Yazarlar, deneysel yardım için Gissell Sanchez, Megan Lee ve Jason Estep&#39;i ve reaktifleri paylaşmak için Weifeng Gu ve Xuemei Chen&#39;i onaylamak istiyorlar.

1. İstenilen Silinme Çevresindeki Homoloji Bölgelerinin Belirlenmesi NOT: Yalnızca seçim temelli düzenleme kullanılıyorsa gereklidir. <ol><li> HDR şablonunda homoloji kolları olarak görev yapacak istenen silme yerinin her iki tarafında başlangıçta 1.5-2 kb olan iki bölge seçin ( Şekil 1A ). Klonlamayı kolaylaştırmak için her iki zincirde (GGTCTC) BsaI tanıma sitelerinden yoksun bölgeler belirleyin. BsaI siteleri kaçınılmazsa alternatif bir IIs kısıtlama enzimi (BsmBI, SapI, BbsI) kullanın ve alıcı plazmitteki karşılık gelen siteleri (pUC19-BsaI), direnç markörü verici plasmidini (pGolden-Neo veya pGolden-Hygro) değiştirin ve Homoloji kolu PCR ürünü çıkıntıları. </li></ol> 2. Cas9-sgRNA Ekspresyon Plazmidlerinin Üretimi <ol><li> Mutajenez için hedef alan (lar) ı tanımlayın. Tek kesimli, seçime bağlı olmayan yöntem için, bir non-fu olasılığını artırmak için 5 &#39;yakınlık kodlama eksonlarını hedefleyinNasyonal mutasyon. İki kesimli yöntem için, gerektiği kadar geni kapsayan iki site seçin. NOT: Deneyimlerimize göre 53 kb&#39;ye kadar olan silinmeler verimli bir şekilde oluşturulmuştur. </li><li> Hedeflenen bölge diziliminin 200 ila 300 bp&#39;lik değerini crispr.mit.edu tasarım aracına girin. Seçim temelli klonlama için, silme lokusuna yakın olan 200-300 bp&#39;lik tanımlanmış homoloji bölgelerini kullanın ( Şekil 1A ). Faaliyet bölgelerindeki farklılıkları açıklamak ve aynı potansiyel dışı etkileri paylaşmayan bağımsız klonları izole etmek için hedef bölgeye göre en üst sıralarda yer alan sgRNA&#39;lardan 2-3&#39;ünü seçin. </li><li> İfade plazmidine yerleştirilmek üzere uygun çıkıntılar ile duplekslenmiş oligonükleotitleri tasarlamak için, biten PAM dizisini (NGG) atlayın ve bir 5&#39;-CACC çıkıntısı takiben bir üst üste oligonoza bitişik ekleyin. Alt iplikçiği oligo için, ters tamamlanmış hedef dizisine bir 5&#39;-AAAC çıkıntı ekleyin, bunu takiben 3&#39;-C, ilAşağıda lustrated: <img alt="Sıra 1" src="/files/ftp_upload/55903/55903seq01.jpg" /></li><li> SgRNA&#39;lara karşılık gelen sentetik oligonükleotitleri, Zhang laboratuvar protokolü 29&#39;da tarif edildiği gibi Golden Gate klonlama 28&#39;i kullanarak pSpCas9 (BB) plasmidine yerleştirin. </li></ol> Homolojiye Yönelik Tamir Şablonu Plazmidlerinin Üretilmesi NOT: Yalnızca seçim temelli düzenleme kullanılıyorsa gereklidir. Homoloji yönelimli onarım şablonu plazmid, iki sgRNA hedef alanının hemen dışındaki genomu tamamlayan iki bölge tarafından çevrelenmiş bir ilaç direnci kasetinden oluşur ( Şekil 1B ). <ol><li> Adım 1.1&#39;de tanımlanan daha geniş homoloji bölgelerinden, homoloji kolları olarak görev yapmak üzere tasarlanmış Cas9 kesim bölgelerinden 800-1000 bp 26 en fazla 5-10 bp uzaklıkta olanı seçin ( Şekil 1A ). SgRNA&#39;yı içermediğinden emin olunHedef bölge ve PAM&#39;sini homoloji kollarında kullanır, çünkü şablon plazmitinin CRISPR / Cas9 bölünmesine neden olur. Homoloji kolları dahili BsaI siteleri içeriyorsa, alternatif sgRNA siteleri kullanın. </li><li> PCR, homolog bölgenin herhangi bir ucunda BsaI bölgelerini (GGTCTC) ve benzersiz çıkıntıları tanıtan ilave 5 &#39;sekansı olan ileri ve geri primerleri kullanarak üreticinin talimatlarına göre yüksek doğrulukta bir DNA polimerazı kullanarak genomik DNA&#39;dan homoloji kollarını yükseltmektedir. Çıkıntılar, aşağıda açıklandığı gibi ( Şekil 1B ) doğru montaj sırasını ve yönünü üretmek için doğru dizileri içermelidir: Sol homoloji kolu FP çıkıntısı: 5 &#39;GGGTCTCA GGCC Sol homoloji kolu RP çıkıntısı: 5 &#39;GGGTCTCT CACG Doğru homoloji kolu FP çıkıntısı: 5 &#39;GGGTCTCA GTCC Doğru homoloji kolu RP çıkıntısı: 5 &#39;GGGTCTCT CCAC </li><li> Uygun olan amplifık için homoloji kollarını kontrol edinİleriye ilerlemeden önce jel elektroforezi yoluyla verin. </li><li> Sağ ve sol homoloji kol bölgelerini direnç kaseti ile Golden Gate klonlama 28 ile bir HDR şablon plasmidine birleştirin. LoxP ile çevrili direnç kasetleri (loxP-PGK-Neo-pA-loxP veya loxP-PGK-Hyg-pA-loxP) kaynağı olarak pGolden-Neo veya pGolden-Hygro plazmidlerini 30 kullanın. Çoklu klonlama bölgesinde BsaI siteleri bulunan bir pUC19-BsaI, alıcı vektör olarak BSAI bölgelerini başka yerlerde elimine eden değiştirilmiş bir pUC19 kullanın (istek üzerine temin edilebilir). Üç ekleme ve vektör için 1: 1: 1: 1 oranını kullanın. <ol><li> Aşağıdaki reaksiyon karışımını 30 hazırlayın: <table><tbody><tr><td> Doğru homoloji kolu PCR ürünü </td><td> 0.06 pmol (30-40ng) </td></tr><tr><td> Sol homoloji kolu PCR ürünü </td><td> 0.06 pmol (30-40ng) </td></tr><tr><td> PGolden-Neo plasmid (100 ng / ml) </td><td> 1 &amp;181. L </td></tr><tr><td> PUC19-BsaI plasmid (100 ng / ml) </td><td> 1 uL </td></tr><tr><td> 2x T7 DNA ligaz tamponu </td><td> 5 uL </td></tr><tr><td> BsaI (10 U / uL) </td><td> 0,75 μL </td></tr><tr><td> T7 DNA ligazı (3000 U / uL) </td><td> 0.25 uL </td></tr><tr><td> Su </td><td> 10 μL&#39;ye kadar </td></tr></tbody></table></li><li> Aşağıdaki termal çevrimci parametrelerini kullanın: 5 dakika boyunca 37 ° C, 5 dakika için 20 ° C. 30 döngü için tekrarlayın. </li><li> Geriye kalan doğrusallaştırılmış DNA&#39;yı sindirmek için üreticinin talimatlarına göre klonlama ürününe bir eksonükleaz verin. </li><li> Reaksiyon karışımını hücrelerle verilen protokole göre yetkili bir E. coli suşuna, ampisilin içeren kaplarda plaka haline getirin. </li></ol></li><li> Doğru şablon düzeneğiyle klonları tanımlamak için, bakteri uygulamak(Tamamı eklemenin güvenilir şekilde büyütülmesi için çok büyük olabilmesi nedeniyle) birleştirilen ekin homoloji kolu alt bölümlerini büyütmek için al koloni PCR. Kenar altındaki plazmid dizisine bir primer tavlama ve direnç kasetinin kenarına tamamlayıcı ikinci bir primer kullanın ( Şekil 1B , sıra hem Neo hem de Hygro eklerinde ortaktır), yaklaşık 200 bp daha uzun bir montaja bağlı ürünü üretir Içerilen homoloji kolu: PUC19-Bsal-Left: 5 &#39;GGCTCGTATGTTGTGTGGAATTGTGAG Direnç-Sol: 5 &#39;AAAAGCGCCTCCCCTACCC PUC19-BsaI-Sağ: 5 &#39;GCTATTACGCCAGCTGGCGAAA Direnç-Sağ: 5 &#39;AAGACAATAGCAGGCATGCTGGG <ol><li> Steril kürdan ile bakteri kolonileri seçin ve 20 μL su bakterileri askıya al. 95 ° C&#39;de 15 dakika ısıtın ve bir masa santrifüjünde 5 dakika süreyle maksimum hızda aşağı doğru döndürün. Hemen buzda bekletin. </li><li> Aşağıdaki PCR karışımını hazırlayın 31 &lt;/ Sup&gt;: <table><tbody><tr><td> Seyreltik koloni şablonu </td><td> 1.25 μL </td></tr><tr><td> 10x Taq reaksiyon tamponu </td><td> 1.25 μL </td></tr><tr><td> 20 mM dNTP&#39;ler </td><td> 0.25 uL </td></tr><tr><td> 10 uM İleri primer </td><td> 0.25 uL </td></tr><tr><td> 10 uM Geri astar </td><td> 0.25 uL </td></tr><tr><td> Taq Polimeraz </td><td> 0.25 uL </td></tr><tr><td> Su </td><td> 9 uL </td></tr></tbody></table></li><li> Aşağıdaki termal siklör parametrelerini kullanın: 30 saniye süreyle 95 ° C, (95 ° C 30 saniye, 30 saniye için 61 ° C, 1 dakika / kb için 72 ° C) 25 devir için tekrarlayın, 72 ° C&#39;de 2 dakika boyunca tekrarlayın. </li><li> Agaroz jel elektroforezi ile doğru amplikon boyutu için PCR ürününü kontrol edin. </li><li> İsteğe bağlı olarak, doğru ekleme boyutu ve sırası ile bireysel kolonilerden miniprep plazmid DNAE homoloji kol bölgeleri yukarıda adı geçen amplifikasyon primerleri ile Sanger dizilişiyle. </li></ol></li></ol> 4. CRISPR bileşenlerinin kültürlenmiş hücrelere transferi <ol><li> Transfeksiyondan önce: 37 ° C&#39;de ve% 5 C02&#39;de% 10 FBS ile takviye edilmiş DMEM ortamında T-REx293 hücrelerini kültürleyin. </li><li> 6-kuyucuklu plakalara hücreleri plaklayın ve yaklaşık% 70 konfluansa kadar büyür. Transfekte edilmemiş bir kontrol için bir kuyu ekleyin. </li><li> Ticari bir transfeksiyon protokolü kullanarak 2.5 ug toplam plazmid ile transfekte hücreler. Buna paralel olarak, transfekte edilmemiş kontrolü muhafaza edin. NOT: Transfeksiyon yöntemi ve verimliliği hücre tipine göre değişir. Deneyden önce sistem için uygun transfeksiyon yöntemini belirleyin. <ol><li> Hücrelerin seçimle transfekte edilmesi için 0.75 μg Cas9-sgRNA 1 (sol kesim), 0.75 μg Cas9-sgRNA 2 (sağ kesim) ve 1.0 μg homolog rekombinasyon şablonu kullanın. </li><li> Transfecti içinSeçim yapılmadan hücrelerin açık olmasını istiyorsanız, 2.5 μg Cas9-sgRNA plazmid kullanın. </li></ol></li></ol> 5. İlaç Seçimi <ol><li> Transfeksiyondan 48 saat sonra hücreleri uygun ilaçla tedavi edin (Neomisin / Hygromycin). Transfekte edilmemiş kontrol hücresindeki tüm hücreler ölünceye kadar seçim yapın (genellikle Neo için 3-5 gün, Hygro için 7-14 gün). NOT: T-REx293 hücreleri için Neomisin ve Hygromycin için sırasıyla 500 μg / mL ve 10 μg / mL konsantrasyonları kullanın. Diğer hücre türleri için etkin konsantrasyonu belirlemek için transfekte edilmemiş hücreler üzerinde ilacın önceden titrasyonunun yapılması yararlı olabilir. </li></ol> 6. Klon Popülasyonlarının İzolasyonu <ol><li> Seçildikten sonra orijinal kuyudaki hücreleri% 100 konfluansa kadar büyütün. Kuyu başına 0.33 hücre yoğunluğunda 96 oyuklu plakalara hücreler tohumlandı. NOT: Üç 96 yuvalı plakanın tohumlanması, birden fazla doğru klonun izolasyonunu sağlamak için iyi bir başlangıç ​​noktasıdır, ancak daha fazla ya da daha azına ihtiyaç duyulabilir.SgRNA ve HDR verimliliklerine son verir. </li><li> Koloniler gözle görünene kadar, 2-4 hafta süreyle kolonilere dikkat edin. Steril bir pipet ucu ile görünür koloniler seçin ve tek katmanlı büyümeyi teşvik etmek için yeni kuyularda yeniden sıkıştırın. Süspansiyon hücrelerini kullanırken, tek koloni kuyularının daha büyük bir kısmını sağlamak için daha düşük ekim yoğunlukları kullanılabilir. </li></ol> 7. Tarama Adayları <ol><li> Seçim kullanmadan adayları tarama: nokta leke <ol><li> Bireysel klonları% 50-100 konfluansa yükseltin. Kuyu içinde pipetleme yaparak hücrelerin tek katmanını çıkarın. </li><li> Temiz bir mikrosantrifüj tüpüne 100 uL&#39;lik toplam hacmden 90 μL&#39;ye bölün. 5 dakika boyunca 6000 rpm&#39;de aşağı döndürün, ortamı alın ve 1 x Lysis Tamponu veya 1x SDS yükleme tamponu (5x: 250 mM Tris-Cl pH 6.8,% 8 SDS,% 0.1 bromofenol mavisi,% 40&#39;lık 10 uL&#39;lik hücre pelletini lize edin. Gliserol, 100 mM DTT). Wel&#39;de hücrelerin geri kalanına 90 uL yeni medya ekleyinYayılmaya devam edeceğim. </li><li> Bir nokta oluşturmak için kuru nitroselüloz zar üzerine 1 μL hücre lizatı pipetleyin. Her örneği iki ayrı zar üzerinde iki kez lekeleyerek iki aynı örnek örneği oluşturun. </li><li> TBST (Tris Tamponlu Tuz +% 0.01 Tween 20: 8 g NaCl, 0.2 g KCI, 3 g Tris baz, 1 L damıtılmış suya kadar, pH 7.4) içinde% 5 sütteki membranları oda sıcaklığında 1 saat bloke edin Sallama, burada ve prosedür boyunca). </li><li> Bir membranda hedef proteine ​​karşı birincil antikor ve bir kontrol proteini için birincil antikor (tubulin, GAPDH veya değişmesi beklenmeyen diğer proteinler) kullanılarak leke. TBST +% 5 sütte önerilen primer antikor seyreltmesini (ELAVL1 için 0.2 μg / mL ve bu durumda Pum2 için 0.1 μg / mL) kullanın. 1 saat oda sıcaklığında inkübe edin. </li><li> TBST ile 3 kez 15 dakika yıkayın. </li><li> Her membranı T&#39;de uygun HRP ile konjüge edilmiş sekonder antikorla inkübe edinBST + oda sıcaklığında 1 saat boyunca% 5 süt. </li><li> TBST ile 3 kez 15 dakika yıkayın. </li><li> Üreticinin talimatlarını izleyerek kemilüminesan substrat çözeltisi uygulayın (Malzeme Tablosuna bakın) ve blotlanmış membranı bir dijital kemilüminesans görüntüleyicide görüntüleyin. </li><li> Uygun yazılım kullanarak hedef ve kontrol proteinleri için nokta yoğunluklarını nicelleştirin. </li><li> Düşük kontrol protein sinyali ile adayları yok edin ve geri kalan adaylar için protein yoğunluklarını kontrol etmek için hedefin arka plandan çıkarılmış oranlarını hesaplayın. Geçiş için en düşük oranlara sahip adayları seçin ve batı leke ile daha fazla doğrulama yapın. </li></ol></li><li> Seçim kullanılarak tarama adayları: koloni PCR <ol><li> Bir DNA hazırlama kiti kullanarak hücre lizatı toplayın (Bkz. Malzeme Tablosu ). <ol><li> Tek tek kolonileri yeni bir 96 kuyucukta çoğaltın ve% 100 konfluene kadar büyür. </li><li> Bir grup klondan ortam çıkarın,Kitten 30 μL ekstraksiyon tamponu içindeki hücreleri tekrar süspansiyon haline getirin. Temiz bir 1.5 mL&#39;lik mikrosantrifüj tüpüne aktarın. </li><li> Çözeltiyi 96 ° C&#39;ye 15 dakika ısıtın ve oda sıcaklığına soğumasını bekleyin. </li><li> Kitten 30 μL Stabilizasyon tamponu ekleyin. İyice karıştırın. </li></ol></li><li> Yabani tip ve monoelale / bialelik mutant hatlarını koloni PCR ile tanımlayın. <ol><li> Direnç kasetinin başarılı veya başarısız entegrasyonuna dayalı olarak homoloji kollarının etrafındaki bölgeleri büyütmek için iki ayrı PCR primeri seti (hedeflenen lokusun sol ve sağ tarafı için) tasarlayın ( Şekil 2C ). Her iki tarafta, homoloji kolunun dışında tavlanmış ortak bir primer (kırmızı) kullanın. Vahşi tipli alleli test etmek için homoloji bölgesini (mavi) kapsayan endojen diziyi tamamlayan karşılık gelen eşleştirilmiş bir primerle kullanın. Takılan direnç kasetini tamamlayan başka bir çift astar kullanın (bkz. Bölümlerdeki primerler2.3), arzu edilen mutasyonu test etmek için. </li><li> (Önerilir) Başlangıçtaki seçilmiş toplu hücre popülasyonundan hücre lisatı kullanılarak primer setlerini doğrulayın, çünkü hem WT hem de mutant allellerin bir karışımını içerecektir ( Şekil 2D ). </li><li> Aşağıdaki reaksiyon karışımını hazırlayın: <table><tbody><tr><td> Hücre lisatı </td><td> 0.5 uL </td></tr><tr><td> 10x KOD tampon </td><td> 1.25 μL </td></tr><tr><td> 25 mM MgS04 </td><td> 0,75 μL </td></tr><tr><td> 2 mM dNTP&#39;ler </td><td> 1.25 μL </td></tr><tr><td> 10 uM İleri primer </td><td> 0.375 uL </td></tr><tr><td> 10 uM Geri astar </td><td> 0.375 uL </td></tr><tr><td> KOD polimeraz </td><td> 0.25 uL </td></tr><tr><td> Su </td><td> 7,75 μL </td></tr></tbody></table></li><li> Aşağıdaki termal çevrimci koşullarını kullanın: 95 ° C&#39;de 2 dakika, (95 ° C&#39;de 20 saniye, Primer Tm&#39;de 10 saniye, 70 ° C&#39;de 20 s / kb) tekrarlama. </li><li> PCR ürününü agaroz jel elektroforezi ile görselleştirin. </li></ol></li><li> Tahmini entegrasyonun her iki tarafı için koloni PCR testini tekrarlayın. Silinmiş bölge için entegrasyonun varlığını ve içsel sıra ürününü göstermeyen adayları seçin ve genişletin. </li><li> Pozitif adayları western blot ve / veya RT-qPCR ile doğrulayın. </li></ol></li></ol> 8. Sırayla Sıralama Genomik Mutasyonunu Doğrulayın <ol><li> Genomik DNA&#39;yı mutant hücre çizgilerinden fenol kloroform ekstraksiyonu ile izole edin 31 . </li><li> PCR, her ucuna BsaI kısıtlama siteleri ekleyen 5 &#39;çıkıntılı primerler kullanılarak sgRNA hedef bölgesini çoğaltılır. NOT: HDR ile düzenlenmiş klonlar için, her iki allel de aynı olabilir, PCR ürünü doğrudan dizilenebilir. </li><li> Golden Gate klonlama ile güçlendirilmiş bölgeyi pUC19-BsaI&#39;ye klonlayın. </li><li> Reaksiyon karışımı, yetkili bir E. coli suşuna dönüştürülür. </li><li> 6-10 bireysel koloniden plazmid DNA&#39;yı miniiprep edin ve Sanger dizilemesi ile klonlanmış bölgeyi dizinleyin. </li></ol>

<ol>
	<li>Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+with+zinc-finger+nucleases.">Genome engineering with zinc-finger nucleases.</a> Genetics. 188 (4), 773-782 (2011).</li><li>Kim, Y. G., Cha, J., Chandrasegaran, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hybrid+restriction+enzymes:+zinc+finger+fusions+to+Fok+I+cleavage+domain.">Hybrid restriction enzymes: zinc finger fusions to Fok I cleavage domain.</a> Proc Natl Acad Sci U S A. 93 (3), 1156-1160 (1996).</li><li>Bibikova, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stimulation+of+homologous+recombination+through+targeted+cleavage+by+chimeric+nucleases.">Stimulation of homologous recombination through targeted cleavage by chimeric nucleases.</a> Mol Cell Biol. 21 (1), 289-297 (2001).</li><li>Bibikova, M., Golic, M., Golic, K. G., Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+chromosomal+cleavage+and+mutagenesis+in+Drosophila+using+zinc-finger+nucleases.">Targeted chromosomal cleavage and mutagenesis in Drosophila using zinc-finger nucleases.</a> Genetics. 161 (3), 1169-1175 (2002).</li><li>Porteus, M. H., Cathomen, T., Weitzman, M. D., Baltimore, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+gene+targeting+mediated+by+adeno-associated+virus+and+DNA+double-strand+breaks.">Efficient gene targeting mediated by adeno-associated virus and DNA double-strand breaks.</a> Mol Cell Biol. 23 (10), 3558-3565 (2003).</li><li>Bogdanove, A. J., Voytas, D. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+effectors:+customizable+proteins+for+DNA+targeting.">TAL effectors: customizable proteins for DNA targeting.</a> Science. 333 (6051), 1843-1846 (2011).</li><li>Miller, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+TALE+nuclease+architecture+for+efficient+genome+editing.">A TALE nuclease architecture for efficient genome editing.</a> Nat Biotechnol. 29 (2), 143-148 (2011).</li><li>Moscou, M. J., Bogdanove, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+cipher+governs+DNA+recognition+by+TAL+effectors.">A simple cipher governs DNA recognition by TAL effectors.</a> Science. 326 (5959), 1501 (2009).</li><li>Christian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+DNA+double-strand+breaks+with+TAL+effector+nucleases.">Targeting DNA double-strand breaks with TAL effector nucleases.</a> Genetics. 186 (2), 757-761 (2010).</li><li>Jiang, W., Marraffini, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas:+New+Tools+for+Genetic+Manipulations+from+Bacterial+Immunity+Systems.">CRISPR-Cas: New Tools for Genetic Manipulations from Bacterial Immunity Systems.</a> Annu Rev Microbiol. 69, 209-228 (2015).</li><li>Barrangou, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+provides+acquired+resistance+against+viruses+in+prokaryotes.">CRISPR provides acquired resistance against viruses in prokaryotes.</a> Science. 315 (5819), 1709-1712 (2007).</li><li>Karginov, F. V., Hannon, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR+system:+small+RNA-guided+defense+in+bacteria+and+archaea.">The CRISPR system: small RNA-guided defense in bacteria and archaea.</a> Mol Cell. 37 (1), 7-19 (2010).</li><li>Wiedenheft, B., Sternberg, S. H., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+genetic+silencing+systems+in+bacteria+and+archaea.">RNA-guided genetic silencing systems in bacteria and archaea.</a> Nature. 482 (7385), 331-338 (2012).</li><li>Mojica, F. J., Diez-Villasenor, C., Garcia-Martinez, J., Soria, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intervening+sequences+of+regularly+spaced+prokaryotic+repeats+derive+from+foreign+genetic+elements.">Intervening sequences of regularly spaced prokaryotic repeats derive from foreign genetic elements.</a> J Mol Evol. 60 (2), 174-182 (2005).</li><li>Pourcel, C., Salvignol, G., Vergnaud, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+elements+in+Yersinia+pestis+acquire+new+repeats+by+preferential+uptake+of+bacteriophage+DNA,+and+provide+additional+tools+for+evolutionary+studies.">CRISPR elements in Yersinia pestis acquire new repeats by preferential uptake of bacteriophage DNA, and provide additional tools for evolutionary studies.</a> Microbiology. 151 (Pt 3), 653-663 (2005).</li><li>Brouns, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+CRISPR+RNAs+guide+antiviral+defense+in+prokaryotes.">Small CRISPR RNAs guide antiviral defense in prokaryotes.</a> Science. 321 (5891), 960-964 (2008).</li><li>Deltcheva, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+RNA+maturation+by+trans-encoded+small+RNA+and+host+factor+RNase+III.">CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III.</a> Nature. 471 (7340), 602-607 (2011).</li><li>Garneau, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR/Cas+bacterial+immune+system+cleaves+bacteriophage+and+plasmid+DNA.">The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA.</a> Nature. 468 (7320), 67-71 (2010).</li><li>Marraffini, L. A., Sontheimer, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+interference+limits+horizontal+gene+transfer+in+staphylococci+by+targeting+DNA.">CRISPR interference limits horizontal gene transfer in staphylococci by targeting DNA.</a> Science. 322 (5909), 1843-1845 (2008).</li><li>Gasiunas, G., Barrangou, R., Horvath, P., Siksnys, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cas9-crRNA+ribonucleoprotein+complex+mediates+specific+DNA+cleavage+for+adaptive+immunity+in+bacteria.">Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria.</a> Proc Natl Acad Sci U S A. 109 (39), E2579-E2586 (2012).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Davis, A. J., Chen, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+double+strand+break+repair+via+non-homologous+end-joining.">DNA double strand break repair via non-homologous end-joining.</a> Transl Cancer Res. 2 (3), 130-143 (2013).</li><li>Guirouilh-Barbat, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+the+KU80+pathway+on+NHEJ-induced+genome+rearrangements+in+mammalian+cells.">Impact of the KU80 pathway on NHEJ-induced genome rearrangements in mammalian cells.</a> Mol Cell. 14 (5), 611-623 (2004).</li><li>Moore, J. K., Haber, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+cycle+and+genetic+requirements+of+two+pathways+of+nonhomologous+end-joining+repair+of+double-strand+breaks+in+Saccharomyces+cerevisiae.">Cell cycle and genetic requirements of two pathways of nonhomologous end-joining repair of double-strand breaks in Saccharomyces cerevisiae.</a> Mol Cell Biol. 16 (5), 2164-2173 (1996).</li><li>Liang, F., Han, M., Romanienko, P. J., Jasin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Homology-directed+repair+is+a+major+double-strand+break+repair+pathway+in+mammalian+cells.">Homology-directed repair is a major double-strand break repair pathway in mammalian cells.</a> Proc Natl Acad Sci U S A. 95 (9), 5172-5177 (1998).</li><li>Gratz, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+specific+and+efficient+CRISPR/Cas9-catalyzed+homology-directed+repair+in+Drosophila.">Highly specific and efficient CRISPR/Cas9-catalyzed homology-directed repair in Drosophila.</a> Genetics. 196 (4), 961-971 (2014).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339 (6121), 819-823 (2013).</li><li>Engler, C., Kandzia, R., Marillonnet, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one+pot,+one+step,+precision+cloning+method+with+high+throughput+capability.">A one pot, one step, precision cloning method with high throughput capability.</a> PLoS One. 3 (11), e3647 (2008).</li><li>Ran, F. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+using+the+CRISPR-Cas9+system.">Genome engineering using the CRISPR-Cas9 system.</a> Nat Protoc. 8 (11), 2281-2308 (2013).</li><li>Luo, Y., Lin, L., Bolund, L., Sorensen, C. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+construction+of+rAAV-based+gene+targeting+vectors+by+Golden+Gate+cloning.">Efficient construction of rAAV-based gene targeting vectors by Golden Gate cloning.</a> Biotechniques. 56 (5), 263-268 (2014).</li><li>Green, M. R., Sambrook, J., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning: a laboratory manual. , (2012).</li><li>Lin, S., Staahl, B. T., Alla, R. K., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+homology-directed+human+genome+engineering+by+controlled+timing+of+CRISPR/Cas9+delivery.">Enhanced homology-directed human genome engineering by controlled timing of CRISPR/Cas9 delivery.</a> Elife. 3, e04766 (2014).</li><li>Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+RNA-guided+genome+editing+in+human+cells+via+delivery+of+purified+Cas9+ribonucleoproteins.">Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins.</a> Genome Res. 24 (6), 1012-1019 (2014).</li></ol>

Yazarlar, rekabet eden mali çıkarlarının olmadığını beyan ettiler.

CRISPR / Cas9 sistemi, diğer geçici manipülasyon yöntemlerine daha tutarlı bir alternatif sağlayan stabil genomik modifikasyonların verimli bir şekilde oluşturulmasına izin vermiştir. Burada, memeli hücre hatlarında CRISPR / Cas9 gen nakavtın hızlı tanımlanması için iki yöntem sunduk. Her iki yöntem de çok az hücresel malzeme gerektirir, bu nedenle test, klonal kültüre ait erken safhalarda yapılabilir, zamandan ve reaktiflerden tasarruf edilebilir. Her iki yöntemin verimliliğini artırmak iç...

<html> Kararlı genetik değişiklikler, verimlilik ve süre bakımından değişken olabilen geçici hücresel pertürbasyon yöntemlerine göre bir avantaj sağlar. Genomik düzenleme, çinko parmak nükleazları 1 , 2 , 3 , 4 , 5 , transkripsiyon aktivatörü benzeri efektör nükleazları (TALEN&#39;ler) 6 , 7 , 8 , 9 gibi hedefe spesifik nükleazların gelişimi nedeniyle son yıllarda giderek yaygınlaşmaktadır. Ve kümelenmiş, düzenli olarak aralıklı kısa palindromik tekrarlardan (CRISPR) türemiş RNA yönlendirmeli nükleazlar 10 . CRISPR / Cas9 düzenleme makineleri bakterilerin ve arkeaların viral enfeksiyonlara karşı savunmak için kullandıkları bağışıklık sisteminden adapte edilmiştirAss = &quot;xref&quot;&gt; 11 , 12 , 13 . Bu süreçte, işgalci viral dizinin kısa, 20-30 nt fragmanları, tekrar eden birimler 14 , 15 tarafından çevrelenen &quot;aralayıcılar&quot; olarak genomik bir lokasyona dahil edilir. Ardından transkripsiyon ve RNA işleme, bir aktive edici crRNA 17 (tracrRNA) ile efektör Cas9 endonükleazı birleştiren küçük CRISPR ilişkili RNA&#39;lar16 (crRNA&#39;lar) üretir. Dolayısıyla, crRNA&#39;lar Cas9 hedeflemesine özgüllük sağlar, kompleksi tamamlayıcı viral DNA dizilerini bölmeye yönlendirir ve diğer enfeksiyonları önler 18,19. Hedeflenen DNA&#39;daki herhangi bir &quot;protospacer&quot; sekans, kısa bir protospazere komşu motife (PAM) doğrudan 5 &#39;, S. pyogenes Cas9 durumunda ise NGG olduğu sürece, crRNA&#39;nın kaynağı olarak görev yapabilir <sUp class = &quot;xref&quot;&gt; 20. Ev sahibinin CRISPR lokusu içindeki boşluk yakınında PAM sekansının olmaması, benliğin kendisi ile ben olmayan arasındaki ayrımı yaparak, ev sahibinin hedeflenmesini engeller. Evrenselliği ve esnekliği nedeniyle, bu biyolojik sistem genomik düzenleme için güçlü bir şekilde adapte edilmiştir, böylelikle hemen hemen her PAM bitişik DNA sitesi hedeflenebilir. Bu sürümde, başka bir değişiklik, crRNA ve tracRNA&#39;yı Cas9 protein 21&#39;e yüklenen tek bir rehber RNA (sgRNA) bileşenine kaynaştırdı. Ökaryotik hücrelerde Cas9 ve bir sgRNA ekspresyonu üzerine Cas9 proteini, her iki DNA kolunu hedeflenen lokusta parçalamaktadır. Uygun homolog bir dizinin yokluğunda hücre bu kopuşu tipik olarak küçük delesyonlar veya nadiren eklemeler başlatan homolog olmayan uç birleştirme (NHEJ) 22 , 23 , 24 aracılığıyla tespit eder. Bir açık hedefleme yaparkenOkuma çerçevesi, onarım muhtemelen işlevsel olmayan bir protein ürünü üreten bir translasyonel çerçeve kaymasına yol açar. Aksine, geniş homoloji bölgelerine sahip bir dışsal şablon ile sağlandığında, hücre homolog yöneltilmiş onarım 25 , 26 ile çift iplikçik kırılmasını sabitleyebilir. Bu yol, genomda daha büyük hassas silme, değiştirme veya eklemeye izin verir ve ölebilir seçim işaretleri 27&#39;nin eklenmesi ile birlikte. Burada, bu iki CRISPR / Cas9 yöntemlerinden biri ile nakavt hücre hatları üretmek için protokoller sunuyoruz ( Şekil 1A ). NHEJ yaklaşımı, tek bir sgRNA kesim bölgesini ve seçiciden bağımsız taramayı kullanır ve bu nedenle çok fazla ön hazırlık gerektirir. Bu yöntemi kullanırken, transkriptin 5 &#39;ucundaki eksonları tamamlayan ve en iyi nakavt üreten kılavuz RNA&#39;lar tasarlanmalıdır. Modifikattan beriBu durumda iyonların genoma küçük olması, nakavt klonlarının taranması, protein ürününün yüksek verimli bir şekilde değerlendirildiği nokta lekelerine dayanıyor. Bir örnek olarak ELAV benzeri 1 protein (ELAVL1) nakavt hatları neslini kullanırız. İkinci yaklaşım, homoloji yönelimli onarım (HDR) üzerine kuruludur ve onlarca kb silinmesine izin vererek ilgi geni veya bölgeyi kapsayan iki sgRNA kesim bölgesini kullanır. Yarılma bölgelerinin yanındaki iki homoloji bölgesine sahip bir plazmid, nakavt üretiminin verimliliğini arttıran seçilebilir bir direnç markeri tanıtan bir değiştirme şablonu ( Şekil 1B ) sağlar. Bu yöntem, uygun şekilde tasarlanmış homoloji kollarıyla gen modifikasyonlarını başlatmak için uyarlanabilir. Bu durumda, yeni bir DNA parçasının entegrasyonu PCR&#39;ye dayalı taramaya izin verir ( Şekil 1C ). Burada, örnek olarak Pumilio RNA bağlayıcı aile üyesi 2 (PUM2) nakavt hatları neslini kullanıyoruz.

<table border="0" cellpadding="0" cellspacing="0" width="740">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:227px;">Competent E. coli cells</td>
			<td style="width:95px;"></td>
			<td style="width:120px;"></td>
			<td style="width:299px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">plasmid prep kit</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pSpCas9(BB) plasmid</td>
			<td>Addgene</td>
			<td>42230</td>
			<td>Ran et al 2013, cloning sgRNAs</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">BbsI enzyme</td>
			<td>ThermoFisher</td>
			<td>FD1014</td>
			<td>Ran et al 2013, cloning sgRNAs</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">T7 DNA ligase</td>
			<td>NEB</td>
			<td>M0318L</td>
			<td>Ran et al 2013, cloning sgRNAs</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Tango Buffer</td>
			<td>ThermoFisher</td>
			<td>BY5</td>
			<td>Ran et al 2013, cloning sgRNAs</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">PlasmidSafe exonuclease</td>
			<td>Epicentre</td>
			<td>E3105K</td>
			<td>Ran et al 2013, cloning sgRNAs</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Q5 hot start high fidelity polymerase</td>
			<td>NEB</td>
			<td>M0494A</td>
			<td>HA amplification</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pUC19-BsaI</td>
			<td></td>
			<td></td>
			<td>Modified pUC19 plasmid, mutated existing BsaI site and inserted two outward facing BsaI sites after BamHI/EcoRI digestion</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pGolden-Neo</td>
			<td>Addgene</td>
			<td>51422</td>
			<td>Resistance cassette</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pGolden-Hygro</td>
			<td>Addgene</td>
			<td>51423</td>
			<td>Resistance cassette</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">BsaI enzyme</td>
			<td>NEB</td>
			<td>R3535S</td>
			<td>Homology arm contruction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">T7 DNA ligase</td>
			<td>NEB</td>
			<td>M0318L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">PlasmidSafe exonuclease</td>
			<td>Epicentre</td>
			<td>E3105K</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Toothpicks</td>
			<td></td>
			<td></td>
			<td>bacterial PCR</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Taq polymerase</td>
			<td></td>
			<td></td>
			<td>bacterial colony PCR</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HEK293 human cells</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DMEM</td>
			<td>Corning</td>
			<td>10-013-CV</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">FBS</td>
			<td>Corning</td>
			<td>MT35010CV</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Penicillin-Strep (opt.)</td>
			<td>Gibco</td>
			<td>15140-122</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">6 well plates</td>
			<td>BioLite</td>
			<td>12556004</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">TransIT-LTI Transfection Reagent</td>
			<td>Mirus</td>
			<td>MIR2300</td>
			<td>for lipofection only</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Opti-MEM</td>
			<td>ThermoFisher</td>
			<td>31985062</td>
			<td>for lipofection only</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">G418 (Neomycin)</td>
			<td>Sigma Aldrich</td>
			<td>A1720-5G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Hygromycin</td>
			<td>Sigma Aldrich</td>
			<td>H3274-250MG</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">96 well plates</td>
			<td>ThermoFisher</td>
			<td>12556008</td>
			<td></td>
		</tr>
		<tr height="18">
			<td height="18" style="height:18px;">Passive Lysis Buffer, 5x</td>
			<td>Promega</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="18">
			<td height="18" style="height:18px;">1xSDS loading buffer</td>
			<td></td>
			<td></td>
			<td>recipe decribed in protocol</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Nitrocellulose Membrane</td>
			<td>Bio-Rad</td>
			<td>162-0115</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">TBST</td>
			<td></td>
			<td></td>
			<td>recipe decribed in protocol</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Dehydrated milk</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SuperSignal West Dura Extended Duration Substrate</td>
			<td>ThermoFisher</td>
			<td>34075</td>
			<td>for HRP-conjugated secondary antibodies</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Extracta DNA prep for PCR</td>
			<td>Quantabio</td>
			<td>95091-025</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">KOD polymerase</td>
			<td>Novagen</td>
			<td>71316</td>
			<td></td>
		</tr>
	</tbody>
</table>

selection-dependent and independent generation of crispr/cas9-mediated gene knockouts in mammalian cells

CRISPR / Cas9 genom mühendisliği sistemi, az çaba sarf ederek hassas genom düzenlemesine izin vererek biyolojiye devrim yarattı. Spesifikliği kazandıran tek bir rehber RNA (sgRNA) yardımıyla Cas9 proteini, her iki DNA zincirini hedeflenen lokusta parçalamaktadır. DNA kopması homolog olmayan bitiş katılma (NHEJ) veya homoloji yönelimli onarım (HDR) tetikleyebilir. HDR, daha büyük ve daha hassas pertürbasyonlara izin verirken, NHEJ, çerçeve kayması mutasyonlarına yol açan küçük delesyonlar veya eklemeler başlatabilir. Burada, çökertilmiş hücre hatlarının üretilmesi için protokolleri, kurulu CRISPR / Cas9 yöntemlerini downstream seçim / tarama için iki seçenek ile birleştirerek sunuyoruz. NHEJ yaklaşımı, tek bir sgRNA kesim bölgesini ve seleksiyondan bağımsız taramayı kullanır; burada, protein üretiminin nokta imünoblotuyla yüksek verimli bir şekilde değerlendirildiği yerdir. HDR yaklaşımı ilgi geni boyunca uzanan iki sgRNA kesim bölgesini kullanır. Sağlanan HDR şablonuyla birlikte bu yöntem silme gerçekleştirebilirEklenebilen seçilebilir direnç işaretleyicisinin yardımıyla, onlarca kb arasında değişir. Her bir yöntemin uygun uygulamaları ve avantajları tartışılmıştır.

ELAVL1 nakavt hatlarının üretilmesi için sağlam bir antikor mevcuttu, bu nedenle tek sgRNA&#39;lar ( Şekil 1A , solda) kullanılarak düzenleme, ardından nokta immünoblot uygulandı. Elde edilen klonlarda verimlilikleri karşılaştırmak ve hedef etkileri dışarıda bırakmak için bağımsız olarak üç sgRNA transfekte edildi. Hücre lizatlarını, iki nitroselüloz zar üzerine klonal popülasyondan toplayıp blotladıktan sonra lekeler hem ELA...

Watch this Scientific Journal Video about Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells at JoVE.com

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

Somatik hücre dizilerini genetik olarak manipüle etme becerisindeki son gelişmeler, temel ve uygulamalı araştırmalar için büyük potansiyele sahiptir. Burada, CRISPR / Cas9&#39;un ürettiği nakavt üretimi ve seçilebilir işaretlerin kullanılıp kullanılmadığı memeli hücre hatlarında tarama için iki yaklaşım sunuyoruz.

Memeli Hücrelerinde CRISPR / Cas9 aracılı Gen Knockout&#39;larının Seçime Bağlı ve Bağımsız Üretimi

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

selection-dependent-independent-generation-crisprcas9-mediated-gene

Research

JoVE Journal

Genetics

12.4K Görüntüleme.  University of California, Riverside.  Somatik hücre dizilerini genetik olarak manipüle etme becerisindeki son gelişmeler, temel ve uygulamalı araştırmalar için büyük potansiyele sahiptir. Burada, CRISPR / Cas9'un ürettiği nakavt üretimi ve seçilebilir işaretlerin kullanılıp kullanılmadığı memeli hücre hatlarında tarama için iki yaklaşım sunuyoruz. 

Video: Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

Parallel Measurement of Circadian Clock Gene Expression and Hormone Secretion in Human Primary Cell Cultures

Circadian clocks are functional in all light-sensitive organisms, allowing for an adaptation to the external world by anticipating daily environmental changes. Considerable progress in our understanding of the tight connection between the circadian clock and most aspects of physiology has been made in the field over the last decade. However, unraveling the molecular basis that underlies the function of the circadian oscillator in humans stays of highest technical challenge. Here, we provide a detailed description of an experimental approach for long-term (2-5 days) bioluminescence recording and outflow medium collection in cultured human primary cells. For this purpose, we have transduced primary cells with a lentiviral luciferase reporter that is under control of a core clock gene promoter, which allows for the parallel assessment of hormone secretion and circadian bioluminescence. Furthermore, we describe the conditions for disrupting the circadian clock in primary human cells by transfecting siRNA targeting CLOCK. Our results on the circadian regulation of insulin secretion by human pancreatic islets, and myokine secretion by human skeletal muscle cells, are presented here to illustrate the application of this methodology. These settings can be used to study the molecular makeup of human peripheral clocks and to analyze their functional impact on primary cells under physiological or pathophysiological conditions.

Here, we describe settings to monitor in parallel circadian bioluminescence and the secretory activity of human islet cells and primary myotubes. For this, we employed lentiviral gene delivery of a luciferase core clock reporter, followed by in vitro synchronization and collection of outflow medium by continuous cell perifusion.

İnsan Primer Hücre Kültürleri içinde Sirkadyen Saat Gen İfade ve Hormon salgısını Paralel Ölçümü

Circadian clocks are functional in all light-sensitive organisms, allowing for an adaptation to the external world by anticipating daily environmental ...

Genetik

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

Advances in genomics have raised the possibility of probing biodiversity at an unprecedented scale. However, sequence alone will not be informative without tools to study gene function. The development and sharing of detailed protocols for the establishment of new model systems in laboratories, and for tools to carry out functional studies, is thus crucial for leveraging the power of genomics. Coleoptera (beetles) are the largest clade of insects and occupy virtually all types of habitats on the planet. In addition to providing ideal models for fundamental research, studies of beetles can have impacts on pest control as they are often pests of households, agriculture, and food industries. Detailed protocols for rearing and maintenance of D. maculatus laboratory colonies and for carrying out dsRNA-mediated interference in D. maculatus are presented. Both embryonic and parental RNAi procedures-including apparatus set up, preparation, injection, and post-injection recovery-are described. Methods are also presented for analyzing embryonic phenotypes, including viability, patterning defects in hatched larvae, and cuticle preparations for unhatched larvae. These assays, together with in situ hybridization and immunostaining for molecular markers, make D. maculatus an accessible model system for basic and applied research. They further provide useful information for establishing procedures in other emerging insect model systems.

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

Here, we present protocols for rearing an intermediate-germ beetle, Dermestes maculatus (D. maculatus) in the lab. We also share protocols for embryonic and parental RNAi and methods for analyzing embryonic phenotypes to study gene function in this species.

Yetiştirme ve Gizle böcek RNA aracılı gen demonte çift sarmallı,<em&gt; Dermestes maculatus</em

Advances in genomics have raised the possibility of probing biodiversity at an unprecedented scale. However, sequence alone will not be informative ...

Using a Fluorescent PCR-capillary Gel Electrophoresis Technique to Genotype CRISPR/Cas9-mediated Knockout Mutants in a High-throughput Format

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play in the functioning of cells and whole organisms. This cause has been tremendously aided by the recent introduction of the CRISPR/Cas9 system-a versatile tool that allows researchers to manipulate the genome and transcriptome in order to, among other things, knock out, knock down, or knock in genes in a targeted manner. For the purpose of knocking out a gene, CRISPR/Cas9-mediated double-strand breaks recruit the non-homologous end-joining DNA repair pathway to introduce the frameshift-causing insertion or deletion of nucleotides at the break site. However, an individual guide RNA may cause undesirable off-target effects, and to rule these out, the use of multiple guide RNAs is necessary. This multiplicity of targets also means that a high-volume screening of clones is required, which in turn begs the use of an efficient high-throughput technique to genotype the knockout clones. Current genotyping techniques either suffer from inherent limitations or incur high cost, hence rendering them unsuitable for high-throughput purposes. Here, we detail the protocol for using fluorescent PCR, which uses genomic DNA from crude cell lysate as a template, and then resolving the PCR fragments via capillary gel electrophoresis. This technique is accurate enough to differentiate one base-pair difference between fragments and hence is adequate in indicating the presence or absence of a frameshift in the coding sequence of the targeted gene. This precise knowledge effectively precludes the need for a confirmatory sequencing step and allows users to save time and cost in the process. Moreover, this technique has proven to be versatile in genotyping various mammalian cells of various tissue origins targeted by guide RNAs against numerous genes, as shown here and elsewhere.

The genotyping technique described here, which couples fluorescent polymerase chain reaction (PCR) to capillary gel electrophoresis, allows for high-throughput genotyping of nuclease-mediated knockout clones. It circumvents limitations faced by other genotyping techniques and is more cost effective than sequencing methods.

CRISPR genotipine bir Floresan PCR kılcal jel elektroforezi Tekniği / yüksek verimli bir Format Nakavt Mutants Cas9 aracılı

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point mutations, which often are responsible for a variety of human inherited disorders. Using a well-established cell-based model system, the point mutation of a single-copy mutant eGFP gene integrated into HCT116 cells has been repaired using this combinatorial approach. The analysis of corrected and uncorrected cells reveals both the precision of gene editing and the development of genetic lesions, when indels are created in uncorrected cells in the DNA sequence surrounding the target site. Here, the specific methodology used to analyze this combinatorial approach to the gene editing of a point mutation, coupled with a detailed experimental strategy to measuring indel formation at the target site, is outlined. This protocol outlines a foundational approach and workflow for investigations aimed at developing CRISPR/Cas9-based gene editing for human therapy. The conclusion of this work is that on-site mutagenesis takes place as a result of CRISPR/Cas9 activity during the process of point mutation repair. This work puts in place a standardized methodology to identify the degree of mutagenesis, which should be an important and critical aspect of any approach destined for clinical implementation.

This protocol outlines the workflow of a CRISPR/Cas9-based gene editing system for the repair of point mutations in mammalian cells. Here, we use a combinatorial approach to gene editing with a detailed follow-on experimental strategy for measuring indel formation at the target site&#8212;in essence, analyzing onsite mutagenesis.

Yerinde mutagenisitesinin CRISPR/Cas9 ve SsODN insan hücrelerinde tarafından katalize nokta mutasyon onarım bir fonksiyonu olarak incelemek için standart bir metodoloji

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in which the gene of interest has been disrupted. A gene-disruption DNA construct containing a suitable antibiotic resistance marker gene is useful for the generation of gene-disrupted strains in bacteria. However, conventional construction methods, which require gene cloning steps, involve complex and time-consuming protocols. Here, a relatively facile, rapid, and cost-effective method for targeted gene disruption in Streptococcus mutans is described. The method utilizes a 2-step fusion polymerase chain reaction (PCR) to generate the disruption construct and electroporation for genetic transformation. This method does not require an enzymatic reaction, other than PCR, and additionally offers greater flexibility in terms of the design of the disruption construct. Employment of electroporation facilitates the preparation of competent cells and improves the transformation efficiency. The present method may be adapted for the generation of gene-disrupted strains of various species.

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

We describe a facile, rapid, and relatively inexpensive method for the generation of gene-disrupted Streptococcus mutans strains; this technique may be adapted for the generation of gene-disrupted strains of various species.

Nesil bir gen kesintiye Streptococcus mutans çoğunlukla zorlanma olmadan Gen Klonlama

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in ...

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration of transgenes. However, due to the low efficiency of homologous recombination (HR) and various indel mutations of non-homologous end joining (NHEJ)-based strategies in non-dividing cells, in vivo genome editing remains a great challenge. Here, we describe a homology-mediated end joining (HMEJ)-based CRISPR/Cas9 system for efficient in vivo precise targeted integration. In this system, the targeted genome and the donor vector containing homology arms (~800 bp) flanked by single guide RNA (sgRNA) target sequences are cleaved by CRISPR/Cas9. This HMEJ-based strategy achieves efficient transgene integration in mouse zygotes, as well as in hepatocytes in vivo. Moreover, a HMEJ-based strategy offers an efficient approach for correction of fumarylacetoacetate hydrolase (Fah) mutation in the hepatocytes and rescues Fah-deficiency induced liver failure mice. Taken together, focusing on targeted integration, this HMEJ-based strategy provides a promising tool for a variety of applications, including generation of genetically modified animal models and targeted gene therapies.

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

The clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9 (CRISPR/Cas9) system provides a promising tool for genetic engineering, and opens up the possibility of targeted integration of transgenes. We describe a homology-mediated end joining (HMEJ)-based strategy for efficient DNA targeted integration in vivo and targeted gene therapies using CRISPR/Cas9.

Bir bitiş homoloji-aracılı katılmadan tabanlı strateji kullanarak hedeflenen Integration CRISPR/Cas9-aracılı Vivo içinde

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration ...

A Protocol for the Production of Integrase-deficient Lentiviral Vectors for CRISPR/Cas9-mediated Gene Knockout in Dividing Cells

Lentiviral vectors are an ideal choice for delivering gene-editing components to cells due to their capacity for stably transducing a broad range of cells and mediating high levels of gene expression. However, their ability to integrate into the host cell genome enhances the risk of insertional mutagenicity and thus raises safety concerns and limits their usage in clinical settings. Further, the persistent expression of gene-editing components delivered by these integration-competent lentiviral vectors (ICLVs) increases the probability of promiscuous gene targeting. As an alternative, a new generation of integrase-deficient lentiviral vectors (IDLVs) has been developed that addresses many of these concerns. Here the production protocol of a new and improved IDLV platform for CRISPR-mediated gene editing and list the steps involved in the purification and concentration of such vectors is described and their transduction and gene-editing efficiency using HEK-293T cells was demonstrated. This protocol is easily scalable and can be used to generate high titer IDLVs that are capable of transducing cells in vitro and in vivo. Moreover, this protocol can be easily adapted for the production of ICLVs.

We describe the production strategy of integrase-deficient lentiviral vectors (IDLVs) as vehicles for delivering CRISPR/Cas9 to cells. With an ability to mediate quick and robust gene editing in cells, IDLVs present a safer and equally effective vector platform for gene delivery compared to integrase-competent vectors.

Integrase-eksik Lentiviral vektörler üretimi için CRISPR/Cas9-aracılı Gene hücre bölünmesi içinde nakavt için bir iletişim kuralı

Lentiviral vectors are an ideal choice for delivering gene-editing components to cells due to their capacity for stably transducing a broad range of cells ...

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development of a customizable platform to rapidly generate gene modifications in a wide variety of organisms, including zebrafish. CRISPR-based genome editing uses a single guide RNA (sgRNA) to target a CRISPR-associated (Cas) endonuclease to a genomic DNA (gDNA) target of interest, where the Cas endonuclease generates a double-strand break (DSB). Repair of DSBs by error-prone mechanisms lead to insertions and/or deletions (indels). This can cause frameshift mutations that often introduce a premature stop codon within the coding sequence, thus creating a protein-null allele. CRISPR-based genome engineering requires only a few molecular components and is easily introduced into zebrafish embryos by microinjection. This protocol describes the methods used to generate CRISPR reagents for zebrafish microinjection and to identify fish exhibiting germline transmission of CRISPR-modified genes. These methods include in vitro transcription of sgRNAs, microinjection of CRISPR reagents, identification of indels induced at the target site using a PCR-based method called a heteroduplex mobility assay (HMA), and characterization of the indels using both a low throughput and a powerful next-generation sequencing (NGS)-based approach that can analyze multiple PCR products collected from heterozygous fish. This protocol is streamlined to minimize both the number of fish required and the types of equipment needed to perform the analyses. Furthermore, this protocol is designed to be amenable for use by laboratory personal of all levels of experience including undergraduates, enabling this powerful tool to be economically employed by any research group interested in performing CRISPR-based genomic modification in zebrafish.

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Targeted genome editing in the model system Danio rerio (zebrafish) has been greatly facilitated by the emergence of CRISPR-based approaches. Herein, we describe a streamlined, robust protocol for generation and identification of CRISPR-derived nonsense alleles that incorporates the heteroduplex mobility assay and identification of mutations using next-generation sequencing.

Verimli üretim ve Model sistem Danio rerio kimlik CRISPR/Cas9 tarafından oluşturulan Gene altını gizleme

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development ...

Formaldehyde-assisted Isolation of Regulatory Elements to Measure Chromatin Accessibility in Mammalian Cells

Appropriate gene expression in response to extracellular cues, that is, tissue- and lineage-specific gene transcription, critically depends on highly defined states of chromatin organization. The dynamic architecture of the nucleus is controlled by multiple mechanisms and shapes the transcriptional output programs. It is, therefore, important to determine locus-specific chromatin accessibility in a reliable fashion that is preferably independent from antibodies, which can be a potentially confounding source of experimental variability. Chromatin accessibility can be measured by various methods, including the Formaldehyde-Assisted Isolation of Regulatory Elements (FAIRE) assay, that allow the determination of general chromatin accessibility in a relatively low number of cells. Here we describe a FAIRE protocol that allows simple, reliable, and fast identification of genomic regions with a low protein occupancy. In this method, the DNA is covalently bound to the chromatin proteins using formaldehyde as a crosslinking agent and sheared to small pieces. The free DNA is afterwards enriched using phenol:chloroform extraction. The ratio of free DNA is determined by quantitative polymerase chain reaction (qPCR) or DNA sequencing (DNA-seq) compared to a control sample representing total DNA. The regions with a looser chromatin structure are enriched in the free DNA sample, thus allowing the identification of genomic regions with lower chromatin compaction.

The plasticity of nuclear architecture is controlled by dynamic epigenetic mechanisms including non-coding RNAs, DNA methylation, nucleosome repositioning as well as histone composition and modification. Here we describe a Formaldehyde-Assisted Isolation of Regulatory Elements (FAIRE) protocol which allows the determination of chromatin accessibility in a reproducible, inexpensive, and straightforward manner.

Düzenleyici elemanlarının ölçü Kromatin erişilebilirlik memeli hücrelerinde formaldehit destekli izolasyon

Appropriate gene expression in response to extracellular cues, that is, tissue- and lineage-specific gene transcription, critically depends on highly ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. Complete gene ablation in HSCs required the generation of knockout mice from which HSCs could be isolated, and gene ablation in primary human HSCs was not possible. Viral transduction could be used for knock-down approaches, but these suffered from variable efficacy. In general, genetic manipulation of human and mouse hematopoietic cells was hampered by low efficiencies and extensive time and cost commitments. Recently, CRISPR/Cas9 has dramatically expanded the ability to engineer the DNA of mammalian cells. However, the application of CRISPR/Cas9 to hematopoietic cells has been challenging, mainly due to their low transfection efficiencies, the toxicity of plasmid-based approaches and the slow turnaround time of virus-based protocols.
A rapid method to perform CRISPR/Cas9-mediated gene editing in murine and human hematopoietic stem and progenitor cells with knockout efficiencies of up to 90% is provided in this article. This approach utilizes a ribonucleoprotein (RNP) delivery strategy with a streamlined three-day workflow. The use of Cas9-sgRNA RNP allows for a hit-and-run approach, introducing no exogenous DNA sequences in the genome of edited cells and reducing off-target effects. The RNP-based method is fast and straightforward: it does not require cloning of sgRNAs, virus preparation or specific sgRNA chemical modification. With this protocol, scientists should be able to successfully generate knockouts of a gene of interest in primary hematopoietic cells within a week, including downtimes for oligonucleotide synthesis. This approach will allow a much broader group of users to adapt this protocol for their needs.

A protocol for fast CRISPR/Cas9-mediated gene disruption in mouse and human primary hematopoietic cells is described in this article. Cas9-sgRNA ribonucleoproteins are introduced via electroporation with sgRNAs generated through in vitro transcription and commercial Cas9. High editing efficiencies are achieved with limited time and financial cost.

Fare ve insan hematopoetik progenitör hücre tarafından CRISPR/Cas9 yüksek verimli Gene bozulma

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Memeli Hücrelerinde CRISPR / Cas9 aracılı Gen Knockout'larının Seçime Bağlı ve Bağımsız Üretimi

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler