpdr.org/</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">other programs&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Chem Station Rev. A.09.03</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td style="width:231px;">Handling program for HPLC&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Clone Manager Suite 7</td>
			<td style="width:397px;">Scientific and Educational Software, Cary, USA</td>
			<td style="width:231px;">Designing Cloning Experiment&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Newbler v2.8</td>
			<td style="width:397px;">Roche Diagnostics</td>
			<td>Alignment of sequencing reads</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Machines&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Centrifuge Avanti J-6000, Rotor JA-10</td>
			<td>Beckman Coulter GmbH, Krefeld, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPLC/MS</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Autosampler: G1313A</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Pre-column: XBridge C18 (20 mm x 4.6 mm; Particle size: 3.5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Column:Xbridge C18 (100 mm &#215; 4.6 mm; Particle size: 3.5 &#956;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_semi-prep Pre-Column: Zorbax B-C18 (9.4 x 150 mm; Particle size: 5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_semi-prep Column: Zorbax B-C18 (9.4 x 20 mm; Particle size: 5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Degasser: G1322A&#160;</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Quarternary pump: G1311A</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Diode array detector (DAD )G1315B (&#955; = 254 nm and 400 nm)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Quadrupole mass detector (MSD) G1946D(2-3000 m/z)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">rotary evaporator</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_heating bath Hei-VAP Value/G3</td>
			<td colspan="2">Heidolph Instruments GmbH &#38; Co.KG, Schwabach, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_vacuum pump system SC 920 G</td>
			<td>KNF&#160;Global Strategies&#160;AG, Sursee, Switzerland</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">other material&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Sephadex LH20</td>
			<td style="width:397px;">GE Healthcare,&#160;</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Chromafil PVDF-45/15MS (pore size 0.45 &#181;m; filter &#216;15 mm)</td>
			<td>MACHEREY-NAGEL GmbH &#38; Co. KG, D&#252;ren, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SPE column Oasis HLB 20 35 cc (6g)</td>
			<td style="width:397px;">Waters GmbH, Eschborn, Germany&#160;</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">E. coli&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Bacillus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Streptomyces sp.</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: TSB, Composition: CASO Boullion, Amount to 1 L H2O: 30 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Yeast extract, Amount to 1 L H2O: 10 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Peptone, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Glucose, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td>for agar plates add 2 % agar</td>
		</tr>
	</tbody>
</table>

from a natural product to its biosynthetic gene cluster: a demonstration using polyketomycin from streptomyces diastatochromogenes t&#252;6028

Streptomyces suşları, çeşitli biyolojik aktivitelerinin farklı bileşiklerin bir çok üretmek için yeteneği bilinmektedir. Farklı koşullar altında yetiştirme genellikle yeni bileşikler üretimine yol açar. Bu nedenle, suşların üretim kültürleri, etil asetat ile ekstre edilir ve ham ekstreler HPLC ile analiz edilmiştir. Ayrıca, ekstreler farklı deney kendi biyolojik etkinlik için test edilmiştir. yapısının aydınlatılması için ilgili bileşik, farklı kromatografi yöntemlerin bir kombinasyonu ile saflaştırılmıştır. genom madenciliği ile birleştiğinde genom dizileme farklı bilgisayar programları kullanarak doğal bir ürün biyosentetik gen kümesinin belirlenmesini sağlar. gen inaktivasyonu deneyleri yapılması gereken, doğru gen kümesi tespit edilmiştir onaylamak için. Elde edilen mutantlar, özellikle doğal bir ürün üretimi için analiz edilir. Doğru gen kümesi deaktive edildikten sonra,suş bileşik üretmek için başarısız. Iş akışı Streptomyces diastatochromogenes Tü6028 tarafından üretilen antibakteriyel bileşik polyketomycin gösterilir. genom dizileme hala çok pahalı iken yaklaşık on yıl önce, bir gen küme klonlanması ve kimlik çok zaman alıcı bir süreç oldu. genom madenciliği ile birlikte hızlı genom dizileme küme kimlik deneme hızlandırır ve yeni yollar biyosentezini keşfetmek ve genetik yöntemlerle yeni doğal ürünler üretmek için açılır. Bu yazıda tarif edilen protokol Streptomyces suşu ya da başka bir mikroorganizmadan türetilmiş herhangi bir başka bileşik atanabilir.

Bu genel olarak biz onun biyosentetik gen kümesi giden bir antibiyotiğin belirlenmesi gelen tek adımları açıklar. Bir çok yıl önce faj içine ambalajlanmış bir kozmid kütüphanesi, klonlanmış E. coli konakçı hücreleri transdüse ve polyketomycin kümenin üst üste bölgelerine sahip klonları tanımlamak için koloni binlerce taranması için vardı. Kozmid sıralaması da zor ve pahalı bir süreç 12 idi. Suşu üzerinde ileri çalışmalar yapmak üzere biz Streptomyces diastatochromogenes Tü6028 bütün genom dizisi. Taslak genom dizisi ile kolayca polyketomycin ve gelecek vaat eden bileşikleri kodlayan diğer kümelerin biyosentetik gen kümesi belirledi. Şekil 7 genetik materyali ve elaborative tarama klonlanması ile biyosentetik küme belirleme &quot;eski&quot; yöntemi karşılaştırır vekaba bir zaman ölçeğinde sonraki genom madenciliği ile tüm genom dizileme ile &quot;yeni&quot; yöntemi. Yeni sıralama teknolojiler ve yeni genom madenciliği programları tüm süreci hızlandırmak. <img alt="Şekil 7," src="/files/ftp_upload/54952/54952fig7.jpg" /> Şekil 7: Bir Biyosentetik Gen küme atama ve &quot;Eski&quot; ve &quot;Yeni&quot; Yöntem Karşılaştırılması. &quot;Eski&quot; yöntemi pozitif klonların seçilmesi ve söz konusu kozmid (ler) sekanslanması ile kozmid kitaplığı klonlanmasını (yukarıda) ihtiva eder; &quot;Yeni&quot; yöntemi, tüm genom sekanslama ve gerginlik (aşağıda) genomu üzerinde bulunan tüm ikincil metabolit gen kümeleri tespit etmek -Maden içerir. Tek adımlar Süresi kaba bir zaman ölçeğinde gösterilir. <a href="http://ecsource.jove.com/files/ftp_upload/54952/54952fig7large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a>

Watch this Scientific Journal Video about From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes TÃƒÂ¼6028 at JoVE.com

From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes T&#252;6028

Burada, (A), antibiyotik aktivitesi ile doğal ürünün belirlenmesi, (B) bileşiği ile saflaştırılması, (c) biyosentezinin ilk modeli, (D), genom dizileme / -Maden ve detaylı bir protokol mevcut ( E) biyosentetik gen kümesinin doğrulanması.

dan Polyketomycin kullanma A Gösteri: Its Biyosentetik Gen kümesi için bir Doğal Ürün dan<em&gt; Streptomyces diastatochromogenes</em&gt; Tü6028

Streptomyces strains are known for their capability to produce a lot of different compounds with various bioactivities. Cultivation under different ...

from-natural-product-to-its-biosynthetic-gene-cluster-demonstration

Research

JoVE Journal

Genetics

17.1K Görüntüleme.  Albert-Ludwigs-Universität Freiburg, Germany.  Burada, (A), antibiyotik aktivitesi ile doğal ürünün belirlenmesi, (B) bileşiği ile saflaştırılması, (c) biyosentezinin ilk modeli, (D), genom dizileme / -Maden ve detaylı bir protokol mevcut ( E) biyosentetik gen kümesinin doğrulanması. 

Video: From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028

Using a GFP-tagged TMEM184A Construct for Confirmation of Heparin Receptor Identity

When novel proteins are identified through affinity-based isolation and bioinformatics analysis, they are often largely uncharacterized. Antibodies against specific peptides within the predicted sequence allow some localization experiments. However, other possible interactions with the antibodies often cannot be excluded. This situation provided an opportunity to develop a set of assays dependent on the protein sequence. Specifically, a construct containing the gene sequence coupled to the GFP coding sequence at the C-terminal end of the protein was obtained and employed for these purposes. Experiments to characterize localization, ligand affinity, and gain of function were originally designed and carried out to confirm the identification of TMEM184A as a heparin receptor1. In addition, the construct can be employed for studies addressing membrane topology questions and detailed protein-ligand interactions. The present report presents a range of experimental protocols based on the GFP-TMEM184A construct expressed in vascular cells that could easily be adapted for other novel proteins.

A construct encoding TMEM184A with a GFP tag at the carboxy-terminus designed for eukaryotic expression, was employed in assays designed to confirm the identification of TMEM184A as a heparin receptor in vascular cells.

Bir GFP etiketli TMEM184A kullanarak Heparin Reseptör Kimliğinin Onay için Construct

When novel proteins are identified through affinity-based isolation and bioinformatics analysis, they are often largely uncharacterized. Antibodies ...

Genetik

Sample Preparation and Analysis of RNASeq-based Gene Expression Data from Zebrafish

The analysis of global gene expression changes is a valuable tool for identifying novel pathways underlying observed phenotypes. The zebrafish is an excellent model for rapid assessment of whole transcriptome from whole animal or individual cell populations due to the ease of isolation of RNA from large numbers of animals. Here a protocol for global gene expression analysis in zebrafish embryos using RNA sequencing (RNASeq) is presented. We describe preparation of RNA from whole embryos or from cell populations obtained using cell sorting in transgenic animals. We also describe an approach for analysis of RNASeq data to identify enriched pathways and Gene Ontology (GO) terms in global gene expression data sets. Finally, we provide a protocol for validation of gene expression changes using quantitative reverse transcriptase PCR (qRT-PCR). These protocols can be used for comparative analysis of control and experimental sets of zebrafish to identify novel gene expression changes, and provide molecular insight into phenotypes of interest.

This protocol presents an approach for whole transcriptome analysis from zebrafish embryos, larvae, or sorted cells. We include isolation of RNA, pathway analysis of RNASeq data, and qRT-PCR-based validation of gene expression changes.

Numune hazırlama ve analiz RNASeq tabanlı gen ifadesi verileri Zebra balığı

The analysis of global gene expression changes is a valuable tool for identifying novel pathways underlying observed phenotypes. The zebrafish is an ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point mutations, which often are responsible for a variety of human inherited disorders. Using a well-established cell-based model system, the point mutation of a single-copy mutant eGFP gene integrated into HCT116 cells has been repaired using this combinatorial approach. The analysis of corrected and uncorrected cells reveals both the precision of gene editing and the development of genetic lesions, when indels are created in uncorrected cells in the DNA sequence surrounding the target site. Here, the specific methodology used to analyze this combinatorial approach to the gene editing of a point mutation, coupled with a detailed experimental strategy to measuring indel formation at the target site, is outlined. This protocol outlines a foundational approach and workflow for investigations aimed at developing CRISPR/Cas9-based gene editing for human therapy. The conclusion of this work is that on-site mutagenesis takes place as a result of CRISPR/Cas9 activity during the process of point mutation repair. This work puts in place a standardized methodology to identify the degree of mutagenesis, which should be an important and critical aspect of any approach destined for clinical implementation.

This protocol outlines the workflow of a CRISPR/Cas9-based gene editing system for the repair of point mutations in mammalian cells. Here, we use a combinatorial approach to gene editing with a detailed follow-on experimental strategy for measuring indel formation at the target site&#8212;in essence, analyzing onsite mutagenesis.

Yerinde mutagenisitesinin CRISPR/Cas9 ve SsODN insan hücrelerinde tarafından katalize nokta mutasyon onarım bir fonksiyonu olarak incelemek için standart bir metodoloji

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in which the gene of interest has been disrupted. A gene-disruption DNA construct containing a suitable antibiotic resistance marker gene is useful for the generation of gene-disrupted strains in bacteria. However, conventional construction methods, which require gene cloning steps, involve complex and time-consuming protocols. Here, a relatively facile, rapid, and cost-effective method for targeted gene disruption in Streptococcus mutans is described. The method utilizes a 2-step fusion polymerase chain reaction (PCR) to generate the disruption construct and electroporation for genetic transformation. This method does not require an enzymatic reaction, other than PCR, and additionally offers greater flexibility in terms of the design of the disruption construct. Employment of electroporation facilitates the preparation of competent cells and improves the transformation efficiency. The present method may be adapted for the generation of gene-disrupted strains of various species.

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

We describe a facile, rapid, and relatively inexpensive method for the generation of gene-disrupted Streptococcus mutans strains; this technique may be adapted for the generation of gene-disrupted strains of various species.

Nesil bir gen kesintiye Streptococcus mutans çoğunlukla zorlanma olmadan Gen Klonlama

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in ...

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to abiotic stresses and diseases. As the plant microbiome can be highly complex, low-cost, high-throughput methods such as amplicon-based sequencing of the 16S rRNA gene are often preferred for characterizing its microbial composition and diversity. However, the selection of appropriate methodology when conducting such experiments is critical for reducing biases that can make analysis and comparisons between samples and studies difficult. This protocol describes in detail a standardized methodology for the collection and extraction of DNA from soil, rhizosphere, and root samples. Additionally, we highlight a well-established 16S rRNA amplicon sequencing pipeline that allows for the exploration of the composition of bacterial communities in these samples, and can easily be adapted for other marker genes. This pipeline has been validated for a variety of plant species, including sorghum, maize, wheat, strawberry, and agave, and can help overcome issues associated with the contamination from plant organelles.

Here, we describe a protocol to obtain amplicon sequence data of soil, rhizosphere, and root endosphere microbiomes. This information can be used to investigate the composition and diversity of plant-associated microbial communities, and is suitable for the use with a wide range of plant species.

Kök Microbiome keşfetmek: toprak, rizosferde ve kök Endosphere bakteriyel topluluk verileri ayıklama

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...

Informatic Analysis of Sequence Data from Batch Yeast 2-Hybrid Screens

We have adapted the yeast 2-hybrid assay to simultaneously uncover dozens of transient and static protein interactions within a single screen utilizing high-throughput short-read DNA sequencing. The resulting sequence datasets can not only track what genes in a population that are enriched during selection for positive yeast 2-hybrid interactions, but also give detailed information about the relevant subdomains of proteins sufficient for interaction. Here, we describe a full suite of stand-alone software programs that allow non-experts to perform all the bioinformatics and statistical steps to process and analyze DNA sequence fastq files from a batch yeast 2-hybrid assay. The processing steps covered by these software include: 1) mapping and counting sequence reads corresponding to each candidate protein encoded within a yeast 2-hybrid prey library; 2) a statistical analysis program that evaluates the enrichment profiles; and 3) tools to examine the translational frame and position within the coding region of each enriched plasmid that encodes the interacting proteins of interest.

Deep sequencing of yeast populations selected for positive yeast 2-hybrid interactions potentially yields a wealth of information about interacting partner proteins. Here, we describe the operation of specific bioinformatics tools and customized updated software to analyze sequence data from such screens.

Sıralı veri--dan toplu Maya 2-hibrid perde Bilişim Analizi

We have adapted the yeast 2-hybrid assay to simultaneously uncover dozens of transient and static protein interactions within a single screen utilizing ...

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and effect sizes of regulatory elements to a target gene. Some progress has been made with the bioinformatic prediction of the existence and function of proximal epigenetic modifications associated with activated gene expression using conserved transcription factor binding sites. Chromatin conformation capture studies have revolutionized our ability to discover physical chromatin contacts between sequences and even within an entire genome. Circular chromatin conformation capture coupled with next-generation sequencing (4C-seq), in particular, is designed to discover all possible physical chromatin interactions for a given sequence of interest (viewpoint), such as a target gene or a regulatory enhancer. Current 4C-seq strategies directly sequence from within the viewpoint but require numerous and diverse viewpoints to be simultaneously sequenced to avoid the technical challenges of uniform base calling (imaging) with next generation sequencing platforms. This volume of experiments may not be practical for many laboratories. Here, we report a modified approach to the 4C-seq protocol that incorporates both an additional restriction enzyme digest and qPCR-based amplification steps that are designed to facilitate a greater capture of diverse sequence reads and mitigate the potential for PCR bias, respectively. Our modified 4C method is amenable to the standard molecular biology lab for assessing chromatin architecture.

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

The identification of physical interactions between genes and regulatory elements is challenging but has been facilitated by chromosome conformation capture methods. This modification to the 4C-seq protocol mitigates PCR bias by minimizing over-amplification of PCR templates and maximizes the mappability of reads by incorporating an addition restriction enzyme digest step.

Gen düzenleyici dizileri dairesel kromozom Conformation yeni nesil sıralama kullanarak yüksek üretilen iş tanımlaması yakalama (4C-seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...

A Fluorescence-based Method to Study Bacterial Gene Regulation in Infected Tissues

Bacterial virulence genes are often regulated at the transcriptional level by multiple factors that respond to different environmental signals. Some factors act directly on virulence genes; others control pathogenesis by adjusting the expression of downstream regulators or the accumulation of signals that affect regulator activity. While regulation has been studied extensively during in vitro growth, relatively little is known about how gene expression is adjusted during infection. Such information is important when a particular gene product is a candidate for therapeutic intervention. Transcriptional approaches like quantitative, real-time RT-PCR and RNA-Seq are powerful ways to examine gene expression on a global level but suffer from many technical challenges including low abundance of bacterial RNA compared to host RNA, and sample degradation by RNases. Evaluating regulation using fluorescent reporters is relatively easy and can be multiplexed with fluorescent proteins with unique spectral properties. The method allows for single-cell, spatiotemporal analysis of gene expression in tissues that exhibit complex three-dimensional architecture and physiochemical gradients that affect bacterial regulatory networks. Such information is lost when data are averaged over the bulk population. Herein, we describe a method for quantifying gene expression in bacterial pathogens in situ. The method is based on simple tissue processing and direct observation of fluorescence from reporter proteins. We demonstrate the utility of this system by examining the expression of Staphylococcus aureus thermonuclease (nuc), whose gene product is required for immune evasion and full virulence ex vivo and in vivo. We show that nuc-gfp is strongly expressed in renal abscesses and reveal heterogeneous gene expression due in part to apparent spatial regulation of nuc promoter activity in abscesses fully engaged with the immune response. The method can be applied to any bacterium with a manipulatable genetic system and any infection model, providing valuable information for preclinical studies and drug development.

Described here is a method for analyzing bacterial gene expression in animal tissues at a cellular level. This method provides a resource for studying the phenotypic diversity occurring within a bacterial population in response to the tissue environment during an infection.

Bakteriyel gen düzenlemesi enfekte dokularda çalışmaya bir floresan tabanlı yöntemi

Bacterial virulence genes are often regulated at the transcriptional level by multiple factors that respond to different environmental signals. Some ...

In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for reversible and tunable expression control of an endogenous gene of interest in living model systems. The REMOTE-control system employs enhanced lac repression and tet activation systems to achieve down- or upregulation of a target gene within a single biological system. Tight repression can be achieved from repressor binding sites flexibly located far downstream of a transcription start site by inhibiting transcription elongation. Robust upregulation can be attained by enhancing the transcription of an endogenous gene by targeting tet transcriptional activators to the cognate promoter. This reversible and tunable expression control can be applied and withdrawn repeatedly in organisms. The potency and versatility of the system, as demonstrated for endogenous Dnmt1 here, will allow more precise in vivo functional analyses by enabling investigation of gene function at various expression levels and by testing the reversibility of a phenotype.

This protocol outlines the steps needed to generate a model system in which the transcription of an endogenous gene of interest can be conditionally controlled in live animals or cells using enhanced lac repressor and/or tet activator systems.

Uzaktan kumandalı sistem in vivo uygulama için işleme endojen gen ekspresyonu

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for ...

Lentiviral Mediated Gene Silencing in Human Pseudoislet Prepared in Low Attachment Plates

Various genetic tools are available to modulate genes in pancreatic islets of rodents to dissect function of islet genes for diabetes research. However, the data obtained from rodent islets are often not fully reproduced in or applicable to human islets due to well-known differences in islet structure and function between the species. Currently, techniques that are available to manipulate gene expression of human islets are very limited. Introduction of transgene into intact islets by adenovirus, plasmid, and oligonucleotides often suffers from low efficiency and high toxicity. Low efficiency is especially problematic in gene downregulation studies in intact islets, which require high efficiency. It has been known that enzymatically-dispersed islet cells reaggregate in culture forming spheroids termed pseudoislets. Size-controlled reaggregation of human islet cells creates pseudoislets that maintain dynamic first phase insulin secretion after prolonged culture and provide a window to efficiently introduce lentiviral short hairpin RNA (shRNA) with low toxicity. Here, a detailed protocol for the creation of human pseudoislets after lentiviral transduction using two commercially available multiwell plates is described. The protocol can be easily performed and allows for efficient downregulation of genes and assessment of dynamism of insulin secretion using human islet cells. Thus, human pseudoislets with lentiviral mediated gene modulation provide a powerful and versatile model to assess gene function within human islet cells.

A protocol to create gene modified human pseudoislets from dispersed human islet cells that are transduced by lentivirus carrying short hairpin RNA (shRNA) is presented. This protocol utilizes readily available enzyme and culture vessels, can be performed easily, and produces genetically modified human pseudoislets suitable for functional and morphological studies.

Düşük ataşman plakalarına hazırlanmış ınsan Pseudoislet 'te lentiviral aracılı gen susturulması

Various genetic tools are available to modulate genes in pancreatic islets of rodents to dissect function of islet genes for diabetes research. However, ...