Name: mapping genome-wide accessible chromatin in primary human t lymphocytes by atac-seq
Uploaded: 2017-11-13T13:00:00.000+00:00
Duration: 9 min 8 s
Description: Watch this Scientific Journal Video about Mapping Genome-wide Accessible Chromatin in Primary Human T Lymphocytes by ATAC-Seq at JoVE.com

Bu eser İsrail Bilim Vakfı (grant 748/14) tarafından desteklenmektedir, Marie Curie Tümleştirme vermek (çiğ) - FP7-insanlar-20013-çiğ-618763 ve ben-çekirdek Program planlama ve bütçeleme Komitesi ve İsrail Bilim Vakfı No 41/11 verin.

tüm yordamları Bar Ilan Üniversitesi Kurumsal inceleme Kurulu tarafından kabul edildi ve protokol deneyler onaylama Komitesi tarafından sağlanan kuralları izler.
 1. arıtma saf insan CD4 + hücre ve polarizasyon T yardımcı 1 (Th1) ve Th2 hücrelerinin Not: burada biz donmuş insan periferik kan mononükleer hücreler (PBMCs) başlayan açıklayınız. İlk adım lastikteki kullanarak CD4 + hücreleri izole oluşur ve sütunları genellikle bize hücreleri CD4 + % 95'i daha fazla verin. Ancak, bu adımı her laboratuarında tercih edilen protokolüne göre değişebilir. T hücre aktivasyonu ve polarizasyon için protokolü Jenner ve ark. güncellenmiştir (2009) 18. yalıtım in CD4 + 10 milyon PBMCs verir hücrelerden artış 4-6 milyon için CD4 + hücre. Bölünmüş iki şişe ve Th1 altında yetiştirilen ve sadece bir hafta içinde koşullar verimli 3-5 milyon Th1 ve Th2 hücreleri Th2 polarize.
 Not: santrifüj ile 4 ° C arasında başlamadan önce soğumasını.
<ol><li>İnsan PBMCs çözülme 1 mL (10 7 hücreleri) %1 penisilin-streptomisin, 2 mM L-glutamin ve % 10 ısı inaktive fetal sığır serum RPMI orta 10 mL içeren bir 50 mL tüp. 500 x g 5 dk. Kaldır süpernatant de santrifüj kapasitesi ve ilave RPMI orta 15 ml steril 25 mL pipet içeren hücreleri resuspend. Hücreleri (ile steril 25 mL pipet) bir T75 kültür şişesi transfer.</li>
	<li>Hücreleri oksijen İnkübatör (37 ° C, % 5 CO 2) geceleme bırakın.</li>
	<li>Steril 25 mL pipet ile yüzen hücreleri 50 mL tüp için transfer. Cep telefonu numarasını ve canlılığı trypan mavi dışlama tarafından belirlemek.</li>
	<li>İzole CD4 + 10 milyon hücrelerden canlı olmayan-yapışık PBMCs lastikteki CD4 + ve üreticiye göre sütunları kullanarak pozitif seçime göre &#39; s öneriler (bkz. Tablo malzemeleri/ekipman) aşağıdaki değişiklik: 10 7 PBMCs % 0.5 BSA PBS içinde 120 µL CD4 lastikteki 30 µL ile etiketlenir.</li>
	<li>RhIL-2 (10 ng/mL), plaka bağlı anti-CD3 (5 µg/mL) ve çözünebilir anti-CD28 (2 µg/mL) tarafından CD4 + T hücreleri 72 h için etkinleştirin. Th1 polarizasyon için rhIL-12 (20 ng/mL) ve anti-Il-4 (10 µg/mL) ekleyin. RhIL-4 (40 ng/mL) ve anti-IFN-γ (10 µg/mL) Th2 polarizasyon için eklemek.</li>
	<li>RhIL-2 (10 ng/mL) huzurunda ek 7 gün ve aynı polarize sitokinler (rhIL-12 için Th1 ve Th2 için rhIL-4) hücreleri kültür.</li>
</ol> 2. Çekirdeklerin yalıtım Not: ataç-seq sağlam çekirdeği ile gerçekleştirilir. Lizis arabellek içeren % 0.05 nonylphenyl polietilen glikol (bkz. Tablo malzemeleri/ekipman), çekirdek birincil insan Th1 ve Th2 hücrelerden yalıtmak için kalibre. Bu adım laboratuvar Kimyasalları ve hücreleri ile ayarlama tavsiye ediyoruz. Aşırı yetersiz deterjan sağlam hücre transpozisyonu tepki verimliliğini düşürür. Hücre lizis verimliliği göre hücrelerin sayısı toplam çekirdek (trypan mavi pozitif hücrelerinin) sayısına göre belirlenir. 
Not: lizis arabellek (10 mM Tris-HCl, pH 7.5, 10 mM NaCl, 3 mM MgCl 2) hazırlayın. Bir salıncak-kova rotor 4 ile bir santrifüj soğumasını ° C. sabit açılı santrifüj yerine bir salıncak-kova santrifüj hücrelerde peletleme hücre/çekirdek kaybı azaltır. Çekirdeği veya hücre kaybı, dikkatle süpernatant atarak zaman damlalıklı önlemek için.
<ol><li>Ekle taze nonylphenyl polietilen glikol (için son bir konsantrasyon % 0.05) ve soğuk lizis arabelleğine kullanımdan hemen önce proteaz inhibitörleri (için 1 x son bir konsantrasyon) x 100. Arabellek buz üzerinde tutmak</li>
	<li>Kendi tutar ve canlılığı trypan mavi yöntemini kullanarak belirlemek için sayısı T hücreleri. Daha yüksek non-spesifik sindirim sonuçlarında % 90 daha düşüktür canlılığı.</li>
	<li>Transfer 0.5 x 10 6 T hücreleri (Th1 veya Th2) 1.5 mL mikrotüpler için. Spin aşağı vasıl 500 x g 5 min için saat 4'te ° C.</li>
	<li>Hücre Pelet 1 mL soğuk fosfat tamponlu tuz (PBS) çözüm resuspend. Spin aşağı vasıl 500 x g 5 min için saat 4'te ° C.</li>
	<li>Hücre Pelet 1 mL soğuk lizis arabellek (nonylphenyl polietilen glikol ve proteaz inhibitörleri içeren) resuspend. Tüp buz üzerinde tutun. Yavaşça çekirdeklerin etkilemesini önlemek için pipet.</li>
	<li>Hızlı bir şekilde 10 µL al ve lysed hücreleri ile microtube buz üstünde ise bir otomatik hücre sayacı ile hücreleri saymak. Bu adımı çekirdeklerin zarar görmesini önlemek için beş dakika aşmaması gerekir. Hücreleri en az % 80'i lysed.</li>
	Hemen yanaşma tepki ile <li>devam et. Hazırlanan çekirdeği üzerinde buz tutmak</li>
</ol> 3. Transpozisyon reaksiyon Not: Bu adımda, izole çekirdeği NGS sıralaması bağdaştırıcısı yüklü prokaryotik Tn5 transposase (TDE1) ile inkübe. Hiperaktif Tn5 aynı anda DNA parçaları ve bağdaştırıcıları (tagmentation süreci) genom erişilebilir bölgelere ligates. Çekirdek ve Tn5 transposase arasındaki oran erişilebilir Kromatin adlı tercihli bölünme için önemlidir. Bu iletişim kuralı için 100.000 çekirdeği 100 μL tepki birimindeki kalibre edilmiş. Ancak, reaksiyon küçültülmüş.
<ol><li>Ayarla sıcaklık termal bir shaker 37 ° c</li>
	<li>Transfer 100.000 çekirdekler için 1.5 mL microtube.</li>
	<li>10 dk 4 ° C'de ve yavaşça için 500 x g, santrifüj süpernatant kaldırmak.</li>
	<li>Transpozisyonu reaksiyon bileşenleri çekirdek için belirtilen Tablo 1 ekleyin.</li>
	<li>Nazik pipetting tarafından resuspend.</li>
	<li>(500 rpm) sallayarak nazik ile yanaşma tepki bir termal shaker-37 ° C'de 30 dk için kuluçkaya. 
	Not: DNA Temizleme katı faz ters çevrilebilir immobilizasyon boncuk 19 tarafından gerçekleştirilir (bkz. Tablo malzemeleri/ekipman) veya PCR arıtma sütunlar. Temizlik sonunda, 10 mm Tris-HCl, pH 8 20 µL içinde DNA parçaları elute. EDTA elüsyon arabellekte kaçının.</li>
</ol> 4. PCR zenginleştirme ataç-seq kütüphanelerin Not: ataç-seq Kütüphane Yani, DNA parçalarının takılı bağdaştırıcılar ile yükseltmek için bu adım hedefleniyor. Aynı yeni nesil sıralama şeritte birkaç ataç-seq kütüphanelerin karıştırma sağlamak için (&#34; çoğullama &#34;) kullanım Sıralanmayan astar 1 (Ad1_noMx) 1 tüm örnekleri için ve farklı bir dizine (barkodlu) astar 2 (reklam 2.1-2.24) Her örnek için 1. Astar dizileri desteklenmiştir Tablo malzemeleri/ekipman sağlanmaktadır.
<ol><li>İlk PCR güçlendirme Not: astar 1 (Ad1_noMx) ve astar 2 çalışma konsantrasyonu 25 µM olduğunu. Tüm astar için 25 µM 100 µM özgün stoktan seyreltilmiş. Tüm PCR reaksiyonları, astar 1 (Ad1_noMx) ve dizin oluşturulmuş astar 2 yalnızca birini kullanın.
	<ol><li>PCR reaksiyon bileşenleri belirtilen Tablo 2 steril bir PCR tüp ekleyin.</li>
		<li>Yer PCR tüp bir termal cycler ve PCR güçlendirme Tablo 3 ' te ayrıntılı bisiklet koşullarını kullanarak gerçekleştirmek.</li>
	</ol></li> <li>Ek amplifikasyon döngü sayısı değerlendirilmesi Not: ek PCR döngü sayısı Kütüphane parçaları f yeterli miktarda verimya da başarılı bir gelecek nesil sıralama çalışmasını, GC önlemek ve önyargı 20 boyutlandırmak için simge durumuna küçültülmüş. En iyi kütüphane parçası amplifikasyon için gerekli PCR döngü (N) sayısı tayini kantitatif PCR (qPCR) tarafından yapılır.
	<ol><li>Seyreltik astar 1 (Ad1_noMx) ve 2 25 µM den 6.25 µM (ilk kütüphane amplifikasyon için kullanılır).</li>
		<li>Optik PCR tüpleri veya bir tabak Tablo 4 ' te belirtildiği gibi bileşenleri ekleme.</li>
		<li>Bir qPCR alet ve döngüsü olarak belirtilen Tablo 5.</li>
		<li>Ek amplifikasyon döngüsü (N) süreyi tahmin etmek için arsa devir sayısı x ekseni ve y ekseni üzerinde göreli floresan (RFU).</li>
		<li>Ek amplifikasyon sayısını döngüleri (N) 1/3, plato qPCR tepki ulaştı döngü sayısı var. Şekil 2 ~ 2,350 göreli Floresans birimler, RFU (kalın yeşil çizgi) plato ulaştı üç ataç-seq kitaplıkları için örnekler sağlar. (Kırmızı ve mavi amplifikasyon eğrileri) kütüphanelerin iki kişilik 8 döngüleri ve üçüncü kütüphane (pembe) 9 ÇSYİ devredir içinde maksimal miktarı (783 RFU, y ekseni üzerinde işaretlenmiş) üçte biri güçlendirilmiş PCR devir sayısına karşılık gelir.</li>
	</ol></li> <li>Son PCR güçlendirme <ol><li>kalan 45 µL PCR reaksiyon yükseltmek. Termal cycler 4.1.2 adımda amplifikasyon tepki içeren bir PCR tüpü yerleştirin. Tablo 6 ' da açıklanan PCR programını çalıştırın. Amplifikasyon döngü (N) önceden belirlenmiş (Adım 4.2.5) sayısı kullanın.</li>
	</ol></li></ol> 5. Boyut seçimi ataç-Seq kütüphaneler Not: yüksek molekül ağırlıklı Kütüphane parçaları ortadan kaldırdığından deneyim, boyutu seçimi güçlendirilmiş ataç-seq kütüphanelerin yeni nesil sıralama sonuçları geliştirir. son ataç-seq kitaplık. 
Not: oda sıcaklığında 30 dk kullanmadan önce ısıtmak manyetik boncuklar izin. 
Taze % 70 etanol suda nükleaz ücretsiz hazırlayın.
<ol><li>Karıştırarak mıknatıslı boncuk resuspend.</li>
	<li>(4.3.1. adımda elde.) ataç-seq kitaplıklarına nükleaz ücretsiz su ekleyin ve en çok 100 µL getirmek.</li>
	<li>Ekle 50 µL (0.5 x) resuspended DNA'ya bağlanıcı manyetik boncuklar için güçlendirilmiş kütüphanelerin 100 µL. Yukarı ve aşağı en az 10 kez pipetting tarafından karıştırın. Örnekleri, oda sıcaklığında 5 min için kuluçkaya. Gerekirse, hızlı bir şekilde mikrotüpler spin.</li>
	<li>Tüp manyetik boncuklar süpernatant ayırmak 2 dk için uygun bir manyetik stand üzerine yerleştirin. 2 dakika sonra yeni bir microtube süpernatant transfer.</li>
	<li>Pipetting tarafından süpernatant hacmi ölçmek ve manyetik boncuklar 0.7 x ekleyin. Yukarı ve aşağı en az 10 kez pipetting tarafından Mix.</li>
	<li>Oda sıcaklığında 5 dk kuluçkaya. 2 dakika süreyle manyetik bir stand üzerinde yer</li>
	<li>Sonra 2 dk kuluçka, süpernatant atmak. Tüpler manyetik kürsüye iken boncuk yıkamak için 200 taze yapılmış µL % 70 etanol ekleyin.</li>
	<li>Devam microtube mıknatıs için 30 üzerinde s ve sonra atma etanol. Adım 5.7.for iki son etanol yıkar yineleyin.</li>
	<li>Tamamen kalan etanol ve tüp mıknatıs üzerinde ise Boncuk 5 min için kurumasına izin kaldırın. Gerekirse, kısaca microtube spin. P10 pipet ucu ile etanol izlerinin giderilmesi.</li>
	<li>Microtube mıknatıs kaldırın ve 10 mm Tris-HCl, pH 8 22 µL ekleyin. EDTA içeren arabellek ataç-seq kitaplıklarında elute değil.</li>
	<li>Oda sıcaklığında 2 min için tüp kuluçkaya ve manyetik kürsüye getirin.</li>
	<li>Çözüm açık olduğunda, yeni bir steril microtube eluted kütüphanelerin 20 µL transfer.</li>
	<li>Deposu boyutu seçili ataç-seq kitaplıkları, -20 ° c</li>
</ol> 6. ATAÇ-Seq kütüphanelerin kalitesi analizi <ol><li>ataç-seq kitaplıkları tarafından gerçek zamanlı PCR kalitesini doğrulanmasını Not: yeni nesil önce ataç-seq kütüphanelerin gürültü oranı sinyal değerlendirmek önemlidir sıralama. Bu DNA parçalarının üzerinden erişilebilir ve ulaşılmaz loci kantitatif PCR (qPCR) kullanarak göreli miktarı belirlenerek yapılır. Ulaşılmaz loci (negatif kontrol, chr1:48, 137, 860-48,137,934 ve chr1:193, 093, 748-193,093,827) 1 ve 2 astar çiftleri tarafından güçlendirilmiş. Erişilebilir loci (pozitif kontrolü, chr19:30, 336, 166-30,336,253 ve chr19:11546154-11546237) 3 ve 4 astar çiftleri tarafından güçlendirilmiş. Pozitif ve negatif loci insan CD4 + hücreleri (KODLA katılımların ENCSR000EQE ve ENCSR000EQG) Kromatin erişilebilirlik (DHS-seq) profillerden tanımlı değil. Negatif astar 1 büyük bir heterochromatic intergenic bölgeye (230 kb TRADB2 ve FOXD2 dan 88 kb) yer alır. Negatif kontrol bölgesi 2 CDC73 gene ilk intron içinde mevcuttur. Astar çifti 3 pozitif bir açık Kromatin bölge içinde olumlu astar çifti 4 süre siklin E (CCNE1) gen aşağı protein kinaz C substrat 80 K-H (PRKCSH) düzenleyici içinde ortalanır. Önemlisi, bu denetim loci onlar insan hücre türleri geniş bir yelpazede kitaplıklardan ataç-seq izlemek için uygulanabilir düşündüren başka insan hücre tipleri KODLA proje 3, erişilebilirlik benzer bir yol gösterir. Astar verimliliği ve tüm astar çiftleri özgüllüğü qPCR (hücrelerden insan Th) genomik DNA'ın seri bir seyreltme ve elde edilen güçlendirilmiş ürünler bir erime eğrisi analizi tarafından doğrulanmış.
	<ol><li>İzole genomik DNA ticari olarak kullanılabilir kullanarak (bkz. Tablo malzemeleri/ekipman) kit.</li>
		<li>Güçlendirilmiş ataç seq seyreltik Kütüphane 1:10 (1 µL Kütüphane + 9 nükleaz ücretsiz su µL) ve genomik DNA ~ 5 ng/µL '.</li>
		<li>Reaksiyon karışımı (Tablo 7) tepkiler nüsha gerçekleştirilen dikkate alarak her pozitif ve negatif kontrol astar çifti için hazır olun.</li>
		<li>QPCR ana mix tedarikçi tarafından önerilen protokolüne göre qPCR termal cycler Incubate.</li>
		<li>Analiz sonuçları qPCR alet &#39; s yazılım (bkz. Tablo malzemeleri/ekipman). Genomik DNA kontrolü örnek olarak seçin. Elde edilen değerler bir zenginleştirme erişilebilir bölgeler (pozitif kontrol astar tarafından güçlendirilmiş) temsil eder. Bir örnek Tablo 8 ' de gösterilen. 
		Not: Tahmini ortalama Kütüphane boyutu ve konsantrasyon: ataç-seq kitaplıklarından DNA parçalarının boyutu dağılımı yüksek-duyarlı otomatik Elektroforez Sistemleri üretici göre belirlenir &#39; s yönergeleri. Bu örnek toplama dsDNA yüksek-duyarlı kit ve en az 2 µL her DNA örneği kullanarak bir yer olarak ölçmek için tavsiye edilir. 
		Not: Yeni nesil sıralama - kütüphaneler çoğullama önce her ataç-seq Kütüphane molarite formülü kullanarak hesaplama: (ng/µL x 10 6) / (660 x ortalama kitaplığı parçası uzunluğu). İçin amaç &#62; açık Kromatin değerlendirmek için her ataç-seq kitaplık 30 milyon defa okundu insan örnekleri bölgelerinde. Kütüphanede NGS sıralama için yeterli olup olmadığını belirlemek istiyorsanız, başlangıçta ~ 10 milyon okur (sıralama Lane DNA sıralama cihazda hızlı çalıştırma modunda % 5) nişan al. Nucleosome konumlandırma anlaması için eşleştirilmiş uç sıralama gerekli 1 olduğunu göz önünde bulundurun.</li>
	</ol></li></ol> 7. Yeni nesil sıralama elde edilen sonuçların analiz <ol><li>FastQC resimler, her kitaplık için ayrı ayrı inceleyerek sıralama okuma kalitesini sonucuna.</li>
	<li>Papyon 21 yazılım Unix/Linux ortamında kullanarak okuma insan başvuru genom (hg19 birleştirme) için hizalayın. Komut &#39; papyon -m 1 - q -S Genom dizini reads.fastq output_aligned.sam &#39;. Genom dizini papyon genom dizinleri depolandığı klasörün için duruyor. Parametre -m 1 genomu içinde birden fazla locus okuyan hizalamasını izin vermiyor - q fastq biçiminde olması gerektiğini giriş dosyası için -S mı SAM biçiminde çıktı için.</li>
	<li>Yinelenen okuma UNIX/Linux ortamında SAMtools 22 rmdup seçeneğini kullanarak kaldırın. Komutları &#39; samtools göster -S output_aligned.sam -b | samtools sıralama -o-output_aligned &#62; output_aligned.bam &#39;, samtools rmdup -s output_aligned.bam output_aligned _rmdup.bam &#39;. İlk komut, görünüm, hangi sonra sıralanır BAM biçime SAM biçimini değiştirir. Rmdup seçeneği daha sonra sıralanmış BAM dosyada uygulanır. İsteğe bağlı olarak bir özgün ataç-seq kağıt 1 ' de açıklandığı gibi okuma transposon ekleme sitesi için ayarlayabilirsiniz. Bu yapılır 23 UNIX/Linux ortamında komutları kullanarak BEDtools. Komutları &#39; bamToBed -i output_aligned _rmdup.bam &#62; output_aligned _rmdup.bed &#39;, &#39; shiftBed -i output_aligned _rmdup.bed -p 4 - m-5 - g genom &#62; output_aligned _rmdup_adjusted.bed &#39;. İlk komut, bamTobed, sonra shiftBed komut için kullanılabilecek yatak biçime BAM biçimini değiştirir. Genom genom her kromozom uzunluğunu içeren bir sekme sınırlandırılmış dosya dosyadır. Dosya genellikle BEDtools dizinine eklenir.</li>
	Aşağıdaki parametrelerle kayar yatak dosyada UNIX/Linux ortamında modeli tabanlı analiz ChIP-seq (MACS2) 24 yazılım kullanarak <li>gerçekleştir tepe arama:--nomodel--extsize 75 - shift -30. Bu parametreler her sıralama okuma ortasında transposon ekleme sitedir okuma ayarlamak için kullanılır.</li>
</ol>

<ol>
	<li>Buenrostro, J. D., Giresi, P. G., Zaba, L. C., Chang, H. Y., Greenleaf, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposition+of+native+chromatin+for+fast+and+sensitive+epigenomic+profiling+of+open+chromatin,+DNA-binding+proteins+and+nucleosome+position.">Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position.</a> Nat Methods. 10 (12), 1213-1218 (2013).</li><li>Buenrostro, J. D., Wu, B., Chang, H. Y., Greenleaf, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATAC-seq:+A+method+for+assaying+chromatin+accessibility+genome-wide.">ATAC-seq: A method for assaying chromatin accessibility genome-wide.</a> Curr Protoc Mol Biol. , 21.29.1-21.29.9 (2015).</li><li>Thurman, R. E., Rynes, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+accessible+chromatin+landscape+of+the+human+genome.">The accessible chromatin landscape of the human genome.</a> Nature. 489 (7414), 75-82 (2012).</li><li>Song, L., Crawford, G. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNase-seq:+a+high-resolution+technique+for+mapping+active+gene+regulatory+elements+across+the+genome+from+mammalian+cells.">DNase-seq: a high-resolution technique for mapping active gene regulatory elements across the genome from mammalian cells.</a> Cold Spring Harb Protoc. (2), (2010).</li><li>Simon, J. M., Giresi, P. G., Davis, I. J., Lieb, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+formaldehyde-assisted+isolation+of+regulatory+elements+(FAIRE)+to+isolate+active+regulatory+DNA.">Using formaldehyde-assisted isolation of regulatory elements (FAIRE) to isolate active regulatory DNA.</a> Nat Protoc. 7 (2), 256-267 (2012).</li><li>Cui, K., Zhao, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-Wide+Approaches+to+Determining+Nucleosome+Occupancy+in+Metazoans+Using+MNase-Seq.">Genome-Wide Approaches to Determining Nucleosome Occupancy in Metazoans Using MNase-Seq.</a> Methods Mol Biol. 833, 413-419 (2012).</li><li>Qu, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Individuality+and+Variation+of+Personal+Regulomes+in+Primary+Human+T+Cells.">Individuality and Variation of Personal Regulomes in Primary Human T Cells.</a> Cell Syst. 1 (1), 51-61 (2015).</li><li>Scharer, C. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATAC-seq+on+biobanked+specimens+defines+a+unique+chromatin+accessibility+structure+in+na&#239;ve+SLE+B+cells.">ATAC-seq on biobanked specimens defines a unique chromatin accessibility structure in na&#239;ve SLE B cells.</a> Sci Rep. 6, 27030 (2016).</li><li>Seb&#233;-Pedr&#243;s, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Dynamic+Regulatory+Genome+of+Capsaspora+and+the+Origin+of+Animal+Multicellularity.">The Dynamic Regulatory Genome of Capsaspora and the Origin of Animal Multicellularity.</a> Cell. 165 (5), 1224-1237 (2016).</li><li>Lu, Z., Hofmeister, B. T., Vollmers, C., DuBois, R. M., Schmitz, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combining+ATAC-seq+with+nuclei+sorting+for+discovery+of+cis-regulatory+regions+in+plant+genomes.">Combining ATAC-seq with nuclei sorting for discovery of cis-regulatory regions in plant genomes.</a> Nucleic Acids Res. 45 (6), e41 (2016).</li><li>Davie, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+Transcription+Factors+and+Regulatory+Regions+Driving+In+Vivo+Tumor+Development+by+ATAC-seq+and+FAIRE-seq+Open+Chromatin+Profiling.">Discovery of Transcription Factors and Regulatory Regions Driving In Vivo Tumor Development by ATAC-seq and FAIRE-seq Open Chromatin Profiling.</a> PLOS Genet. 11 (2), (2015).</li><li>Villar, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancer+Evolution+across+20+Mammalian+Species.">Enhancer Evolution across 20 Mammalian Species.</a> Cell. 160 (3), 554-566 (2015).</li><li>Lara-Astiaso, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+state+dynamics+during+blood+formation.">Chromatin state dynamics during blood formation.</a> Science. 345 (6199), 943-949 (2014).</li><li>Prescott, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancer+Divergence+and+cis-Regulatory+Evolution+in+the+Human+and+Chimp+Neural+Crest.">Enhancer Divergence and cis-Regulatory Evolution in the Human and Chimp Neural Crest.</a> Cell. 163 (1), 68-83 (2015).</li><li>Wu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+landscape+of+accessible+chromatin+in+mammalian+preimplantation+embryos.">The landscape of accessible chromatin in mammalian preimplantation embryos.</a> Nature. 534 (7609), 652-657 (2016).</li><li>Buenrostro, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+chromatin+accessibility+reveals+principles+of+regulatory+variation.">Single-cell chromatin accessibility reveals principles of regulatory variation.</a> Nature. 523 (7561), 486-490 (2015).</li><li>Corces, M. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lineage-specific+and+single-cell+chromatin+accessibility+charts+human+hematopoiesis+and+leukemia+evolution.">Lineage-specific and single-cell chromatin accessibility charts human hematopoiesis and leukemia evolution.</a> Nat Genet. 48 (10), 1193-1203 (2016).</li><li>Jenner, R. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcription+factors+T-bet+and+GATA-3+control+alternative+pathways+of+T-cell+differentiation+through+a+shared+set+of+target+genes.">The transcription factors T-bet and GATA-3 control alternative pathways of T-cell differentiation through a shared set of target genes.</a> Proc Natl Acad Sci USA. 106 (42), 17876-17881 (2009).</li><li>DeAngelis, M. M., Wang, D. G., Hawkins, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solid-phase+reversible+immobilization+for+the+isolation+of+PCR+products.">Solid-phase reversible immobilization for the isolation of PCR products.</a> Nucleic Acids Res. 23 (22), 4742-4743 (1995).</li><li>Aird, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analyzing+and+minimizing+PCR+amplification+bias+in+Illumina+sequencing+libraries.">Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries.</a> Genome Biol. 12 (2), R18 (2011).</li><li>Langmead, B., Trapnell, C., Pop, M., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrafast+and+memory-efficient+alignment+of+short+DNA+sequences+to+the+human+genome.">Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.</a> Genome Biol. 10 (3), R25 (2009).</li><li>Li, H., Handsaker, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Quinlan, A. R., Hall, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BEDTools:+a+flexible+suite+of+utilities+for+comparing+genomic+features.">BEDTools: a flexible suite of utilities for comparing genomic features.</a> Bioinformatics. 26 (6), 841-842 (2010).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+Analysis+of+ChIP-Seq+(MACS).">Model-based Analysis of ChIP-Seq (MACS).</a> Genome Biol. 9 (9), R137 (2008).</li><li>Meyer, C. A., Shirley Liu, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identifying+and+mitigating+bias+in+next-generation+sequencing+methods+for+chromatin+biology.">Identifying and mitigating bias in next-generation sequencing methods for chromatin biology.</a> Nat Rev Genet. 15 (11), 709-721 (2014).</li><li>He, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Refined+DNase-seq+protocol+and+data+analysis+reveals+intrinsic+bias+in+transcription+factor+footprint+identification.">Refined DNase-seq protocol and data analysis reveals intrinsic bias in transcription factor footprint identification.</a> Nat Methods. 11 (1), 73-78 (2013).</li><li>Madrigal, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+Accounting+for+Sequence-Specific+Bias+in+Genome-Wide+Chromatin+Accessibility+Experiments:+Recent+Advances+and+Contradictions.">On Accounting for Sequence-Specific Bias in Genome-Wide Chromatin Accessibility Experiments: Recent Advances and Contradictions.</a> Front Bioeng Biotechnol. 3, 1-4 (2015).</li><li>Qin, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChiLin:+a+comprehensive+ChIP-seq+and+DNase-seq+quality+control+and+analysis+pipeline.">ChiLin: a comprehensive ChIP-seq and DNase-seq quality control and analysis pipeline.</a> BMC Bioinformatics. 17 (1), (2016).</li><li>Bao, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+ATAC-seq+approach+reveals+lineage-specific+reinforcement+of+the+open+chromatin+landscape+via+cooperation+between+BAF+and+p63.">A novel ATAC-seq approach reveals lineage-specific reinforcement of the open chromatin landscape via cooperation between BAF and p63.</a> Genome Biol. 16 (1), 284 (2015).</li><li>Maurano, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+localization+of+common+disease-associated+variation+in+regulatory+DNA.">Systematic localization of common disease-associated variation in regulatory DNA.</a> Science. 337 (6099), 1190-1195 (2012).</li></ol>

Yazarlar ifşa gerek yok.

Burada açıklanan ataç-seq Protokolü başarılı bir şekilde erişilebilir Kromatin analiz için Primer hücre içinde istihdam edilmiştir (insan Th1, Th2 hücrelerinin ve B hücreleri) yanı sıra kültürlü hücre hatları (MCF10A insan meme kanseri hücreleri ve U261 glioblastoma hücreleri). Diğer hücre tipleri için ataç-seq yüklemeden lizis adımda özellikle bazı protokol optimizasyon gerektirebilir. Non-iyonik deterjan konsantrasyonu çok yüksek ise, mitokondriyal DNA kirlenme daha yüksek bir yüzdes...

ATAÇ-seq1,2 düzenleyici3 açık Kromatin bölgeleri ve nucleosome konumlandırma sağlar güçlü bir yöntemdir. Bu bilgileri konumu, kimlik ve transkripsiyon faktörleri Faaliyet çıkarım için uygulanır. Kromatin yapısı nicel değişimler ölçmek için yöntemin duyarlılığı Kromatin remodelers ve değiştiriciler, RNA polimeraz II1transkripsiyon aktivite gibi Kromatin faktörlerin aktivitesinin çalışma sağlar. Böylece ataç-seq ilgi herhangi bir hücre tipi transkripsiyon yönetmelikte yöneten mekanizmaları deşifre için güçlü ve tarafsız bir yaklaşım sağlar. Biz ataç-seq adaptasyon için birincil insan Th1 ve Th2 hücreleri tanımlamak.
ATAÇ-seq adaptörler için yeni nesil sıralama (NGS) çiftler DNA fragmantasyonu DNA'sı adaptörler (örneğin, "tagmentation" süreci)1ile etiketleme ile olan hiperaktif Tn5 transposase dolu. PCR güçlendirme elde edilen DNA kütüphaneler yeni nesil sıralama (şekil 1) için hazırsınız demektir. Erişilebilir Kromatin tercihli tagmentation ataç-seq sıralama okur yerel zenginleştirme analiz tarafından algılanır.
Kısa deneysel işlemin ve Kromatin erişilebilirlik ve nucleosomal Dnaz seq4, dürüst-seq5ve MNase-seq6, gibi konumlandırma ölçmek için diğer yöntemleri göre daha az başlangıç materyali için gereksinim vardır ATAÇ-seq kullanımı insan Primer hücre1,7 ve klinik örnekleri8yanı sıra tek hücreli organizmalar9, bitkiler10, meyve sinekleri11 de dahil olmak üzere birden çok biyolojik sistemlerde terfi ve çeşitli memeliler12.
Kimlik için erişilebilir loci bağlı faktörler zenginleştirme onların bağlama sırası motifleri analiz veya ataç-seq takip yüksek üretilen iş DNA sıralama () tarafından Kromatin immunoprecipitation (ChIP) ile birleştirerek ortaya transkripsiyon ChIP-seq). Bu yaklaşım lineage özgü transkripsiyon faktörleri fare13' te hematopoiesis için önemli tanımlaması etkin. ATAÇ-seq tarafsız ve küresel doğası gen düzenlemesi reaktifler çipi analiz için antikorlar gibi mevcut değildir organizmalarda eğitim sağlar. Örneğin, evrimsel değişimler CIS-düzenleyici bölgeleri tespit edilmiştir kafatası nöral crest hücrelerden insan ve şempanzenin14, düzenleyici elemanlarının gelişimsel değişimler sırasında erken fare inceleyerek embriyogenez15, tek hücreli C. owzarzakibir yaşam döngüsü boyunca yasal manzara modunda değiştirir9ve Organizatör ve arttırıcılar 20 memeli türü12arasında evrimi.
ATAÇ-seq Ayrıca Kromatin erişilebilirlik hangi genellikle genom genelinde Çalışmalar7,16evades böylece ifşa değişkenlik hücre popülasyonlarının içinde tek kişilik hücrelerde ölçmek için vesile olmuştur. Buna ek olarak, ATAÇ-seq örnekleri nadir hastalık koşullarında DNA yasal bölgelerde meydana gelen değişiklikler çalışma için kullanılabilir. Örneğin, ATAÇ-seq Akut Miyeloid Lösemi (AML)17 veya Rasbaşlangıcı sırasında değişiklikleri düzenleme peyzaj çalışması için kullanılabilir-oncogenesis11tahrik.

<table><tbody><tr><td>50 mL tubes</td><td>Lumitron</td><td>LUM-CFT011500-P</td><td>Can be from other vendors.</td></tr><tr><td>Microtubes</td><td>Axygen Inc</td><td>MCT-175-C</td><td>Can be from other vendors.</td></tr><tr><td>25 mL serological pipettes</td><td>Corning Costar</td><td>4489</td><td>Can be from other vendors.</td></tr><tr><td>Tissue culture flask</td><td>Lumitron</td><td>LUM-TCF-012-250-P</td><td>Can be from other vendors.</td></tr><tr><td>Countes Automated Cell Counter</td><td>Invitrogen</td><td>C10227</td><td></td></tr><tr><td>NucleoSpin Tissue</td><td>MACHEREY-NAGEL</td><td>740952.5</td><td></td></tr><tr><td>Peripheral blood mononuclear cells&amp;nbsp;(PBMC)</td><td>ATCC</td><td>&amp;nbsp;PCS&amp;shy;800&amp;shy;011</td><td>Can be from other vendors.</td></tr><tr><td>RPMI 1640 Medium</td><td>Biological Industries</td><td>01-103-1A</td><td>Can be from other vendors.</td></tr><tr><td>L-Glutamine Solution (200 mM)</td><td>Biological Industries</td><td>03-020-1B</td><td>Can be from other vendors.</td></tr><tr><td>Penicillin-Streptomycin</td><td>Biological Industries</td><td>03-031-1B</td><td>Can be from other vendors.</td></tr><tr><td>Fetal Bovine Serum (FBS),&amp;nbsp;Heat Inactivated, European Grade</td><td>Biological Industries</td><td>04-127-1</td><td>Can be from other vendors.</td></tr><tr><td>MACS CD4 microbeads, human</td><td>Miltenyi Biotec</td><td>130-045-101</td><td></td></tr><tr><td>MACS MS columns</td><td>Miltenyi Biotec</td><td>130-042-201</td><td></td></tr><tr><td>Anti-Human CD4 FITC</td><td>Biogems</td><td>06121-50</td><td></td></tr><tr><td>Mouse IgG1 Isotype Control FITC</td><td>Biogems</td><td>44212-50</td><td></td></tr><tr><td>Anti-Human CD3 (OKT3)</td><td>Tonbo biosciences</td><td>40-0037</td><td></td></tr><tr><td>Anti-Human CD28 SAFIRE Purified</td><td>Biogems</td><td>10311-25</td><td></td></tr><tr><td>Recombinant Human IL2</td><td>Peprotech</td><td>200-02</td><td></td></tr><tr><td>Recombinant Human IL4</td><td>Peprotech</td><td>200-04</td><td></td></tr><tr><td>Recombinant Human IL12 p70</td><td>Peprotech</td><td>200-12</td><td></td></tr><tr><td>In Vivo Ready Anti-Human IL-4 (MP4-25D2)</td><td>Tonbo</td><td>40-7048</td><td></td></tr><tr><td>LEAF&amp;nbsp;Purified anti-human IFN-&amp;gamma;</td><td>BioLegend</td><td>506513</td><td></td></tr><tr><td>NaCl, analytical grade</td><td>Carlo Erba</td><td>479687</td><td>Can be from other vendors.</td></tr><tr><td>Magnesium chloride, Hexahydrate, molecular biology grade</td><td>Calbiochem</td><td>442611</td><td>Can be from other vendors.</td></tr><tr><td>EDTA</td><td>MP Biomedicals</td><td>800682</td><td>Can be from other vendors.</td></tr><tr><td>Tris, ultra pure, 99.9% pure</td><td>MP Biomedicals</td><td>819620</td><td>Can be from other vendors.</td></tr><tr><td>NP-40 alternative (Nonylphenyl Polyethylene Glycol)</td><td>Calbiochem</td><td>492016</td><td>Can be from other vendors.</td></tr><tr><td>Protease Inhibitors</td><td>Sigma</td><td>P2714</td><td>this protease inhibitor coctail is a powder. To make 100 x solution dilute in 1 mL of molecular-biology grade water.</td></tr><tr><td>Magnetic solid phase reverse immobilization beads: AMPure XP beads</td><td>Beckman</td><td>63881</td><td></td></tr><tr><td>PCR purification kit</td><td>HyLabs</td><td>EX-GP200</td><td>Can be from other vendors.</td></tr><tr><td>Nextera DNA Library Preparation Kit (TDE1 transposase and TD buffer)</td><td>Illumina</td><td>FC-121-1030</td><td></td></tr><tr><td>NEBNext High-Fidelity 2 x PCR Master Mix</td><td>New England BioLabs</td><td>M0541</td><td></td></tr><tr><td>NEBNext Q5 Hot Start HiFi PCR Master Mix</td><td>New England BioLabs</td><td>M0543</td><td></td></tr><tr><td>SYBR Green I&amp;nbsp;</td><td>Invitrogen</td><td>S7585</td><td></td></tr><tr><td>&amp;nbsp;CFX Connect Real-Time PCR&amp;nbsp;Detection&amp;nbsp;System</td><td>Bio-rad</td><td>185-5200</td><td>Can be from other vendors.</td></tr><tr><td>CFX Manager Software</td><td>Bio-rad</td><td>1845000</td><td></td></tr><tr><td>master mix for qPCR: iTaq Universal SYBR Green Supermix</td><td>Bio-rad</td><td>172-5124</td><td>Can be from other vendors.</td></tr><tr><td>Qubit fluorometer 2.0</td><td>Invitrogen</td><td>Q32866</td><td></td></tr><tr><td>Qubit dsDNA HS Assay Kit</td><td>Invitrogen</td><td>Q32854</td><td></td></tr><tr><td>Magnet for eppendorf tubes</td><td>Invitrogen</td><td>12321D</td><td>Can be from other vendors.</td></tr><tr><td>Swing bucket cooling centrifuge with the buckets for 15 mL falcon tubes and eppendorf tubes</td><td>Thermo Scientific</td><td>75004527</td><td>Could be from other vendors. It is important that it has buckets for eppendorf tubes.</td></tr><tr><td>Thermo-shaker</td><td>MRC</td><td></td><td>Can be from other vendors.</td></tr><tr><td>High Sensitivity D1000 ScreenTape</td><td>Agilent Technologies</td><td>5067-5584</td><td></td></tr><tr><td>High Sensitivity D1000 Reagents</td><td>Agilent Technologies</td><td>5067-5585</td><td></td></tr><tr><td>4200 TapeStation system</td><td>Agilent Technologies</td><td>G2991AA</td><td>Tape-based platform for&amp;nbsp; electrophoresis</td></tr><tr><td>High Sensitivity DNA kit</td><td>Agilent Technologies</td><td>5067-4626</td><td>Reagent for high-sensitivity TapeStation analysis</td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>Primer name and sequence</td><td>Company</td><td></td><td></td></tr><tr><td>Ad1_noMX: 5&#039;-AATGATACGGCGACCACCGAGA&lt;br/&gt; TCTACACTCGTCGGCAGCGTC&lt;br/&gt; AGATGTG-3&#039;</td><td>IDT</td><td></td><td>Ad1-noMx: 5&#039;-P5 sequence-transposase sequence-3&#039;</td></tr><tr><td>Ad2.1_TAAGGCGA: 5&#039;-CAAGCAGAAGACGGCATACGAG&lt;br/&gt; AT[TCGCCTTA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.1_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.2_CGTACTAG: 5&#039;-CAAGCAGAAGACGGCATACGAG&lt;br/&gt; AT[CTAGTACG]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.2_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.3_AGGCAGAA: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[TTCTGCCT]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.3_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.4_TCCTGAGC: 5&#039;-CAAGCAGAAGACGGCATACGAG&lt;br/&gt; AT[GCTCAGGA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.4_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.5_GGACTCCT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[AGGAGTCC]GTCTCGTGGG&lt;br/&gt; CTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.5_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.6_TAGGCATG: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[CATGCCTA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.6_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.7_CTCTCTAC: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[GTAGAGAG]GTCTCGTGGG&lt;br/&gt; CTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.7_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.8_CAGAGAGG: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[CCTCTCTG]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.8_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.9_GCTACGCT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[AGCGTAGC]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.9_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.10_CGAGGCTG: 5&#039;-CAAGCAGAAGACGGCATACG&lt;br/&gt; AGAT[CAGCCTCG]GTCTCGTGG&lt;br/&gt; GCTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.10_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.11_AAGAGGCA: 5&#039;-CAAGCAGAAGACGGCATACG&lt;br/&gt; AGAT[TGCCTCTT]GTCTCGTGGG&lt;br/&gt; CTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.11_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.12_GTAGAGGA: 5&#039;-CAAGCAGAAGACGGCATACG&lt;br/&gt; AGAT[TCCTCTAC]GTCTCGTGGG&lt;br/&gt; CTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.12_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.13_GTCGTGAT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[ATCACGAC]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.13_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.14_ACCACTGT: 5&#039;- CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[ACAGTGGT]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.14_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.15_TGGATCTG: 5&#039;- CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[CAGATCCA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.15_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.16_CCGTTTGT: 5&#039;- CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[ACAAACGG]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.16_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>&amp;nbsp;Ad2.17_TGCTGGGT: 5&#039;- CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[ACCCAGCA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.17_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>&amp;nbsp;Ad2.18_GAGGGGTT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[AACCCCTC]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.18_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.19_AGGTTGGG: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[CCCAACCT]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.19_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>&amp;nbsp;Ad2.20_GTGTGGTG: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[CACCACAC]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.20_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>&amp;nbsp;Ad2.21_TGGGTTTC: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[GAAACCCA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.21_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.22_TGGTCACA: 5&#039;- CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[TGTGACCA]GTCTCGTGGGC&lt;br/&gt;TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.22_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.23_TTGACCCT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[AGGGTCAA]GTCTCGTGGGC&lt;br/&gt;TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.23_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.24_CCACTCCT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[AGGAGTGG]GTCTCGTGGG&lt;br/&gt;CTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.24_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>F1: 5&#039;-CCTTTTTATTTGCCCATACACTC-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>R1: 5&#039;-CCCAGATAGAAAGTTGGAGAGG-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>F2: 5&#039;-TTGAGGGATGCCATAACAGTC-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>R2: 5&#039;-CTGCTGAACAACATCCTTCAC-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>F3: 5&#039;-GGTTTGCAGGTTGCGTTG-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>R3: 5&#039;-AGAGGAATCTGGGAGTGACG-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>F4: 5&#039;-TGCTCATTCCGTTTCCCTAC-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>R4: 5&#039;-AGCCGGAAAGAAAGTTCCTG-3&#039;</td><td>IDT</td><td></td><td></td></tr></tbody></table>

mapping genome-wide accessible chromatin in primary human t lymphocytes by atac-seq

Yüksek işlem hacmi sıralama (ataç-seq) ile Transposase erişilebilir Kromatin için tahlil (erişilebilir) bölgelerinde açık: Kromatin tanımlanması için kullanılan bir yöntemdir. Bu bölgeler için hangi transkripsiyon faktörleri bağlamak düzenleyici DNA öğeleri (örneğin, Organizatör, arttırıcılar, odağı kontrol bölgeleri, izolatörler) temsil eder. Erişilebilir Kromatin manzara eşleme bir güçlü açığa çıkarmak etkin düzenleyici elemanlarının için genom arasında bir yaklaşımdır. Bu bilgiler ilgili transkripsiyon faktörleri ağ ve gen ifade programları yöneten Kromatin yapısı mekanizmaları keşfetmek için tarafsız bir yaklaşım olarak hizmet vermektedir. ATAÇ-seq Dnaz için güçlü ve hassas bir alternatif olduğunu ben yeni nesil sıralama (Dnaz-seq) ve formaldehit destekli yalıtım Kromatin genom geniş analizi için düzenleyici elemanlarının (FAIRE-seq) ile birleşince aşırı duyarlılık analizi erişilebilirlik ve micrococcal nükleaz duyarlı sitelerin (MNase-seq) nucleosome konumlandırma belirlemek için sıralama için. Biz insan birincil bağışıklık Yani CD4 + lenfosit hücreleri için en iyi duruma getirilmiş detaylı bir ataç-seq Protokolü mevcut (T yardımcı 1 (Th1) ve Th2 hücrelerinin). Bu kapsamlı protokol hücre hasat ile başlar sonra Kromatin tagmentation, numune hazırlama için yeni nesil sıralama, moleküler yordamı açıklar ve ayrıca yöntemleri ve konuları için kullanılan hesaplama analizleri içerir Sonuçları yorumlayın. Ayrıca, zaman ve para tasarrufu için biz ataç-seq Kütüphane sıralama önce değerlendirmek için kalite kontrol önlemleri tanıttı. Önemlisi, bu protokol için sunulan ilkeleri diğer insan bağışıklık ve non-immün Primer hücre ve hücre hatları onun uyum sağlar. Söz konusu kurallar da yeni nesil sıralama yöntemleri ile yetkin olmayan laboratuarlar için yararlı olacaktır.

Bu iletişim kuralı, nihai sonucunu genellikle 3-20 ng/µL bir ataç-seq kütüphanedir. Ne zaman bir sistemde DNA bütünlük analizi için koşmak (bakınız Tablo malzemeleri/ekipman), merdiven gibi bir görünüm2 (şekil 3A) gösteriyorlar. DNA parçaları ortalama boyutunu genellikle ~ 450-530 bp var.
Yeni nesil sıralama gerçekleştirmeden önce ata?...

Watch this Scientific Journal Video about Mapping Genome-wide Accessible Chromatin in Primary Human T Lymphocytes by ATAC-Seq at JoVE.com

Mapping Genome-wide Accessible Chromatin in Primary Human T Lymphocytes by ATAC-Seq

Tahlil Transposase erişilebilir yüksek üretilen iş sıralama (ataç-seq) ile birleştiğinde Kromatin için erişilebilir Kromatin ortaya çıkarmak için genom geniş bir yöntemdir. Bu bir adım adım ataç-seq insan lenfosit (Th1/Th2) için en iyi duruma getirilmiş son hesaplama çözümleme moleküler üzerinden iletişim kuralıdır. Bu iletişim kuralı yeni nesil sıralama yöntemleri deneyiminiz olmadan araştırmacılar tarafından kabul edilebilir.

Birincil insan T lenfositler tarafından ataç-Seq genom genelinde erişilebilir Kromatin eşleme

Assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-seq) is a method used for the identification of open (accessible) regions ...

mapping-genome-wide-accessible-chromatin-primary-human-t-lymphocytes

Research

JoVE Journal

Genetics

17.9K Görüntüleme.  Bar-Ilan University. Tahlil Transposase erişilebilir yüksek üretilen iş sıralama (ataç-seq) ile birleştiğinde Kromatin için erişilebilir Kromatin ortaya çıkarmak için genom geniş bir yöntemdir. Bu bir adım adım ataç-seq insan lenfosit (Th1/Th2) için en iyi duruma getirilmiş son hesaplama çözümleme moleküler üzerinden iletişim kuralıdır. Bu iletişim kuralı yeni nesil sıralama yöntemleri deneyiminiz olmadan araştırmacılar tarafından kabul edilebilir.

Video: Mapping Genome-wide Accessible Chromatin in Primary Human T Lymphocytes by ATAC-Seq

An Integrated Platform for Genome-wide Mapping of Chromatin States Using High-throughput ChIP-sequencing in Tumor Tissues

Histone modifications constitute a major component of the epigenome and play important regulatory roles in determining the transcriptional status of associated loci. In addition, the presence of specific modifications has been used to determine the position and identity non-coding functional elements such as enhancers. In recent years, chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq) has become a powerful tool in determining the genome-wide profiles of individual histone modifications. However, it has become increasingly clear that the combinatorial patterns of chromatin modifications, referred to as Chromatin States, determine the identity and nature of the associated genomic locus. Therefore, workflows consisting of robust high-throughput (HT) methodologies for profiling a number of histone modification marks, as well as computational analyses pipelines capable of handling myriads of ChIP-Seq profiling datasets, are needed for comprehensive determination of epigenomic states in large number of samples. The HT-ChIP-Seq workflow presented here consists of two modules: 1) an experimental protocol for profiling several histone modifications from small amounts of tumor samples and cell lines in a 96-well format; and 2) a computational data analysis pipeline that combines existing tools to compute both individual mark occupancy and combinatorial chromatin state patterns. Together, these two modules facilitate easy processing of hundreds of ChIP-Seq samples in a fast and efficient manner. The workflow presented here is used to derive chromatin state patterns from 6 histone mark profiles in melanoma tumors and cell lines. Overall, we present a comprehensive ChIP-seq workflow that can be applied to dozens of human tumor samples and cancer cell lines to determine epigenomic aberrations in various malignancies.

Here, we describe an optimized high-throughput ChIP-sequencing protocol and computational analyses pipeline for the determination of genome-wide chromatin state patterns from frozen tumor tissues and cell lines.

Yüksek işlem hacmi ChIP-sıralama tümör dokularda kullanarak genom geniş eşleme Kromatin devletler için entegre bir Platform

Histone modifications constitute a major component of the epigenome and play important regulatory roles in determining the transcriptional status of ...

Kanser Araştırmaları

ATAC-seq Assay with Low Mitochondrial DNA Contamination from Primary Human CD4+ T Lymphocytes

ATAC-seq has become a widely used methodology in the study of epigenetics due to its rapid and simple approach to mapping genome-wide accessible chromatin. In this paper we present an improved ATAC-seq protocol that reduces contaminating mitochondrial DNA reads. While previous ATAC-seq protocols have struggled with an average of 50% contaminating mitochondrial DNA reads, the optimized&#160;lysis buffer introduced in this protocol reduces mitochondrial DNA contamination to an average of 3%. This improved ATAC-seq protocol allows for a near 50% reduction in the sequencing cost. We demonstrate how these high-quality ATAC-seq libraries can be prepared from activated CD4+ lymphocytes, providing step-by-step instructions from CD4+ lymphocyte isolation from whole blood through data analysis. This improved ATAC-seq protocol has been validated in a wide range of cell types and will be of immediate use to researchers studying chromatin accessibility.

Here, we present a protocol to perform an assay for transposase-accessible chromatin sequencing (ATAC-seq) on activated CD4+ human lymphocytes. The protocol has been modified to minimize contaminating mitochondrial DNA reads from 50% to 3% through the introduction of a new lysis buffer.

ATAÇ-seq tahlil birincil insan CD4 + T lenfositleri kirlenme düşük mitokondrial DNA ile

ATAC-seq has become a widely used methodology in the study of epigenetics due to its rapid and simple approach to mapping genome-wide accessible ...

Genetik

Adipocyte-Specific ATAC-Seq with Adipose Tissues Using Fluorescence-Activated Nucleus Sorting

Assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) is a robust technique that enables genome-wide chromatin accessibility profiling. This technique has been useful for understanding the regulatory mechanisms of gene expression in a range of biological processes. Although ATAC-seq has been modified for different types of samples, there have not been effective modifications of ATAC-seq methods for adipose tissues. Challenges with adipose tissues include the complex cellular heterogeneity, large lipid content, and high mitochondrial contamination. To overcome these problems, we have developed a protocol that allows adipocyte-specific ATAC-seq by employing fluorescence-activated nucleus sorting with adipose tissues from the transgenic reporter Nuclear tagging and Translating Ribosome Affinity Purification (NuTRAP) mouse. This protocol produces high-quality data with minimal wasted sequencing reads while reducing the amount of nucleus input and reagents. This paper provides detailed step-by-step instructions for the ATAC-seq method validated for the use of adipocyte nuclei isolated from mouse adipose tissues. This protocol will aid in the investigation of chromatin dynamics in adipocytes upon diverse biological stimulations, which will allow for novel biological insights.

We present a protocol for assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) specifically on adipocytes using nucleus sorting with adipose tissues isolated from transgenic reporter mice with nuclear fluorescence labeling.

Floresan Aktif Çekirdek Ayıklama Kullanarak Yağ Dokuları ile Adiposit-Spesifik ATAC-Seq

Assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) is a robust technique that enables genome-wide chromatin ...

CATCH-UP: A High-Throughput Upstream-Pipeline for Bulk ATAC-Seq and ChIP-Seq Data

Assay for transposase-accessible chromatin (ATAC) and chromatin immunoprecipitation (ChIP), coupled with next-generation sequencing (NGS), have revolutionized the study of gene regulation. A lack of standardization in the analysis of the highly dimensional datasets generated by these techniques has made reproducibility difficult to achieve, leading to discrepancies in the published, processed data. Part of this problem is due to the diverse range of bioinformatic tools available for the analysis of these types of data. Secondly, a number of different bioinformatic tools are required sequentially to convert raw data into a fully processed and interpretable output, and these tools require varying levels of computational skills. Furthermore, there are many options for quality control that are not uniformly employed during data processing. We address these issues with a complete assay for transposase-accessible chromatin sequencing (ATAC-seq) and chromatin immunoprecipitation sequencing (ChIP-seq) upstream pipeline (CATCH-UP), an easy-to-use, Python-based pipeline for the analysis of bulk ChIP-seq and ATAC-seq datasets from raw fastq files to visualizable bigwig tracks and peaks calls. This pipeline is simple to install and run, requiring minimal computational knowledge. The pipeline is modular, scalable, and parallelizable on various computing infrastructures, allowing for easy reporting of methodology to enable reproducible analysis of novel or published datasets.

ATAC-seq and ChIP-seq allow detailed investigation of gene regulation; however, processing these data types is challenging and often inconsistent between research groups. We present CATCH-UP: an easy-to-use computational pipeline that allows standardized and reproducible data processing and analysis of new and published ATAC/ChIP-seq datasets.

Assay for transposase-accessible chromatin (ATAC) and chromatin immunoprecipitation (ChIP), coupled with next-generation sequencing (NGS), have ...

ATAC-Seq Optimization for Cancer Epigenetics Research

The assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) probes deoxyribonucleic acid (DNA) accessibility using the hyperactive Tn5 transposase. Tn5 cuts and ligates adapters for high-throughput sequencing within accessible chromatin regions. In eukaryotic cells, genomic DNA is packaged into chromatin, a complex of DNA, histones, and other proteins, which acts as a physical barrier to the transcriptional machinery. In response to extrinsic signals, transcription factors recruit chromatin remodeling complexes to enable access to the transcriptional machinery for gene activation. Therefore, identifying open chromatin regions is useful when monitoring enhancer and gene promoter activities during biological events such as cancer progression. Since this protocol is easy to use and has a low cell input requirement, ATAC-seq has been widely adopted to define open chromatin regions in various cell types, including cancer cells. For successful data acquisition, several parameters need to be considered when preparing ATAC-seq libraries. Among them, the choice of cell lysis buffer, the titration of the Tn5 enzyme, and the starting volume of cells are crucial for ATAC-seq library preparation in cancer cells. Optimization is essential for generating high-quality data. Here, we provide a detailed description of the ATAC-seq optimization methods for epithelial cell types.

ATAC-seq is a DNA sequencing method that uses the hyperactive mutant transposase, Tn5, to map changes in chromatin accessibility mediated by transcription factors. ATAC-seq enables the discovery of the molecular mechanisms underlying phenotypic alterations in cancer cells. This protocol outlines optimization procedures for ATAC-seq in epithelial cell types, including cancer cells.

Kanser Epigenetiği Araştırmaları için ATAC-Seq Optimizasyonu

The assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) probes deoxyribonucleic acid (DNA) accessibility using the ...

Tek Hücre Çözünürlüğünde Fare Kardiyak Progenitör Hücrelerinden Çekirdek İzolasyonu

Nuclei Isolation from Mouse Cardiac Progenitor Cells for Epigenome and Gene Expression Profiling at Single-Cell Resolution

The developing heart is a complex structure containing various progenitor cells controlled by complex regulatory mechanisms. The examination of the gene expression and chromatin state of individual cells allows the identification of the cell type and state. Single-cell sequencing approaches have revealed a number of important characteristics of cardiac progenitor cell heterogeneity. However, these methods are generally restricted to fresh tissue, which limits studies with diverse experimental conditions, as the fresh tissue must be processed at once in the same run to reduce the technical variability. Therefore, easy and flexible procedures to produce data from methods such as single-nucleus RNA sequencing (snRNA-seq) and the single-nucleus assay for transposase-accessible chromatin with high-throughput sequencing (snATAC-seq) are needed in this area. Here, we present a protocol to rapidly isolate nuclei for subsequent single-nuclei dual-omics (combined snRNA-seq and snATAC-seq). This method allows the isolation of nuclei from frozen samples of cardiac progenitor cells and can be combined with platforms that use microfluidic chambers.

Yazar Spotlight: Tek Hücre Çözünürlüğünde Epigenom ve Gen İfadesi Profili Oluşturma için Fare Kardiyak Progenitör Hücrelerinden Çekirdek İzolasyonu  

Here, we present a protocol describing cell nuclei preparation. After microdissection and enzymatic dissociation of cardiac tissue into single cells, the progenitor cells were frozen, followed by isolation of pure viable cells, which were used for single-nucleus RNA sequencing and the single-nucleus assay for transposase-accessible chromatin with high-throughput sequencing analyses.

Epigenom ve Tek Hücre Çözünürlüğünde Gen Ekspresyon Profillemesi için Fare Kardiyak Progenitör Hücrelerinden Çekirdek İzolasyonu

The developing heart is a complex structure containing various progenitor cells controlled by complex regulatory mechanisms. The examination of the gene ...

Gelişim Biyolojisi

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly offer whole-genome coverage, where combining chromatin immunoprecipitation (ChIP) and massively parallel sequencing can be utilized to identify the repertoire of mammalian DNA sequences bound by transcription factors in vivo. "Next-generation" genome sequencing technologies provide 1-2 orders of magnitude increase in the amount of sequence that can be cost-effectively generated over older technologies thus allowing for ChIP-seq methods to directly provide whole-genome coverage for effective profiling of mammalian protein-DNA interactions.
For successful ChIP-seq approaches, one must generate high quality ChIP DNA template to obtain the best sequencing outcomes. The description is based around experience with the protein product of the gene most strongly implicated in the pathogenesis of type 2 diabetes, namely the transcription factor transcription factor 7-like 2 (TCF7L2). This factor has also been implicated in various cancers.
Outlined is how to generate high quality ChIP DNA template derived from the colorectal carcinoma cell line, HCT116, in order to build a high-resolution map through sequencing to determine the genes bound by TCF7L2, giving further insight in to its key role in the pathogenesis of complex traits.

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

The combination of chromatin immunoprecipitation and ultra-high-throughput sequencing (ChIP-seq) can identify and map protein-DNA interactions in a given tissue or cell line. Outlined is how to generate a high quality ChIP template for subsequent sequencing, using experience with the transcription factor TCF7L2 as an example.

Yüksek verim Sıralama için Yüksek Kalite Kromatin Immunoprecipitation DNA Şablon üretimi (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

Biyoloji

Multiplexed Analysis of Retinal Gene Expression and Chromatin Accessibility Using scRNA-Seq and scATAC-Seq

Powerful next generation sequencing techniques offer robust and comprehensive analysis to investigate how retinal gene regulatory networks function during development and in disease states. Single-cell RNA sequencing allows us to comprehensively profile gene expression changes observed in retinal development and disease at a cellular level, while single-cell ATAC-Seq allows analysis of chromatin accessibility and transcription factor binding to be profiled at similar resolution. Here the use of these techniques in the developing retina is described, and MULTI-Seq is demonstrated, where individual samples are labeled with a modified oligonucleotide-lipid complex, enabling researchers to both increase the scope of individual experiments and substantially reduce costs.

Here, the authors showcase the utility of MULTI-seq for phenotyping and subsequent paired scRNA-seq and scATAC-seq in characterizing the transcriptomic and chromatin accessibility profiles in retina.

scRNA-Seq ve scATAC-Seq Kullanarak Retinal Gen Ekspresyonu ve Kromatin Erişilebilirliğinin Multipleks Analizi

Powerful next generation sequencing techniques offer robust and comprehensive analysis to investigate how retinal gene regulatory networks function during ...

Birincil insan T lenfositler tarafından ataç-Seq genom genelinde erişilebilir Kromatin eşleme

Özet

Daha Fazla Video Keşfet

PLAYLIST