Bu eser Guozhou Xu için Kuzey Carolina Eyalet Üniversitesi yeni öğretim başlangıç fonlar tarafından desteklenmiştir.

Not: Bir böcek cep/baculovirus sistemi ile değiştirilmiş ifade vektörel çizimler salgı bitki protein ifade ve kristalizasyon için kullanılır.
1. bir Baculovirus ifade vektör GP67 sinyal peptid bitki Protein salgılanması ifade ile modifikasyonu
<ol><li>Bir 5' BglII kesme makinası13, GP67 salgılanması sinyal sıra ve NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI ve XhoI (Şekil 1A) ile bir çok klonlama site içeren bir DNA parçası sentez. Not: BglII ve BamHI sindirilmiş beri DNA aynı yapışkanlı sona sonuçlandı, tavlanmış ligasyonu sırayla BglII ve BamHI siteleri tarafından yarilabilir değil bir sıra mutasyona iken Doğrusallaştırılmış vektör sindirilir DNA parçası ligate ya BglII ya da BamHI14.</li>
	<li>BglII ve XhoI ile DNA'ın Özeti 4 µg ve14BamHI ve XhoI ile bir ifade vektör DNA 4 µg. 1 x konsantrasyon tepki arabellek (50 mM potasyum asetat, 20 mM Tris-asetat, 10 mM magnezyum asetat ve 100 µg/mL BSA, pH 7,9 25 ° c) DNA'daki ile her Restriksiyon enzimi ile 10 birim mix ve 4 h için 37 ° C'de karışımı kuluçkaya.<ol>
<li>Eksize DNA parçası ve bir DNA jel ekstraksiyon kiti15tarafından Doğrusallaştırılmış vektör DNA arındırmak.</li>
	</ol>
</li>
	<li>Yöneyin Doğrusallaştırılmış DNA 400 ile mix 100 ng ng sindirilir DNA parçası 1 x T4 DNA ligaz tepki arabellek (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP ve 10 mM DTT, pH 7.5 25 ° c) ve 5 adet T4 DNA içeren bir 10 µL ligasyonu tepki karışımı ligaz. 16 ° C 16 h için tepki karisimin kuluçkaya.</li>
	<li>5 µL ligasyonu karışımı DH5α yetkili hücre bir standart dönüştürme protokol sonrası 100 µL dönüştürmek ve bir ampisilin-LB agar plaka16üzerinde elde edilen kolonileri seçin. 5-10 kolonileri kadar almak ve her koloni 220 devir/dakika ve 37 ° C 16 h için titreyen bir kuluçka 100 µg/mL ampisilin içeren LB Orta 2 ml büyür.</li>
	<li>Her plazmid DNA ile DNA miniprep kit17 ayıklamak ve klonlar tarafından DNA sıralama bir astar AGTATTTTACTGTTTTCGTAACAG ile onaylayın.</li>
	<li>PCR yükseltmek A. thaliana TDR gen parçası kodlama artıkları sentetik bir TDR gen üzerinden 30-642 oluşturmak (ileri astar: CATG GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, geriye doğru astar: GC GGATCC CTA GTG GTG ATG GTG GTG GTG ACCGTCTATATCTGCATTTCCGGC). 0,5 mM dNTP mix, 0.2 µM astar, şablonun DNA 0.1 µg, 0.4 mM MgCl2ve 1 tepki adet DNA polimeraz içeren DNA polimeraz tepki arabellekte 30 döngüleri için DNA yükseltmek.<ol>
<li>30 95 ° C'de ilk denatürasyon PCR döngüsü adımlar için küme s ve sonra 30 döngüleri denatürasyon 95 ° C'de 30 s, 30 s ve uzantısına sahip bir son 5 min için 72 ° C'de 72 ° c için 1 dakika, uzantısı için 55 ° C'de tavlama.</li>
	</ol>
</li>
	<li>PCR parçası ve yazmamalı ve BamHI kısıtlama endonükleaz enzimleri ile değiştirilmiş vektör sindirmek. Gen parça Doğrusallaştırılmış vektör ile ligate. Yöneyin Doğrusallaştırılmış DNA 400 ile mix 100 ng ng sindirilir DNA parçası T4 DNA ligaz reaksiyon tamponu ve 5 adet T4 DNA ligaz içeren bir 10 µL ligasyonu tepki karışımı. 16 ° C 16 h için tepki karisimin kuluçkaya.</li>
	<li>5 µL ligasyonu karışımı DH5α yetkili hücre bir standart dönüştürme protokol sonrası 100 µL dönüştürmek ve bir ampisilin-LB agar plaka16üzerinde elde edilen kolonileri seçin. Doğru klon DNA sıralama tarafından onaylayın.</li>
</ol>2. bir Baculovirus ifade vektör böcek Hemolin sinyal peptid bitki Protein salgılanması ifade ile modifikasyonu
<ol><li>Bir 5' BglII kesme makinası13, böcek hemolin salgılanması sinyal sıra ve NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI ve XhoI (Şekil 1B) ile bir çok klonlama site içeren bir DNA parçası sentez.</li>
	<li>BglII ve XhoI ile DNA'ın Özeti 4 µg ve14BamHI ve XhoI ile bir ifade vektör DNA 4 µg. 1 x konsantrasyon tepki arabellek (50 mM potasyum asetat, 20 mM Tris-asetat, 10 mM magnezyum asetat ve 100 µg/mL BSA, pH 7,9 25 ° c) DNA'daki ile her Restriksiyon enzimi ile 10 birim mix ve 4 h için 37 ° C'de karışımı kuluçkaya.<ol>
<li>Eksize DNA parçası ve bir DNA jel ekstraksiyon kiti15tarafından Doğrusallaştırılmış vektör DNA arındırmak.</li>
	</ol>
</li>
	<li>Yöneyin Doğrusallaştırılmış DNA 400 ile mix 100 ng ng sindirilir DNA parçası 1 x T4 DNA ligaz tepki arabellek (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP ve 10 mM DTT, pH 7.5 25 ° c) ve 5 adet T4 DNA içeren bir 10 µL ligasyonu tepki karışımı ligaz. 16 ° C 16 h için tepki karisimin kuluçkaya.</li>
	<li>5 µL ligasyonu karışımı DH5α yetkili hücre 100 µL dönüştürmek ve koloniler ampisilin-LB agar plaka üzerinde seçin. 5-10 kolonileri kadar almak ve 2 mL LB ortamda 100 µg/mL 220 devir/dakika ve 37 ° C 16 h için titreyen bir kuluçka ampisilin içeren her koloni büyür.</li>
	<li>Plazmid DNA ile DNA miniprep kit17 ayıklamak ve klonlar tarafından DNA sıralama bir astar AGTATTTTACTGTTTTCGTAACAG ile onaylayın.</li>
	<li>A. thaliana polen reseptör kinaz 3 (PRK3) gen parça PCR yükseltmek artıkları 20-237 sentetik bir PRK3 gen yapısı üzerinden kodlama (ileri astar: CATG GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, geriye doğru astar: CGC GGATCC CTA GTG GTG ATG GTG GTG GTG TGAAGGTTTCTCATCGCATTCTATATTC). 0,5 mM dNTP mix, 0.2 µM astar, şablonun DNA 0.1 µg, 0.4 mM MgCl2ve 1 tepki adet DNA polimeraz içeren DNA polimeraz tepki arabellekte 30 döngüleri için DNA yükseltmek.<ol>
<li>30 95 ° C'de ilk denatürasyon PCR döngüsü adımlar için küme s ve sonra 30 döngüleri denatürasyon 95 ° C'de 30 s, 30 s ve uzantısı için 30 72 ° C'de 55 ° C'de tavlama her döngüsü ve 5 min için 72 ° C'de son uzantısı içinde s.</li>
	</ol>
</li>
	<li>PCR parçası ve yazmamalı ve BamHI kısıtlama endonükleaz enzimleri ile değiştirilmiş vektör sindirmek. Gen parça Doğrusallaştırılmış vektör ile ligate. Yöneyin Doğrusallaştırılmış DNA 400 ile mix 100 ng ng sindirilir DNA parçası T4 DNA ligaz reaksiyon tamponu ve 5 adet T4 DNA ligaz içeren bir 10 µL ligasyonu tepki karışımı. 16 ° C 16 h için tepki karisimin kuluçkaya.</li>
	<li>5 µL ligasyonu karışımı DH5α yetkili hücre bir standart dönüştürme protokol sonrası 100 µL dönüştürmek ve bir ampisilin-LB agar plaka16üzerinde elde edilen kolonileri seçin. Doğru klon DNA sıralama tarafından onaylayın.</li>
</ol>3. üretim ve Baculovirus amplifikasyon oluşturur rekombinant Protein ifade kaset yataklık
<ol><li>DH10Bac yetkili hücre baculovirus ifade sistem1protokol sonrası 40 µL dönüştürmek için yapı plazmid kullanım 100 ng. 48 h 37 ° C'de dönüştürme plakaları kuluçkaya.</li>
	<li>İki beyaz kolonileri her dönüştürme plaka almak, her koloni 2 mL 50 µg/mL sefaloridin, 7 µg/mL gentamisin ve 10 µg/mL tetrasiklin içeren LB orta aşılamak. Ayıklamak ve DNA bacmid doğrulamak için baculovirus ifade sistem1 Protokolü izleyin. Aliquot her DNA 20 µL her, ile iki tüpler ve borular-20 ° C'de depolayın Not: Aşağıdaki adımları aseptik ameliyat gerektirir.</li>
	<li>Bir monolayer Kültür medya % 10 fetal Sığır serum (FBS) ve 100 µg/mL (veya 100 I.U./mL) ile penisilin-streptomisin antibiyotik 27 ° C'de Sf9 hücrelerinin % 80 izdiham bir 6-şey plaka için büyür. Doku kültürü plaka üzerinde kapalı alan yüzdesini temel izdiham yüzdesini tahmin ediyoruz.</li>
	<li>İki steril 1.5 mL santrifüj tüpleri aşağıdaki çözümleri hazırlayın.<ol>
<li>Tüp 1: her transfection için bacmid DNA unsupplemented Sf9 hücre kültür orta antibiyotikler olmadan 100 µL içine 20 µL oranında seyreltin. Seyreltme karışımı yavaşça tüp tarafında flicking tarafından.</li>
		<li>Tüp 2: her transfection için unsupplemented Sf9 hücre kültür orta antibiyotikler olmadan 100 µL içine lipid transfection reaktif 8 µL oranında seyreltin. Seyreltme yukarı ve aşağı 6 x için pipetting tarafından iyice karıştırın.</li>
	</ol>
</li>
	<li>İki çözüm birleştirmek, onları karışımı yavaşça yavaşça yukarı ve aşağı 3 x için pipetting tarafından ve onları 20-40 dakika oda sıcaklığında kuluçkaya.</li>
	<li>Sf9 monolayer her şey hücreleri 2 x 3 mL unsupplemented Sf9 hücre kültür orta olmadan antibiyotik ile yıkayın. Her transfection için unsupplemented Sf9 hücre kültür orta antibiyotikler olmadan 0.8 mL lipid-DNA karışımı içeren her tüpün ekleyin. Tüpler içeriğini karışımı yavaşça yavaşça yukarı ve aşağı 3 x için pipetting tarafından. Tabak yıkama medyadan Aspire edin ve transfection karışımı ile örnekleri yerleşimi.</li>
	<li>Transfection karışımı eklenmesinden sonra 27 ° C'de 5 h transfected plaka kuluçkaya Tam Sf9 hücre kültür veya % 10 FBS ve 100 µg/mL (100 I.U./mL) içeren orta ile transfection ortamı değiştirin penisilin-streptomisin antibiyotik. 4 d için 27 ° C'de transfected plaka kuluçkaya.</li>
	<li>Hasat ve rekombinant baculovirus yükseltmek.<ol>
<li>Süpernatant steril 15 mL konik tüp içinde virüslü plaka, kuluçka sonra 4 d toplayın. Süpernatant vasıl 1010 x g hücre artıkları kaldırmak 5 min için spin. Pelet atmak ve süpernatant temiz bir tüp için dikkatle boşaltmak ve 4 ° C ilâ 1 yıl için saklayın. Not: Bu P0 virüs olduğunu. Bu uzun bir süre için bölünmemeli ve-80 ° C'de depolanmış olabilir.</li>
		<li>Rekombinant her virüs yükseltmek için % 80 izdiham monolayer 150 mm tabakta Sf9 hücrelerin büyümek. Plaka medyadan Aspire edin, 2 mL P0 virüs hücreleri yapışık plaka ekleyin ve 1 h 27 ° C kuluçka plaka kuluçkaya. Orta hücre ile karıştırmak için plaka her 15dk rock.<ol>
<li>25 mL % 10 FBS ve 100 µg/mL (veya 100 I.U./mL) içeren tam Grace'in medya ekleyin penisilin-streptomisin antibiyotik. P1 geçit virüs almak için 27 ° C kuluçka 3 d plaka kuluçkaya.</li>
		</ol>
</li>
		<li>Steril 50 mL konik tüp ve 1010 x g hücre artıkları kaldırmak 5 min için spin virüslü plaka süpernatant toplamak. Süpernatant temiz bir tüp için dikkatle boşaltmak ve 4 ° C ilâ 1 yıl için saklayın. Not: P1 virüs bölünmemeli ve saklı-80 ° C'de daha uzun bir süre için olabilir.</li>
		<li>Virüs--dan P1 P2 geçiş için yükseltmek için bir monolayer 150 mm tabakta Sf9 hücrelerinin % 90 izdiham için büyümek, medya plaka Aspire edin, P1 virüs 2 mL plaka ekleyin ve 1 h 27 ° C kuluçka için kuluçkaya.</li>
		<li>3.8.2 ve 3.8.3 virüslerin P2 ve P3 pasajlar edinmek için adımları yineleyin. P3 virüs 2 aydan fazla tutmayın.</li>
	</ol>
</li>
</ol>4. protein ifade, NiNTA ve kristalizasyon ile arıtma
<ol><li>2 x 106 100 devirde bir 27 ° C kuluçka Shaker yoğunluğu kültür medya 100 µg/mL (veya 100 I.U./mL) ile penisilin-streptomisin antibiyotiklere Hi5 böcek hücrelerinin 1 L kültür. Spin aşağı hücreleri 570 x g 5 min için de, süpernatant dikkatle boşaltmak, 20 mL taze üretilen P3 şunun hücrelerde resuspend ve 1 h. yavaşça sarsmak için her 15 dk x 1 hücreleri resuspend için spin şişe oda sıcaklığında saklayın.</li>
	<li>Hücreleri 1 litre 100 µg/mL (veya 100 I.U./mL) ile Kültür medya penisilin-streptomisin antibiyotikler, transfer 100 devirde bir 27 ° C kuluçka Shaker 72 h. Spin 1.010 x g 5 min için de hücreleri aşağı için hücre kültür ve süpernatant toplamak.</li>
	<li>Kullanım pH göstergesi süpernatant 8,0 pH 0,1 M HCl veya 0.1 M NaOH ekleyerek ayarlayın ve 20 mM Tris tampon pH 8.0, 100 mM NaCl ve 5 mM imidazole içeren bir son konsantrasyonu, bağlama arabellek eklemek için şeritler. Üzerinde ifade O'nun öğesini Rekombinant protein verim tahmini göre belirli bir miktar NiNTA reçine (10-40 mL) ekleyin.<ol>
<li>Çözüm manyetik heyecan üzerinde 1 h. Yıkama için 4 ° C'de düşük hız ile reçine mix ve standart NiNTA arıtma Protokolü18takip ilişkili protein elute.</li>
	</ol>
</li>
	<li>Saf protein iyon değiştirme için konu ve filtrasyon Kromatografi yanı sıra homojen bir örnek vermeye diğer protein saflaştırma yöntemleri jel. Not: TDR ectodomain için 20 mM Tris, pH 8, 100 mM NaCl kullanılan jel filtrasyon arabellek. PRK3 ectodomain için 20 mM BIS-Tris, pH 6, 100 mM NaCl tercih edilen jel filtrasyon arabellek kullanılmıştır.</li>
</ol>

<ol>
	<li>Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+using+the+baculovirus-insect+cell+expression+system.">Protein production using the baculovirus-insect cell expression system.</a> Biotechnology Progress. 30, 1-18 (2014).</li><li>Khan, S., Ng, M. L., Tan, Y. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+the+severe+acute+respiratory+syndrome+coronavirus+3a+protein+and+the+assembly+of+coronavirus-like+particles+in+the+baculovirus+expression+system.">Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system.</a> Methods in Molecular Biology. 379, 35-50 (2007).</li><li>Possee, R. D., King, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Baculovirus+Transfer+Vectors.">Baculovirus Transfer Vectors.</a> Methods in Molecular Biology. 1350, 51-71 (2016).</li><li>Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+establishment+of+two+cell+lines+from+the+insect+Spodoptera+frugiperda+(Lepidoptera;+Noctuidae).">The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae).</a> In Vitro. 13, 213-217 (1977).</li><li>Hink, W. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Established+insect+cell+line+from+the+cabbage+looper,+Trichoplusia+ni.">Established insect cell line from the cabbage looper, Trichoplusia ni.</a> Nature. 226, 466-467 (1970).</li><li>Davis, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+recombinant+protein+production+of+eight+insect+cell+lines.">Comparative recombinant protein production of eight insect cell lines.</a> In Vitro Cellular &amp; Development Biology - Animal. 29A, 388-390 (1993).</li><li>Wickham, T. J., Nemerow, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+growth+methods+and+recombinant+protein+production+in+BTI-Tn-5B1-4+insect+cells+using+the+baculovirus+expression+system.">Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system.</a> Biotechnology Progress. 9, 25-30 (1993).</li><li>Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Baculovirus+expression+of+alkaline+phosphatase+as+a+reporter+gene+for+evaluation+of+production,+glycosylation+and+secretion.">Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion.</a> Nature Biotechnology. 10, 1148-1150 (1992).</li><li>Murphy, C. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+expression,+secretion,+and+large-scale+purification+of+recombinant+HIV-1+gp120+in+insect+cell+using+the+baculovirus+egt+and+p67+signal+peptides.">Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides.</a> Protein Expression and Purification. 4, 349-357 (1993).</li><li>Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemolin:+an+insect-immune+protein+belonging+to+the+immunoglobulin+superfamily.">Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily.</a> Science. 250, 1729-1732 (1990).</li><li>Li, Z., Chakraborty, S., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+CLE+peptide+perception+by+plant+receptors+implicated+from+structural+and+functional+analyses+of+TDIF-TDR+interactions.">Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions.</a> PLoS One. 12, e0175317 (2017).</li><li>Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Extracellular+Domain+of+Pollen+Receptor+Kinase+3+is+structurally+similar+to+the+SERK+family+of+co-receptors.">The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors.</a> Scientific Reports. 8, 2796 (2018).</li><li>Khorana, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Total+synthesis+of+a+gene.">Total synthesis of a gene.</a> Science. 203, 614-625 (1979).</li><li>Bahl, C. P., Marians, K. J., Wu, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+method+for+inserting+specific+DNA+sequences+into+cloning+vehicles.">A general method for inserting specific DNA sequences into cloning vehicles.</a> Gene. 1, 81-92 (1976).</li><li>Xu, W., Zhang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Characterization+of+Vaccine-Derived+Polioviruses,+Relevance+for+the+Global+Polio+Eradication+Initiative.">Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative.</a> Methods in Molecular Biology. 1387, 213-226 (2016).</li><li>Hanahan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+transformation+of+Escherichia+coli+with+plasmids.">Studies on transformation of Escherichia coli with plasmids.</a> Journal of Molecular Biology. 166, 557-580 (1983).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Reddy, B. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+and+purification+of+the+alpha+subunit+of+the+epithelial+sodium+channel,+ENaC.">Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC.</a> Protein Expression and Purification. 117, 67-75 (2016).</li><li>Harris, T. J., Emtage, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+heterologous+genes+in+E.+coli.">Expression of heterologous genes in E. coli.</a> Microbiological Sciences. 3, 28-31 (1986).</li><li>Kaur, J., Kumar, A., Kaur, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+optimization+of+heterologous+protein+expression+in+E.+coli:+Roadblocks+and+reinforcements.">Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements.</a> International Journal of BIological Macromolecules. 106, 803-822 (2018).</li><li>Guo, Y., Yang, F., Tang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Overview+of+Protein+Secretion+in+Yeast+and+Animal+Cells.">An Overview of Protein Secretion in Yeast and Animal Cells.</a> Methods in Molecular Biology. 1662, 1-17 (2017).</li><li>Blight, M. A., Chervaux, C., Holland, I. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+secretion+pathway+in+Escherichia+coli.">Protein secretion pathway in Escherichia coli.</a> Current Opinion in Biotechnology. 5, 468-474 (1994).</li><li>Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+protein+secretion+in+yeast:+strategies+and+impact+on+protein+production.">Engineering of protein secretion in yeast: strategies and impact on protein production.</a> Applied Microbiology and Biotechnology. 86, 403-417 (2010).</li><li>Wormald, M. R., Dwek, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycoproteins:+glycan+presentation+and+protein-fold+stability.">Glycoproteins: glycan presentation and protein-fold stability.</a> Structure. 7, R155-R160 (1999).</li><li>Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Overview+and+History+of+Glyco-Engineering+in+Insect+Expression+Systems.">An Overview and History of Glyco-Engineering in Insect Expression Systems.</a> Methods in Molecular Biology. 1321, 131-152 (2015).</li><li>Li, Z., Chakraborty, S., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-ray+crystallographic+studies+of+the+extracellular+domain+of+the+first+plant+ATP+receptor,+DORN1,+and+the+orthologous+protein+from+Camelina+sativa.">X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa.</a> Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).</li><li>Aricescu, A. R., Owens, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+recombinant+glycoproteins+in+mammalian+cells:+towards+an+integrative+approach+to+structural+biology.">Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology.</a> Current Opinion in Structural Biology. 23, 345-356 (2013).</li><li>Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Scale-up+of+hydrophobin-assisted+recombinant+protein+production+in+tobacco+BY-2+suspension+cells.">Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells.</a> Plant Biotechnology Journal. 12, 402-410 (2014).</li><li>Dohi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+virus-mediated+expression+of+a+foreign+protein+in+suspension-cultured+plant+cells.">Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells.</a> Archives of Virology. 151, 1075-1084 (2006).</li></ol>

Yazarlar ifşa gerek yok.

Çeşitlilik içinde büyüklük ve istikrar proteinlerin biyolojik sistemlerde mevcut binlerce göz önüne alındığında, bu kez bir araştırma için ampirik laboratuvar hangi Contegra ifade sistem karar vardır belirli bir protein ifade için seçilecek. E. coli ifade sistem kez up19ölçeklemek için ilk kısa yaşam döngüsü nedeniyle protein ifade bakterilerin düşük maliyetli Kültür Medya ve göreceli kolaylığı için seçimdir. Ancak, E. coli kullanarak 60 kDa ...

X-ışını crystallographic çalışmalar için özellikle Biyokimya ve biyofizik karakterizasyonu için homojen rekombinant proteinlerin büyük miktarlarda üretme yeteneğine sahip olması bir araştırma laboratuvarı için zorunludur. Escherichia coli, mantar, böcek hücreleri, memeli hücreleri, bitki hücreleri, vb aralarında gibi birçok tanınmış Contegra ifade sistemleri vardır, böcek hücre baculovirus-aracılı ifade sistem en çoğunlukla teknikleri yapısal olarak katlanmış büyük ölçekli rekombinant ökaryotik proteinler protein kristalizasyon1için büyük miktarlarda üretmek için kullanılır.
İfade vektörel çizimler baculovirus ifade sisteminin güçlü polyhedrin veya yüksek bir verim rekombinant proteinler hücre içi2,3üretmek için P10 organizatörü içerecek şekilde tasarlanmıştır. Rekombinant baculovirus yapmak için faiz gen Autographa californica multi-nucleopolyhedroviral genom polyhedrin (polh) odağı içeren bir böcek vektörü klonlanmış. Elde edilen yapı sonra sıralı ve onun doğru açık okuma çerçevesi (ORF) doğrulanır. Doğru yapı sonra transfection sürecinde ana bilgisayar böcek hücresine tanıttı. Gen ilgi viral Genom tarafından Homolog rekombinasyon eklenir. Bu olay rekombinant üretmek için hangi sonra çoğaltır virüs parçacıkları1budded rekombinant viral genom üretiminde sonuçlanır.
İfade sisteminde en sık kullanılan böcek hücreleri Sf9 ve yüksek beş (Hi5) hücrelerdir. Spodoptera frugiperda, pupa yumurtalık hücrelerinden elde edilen Sf21, klonal bir izole Sf9 hücrelerdir ve ebeveyn Trichoplusia ni yumurtalık hücre satırı TN-3684,5dan türetilmiş bir klonal izole Hi5 hücrelerdir. Hi5 hücreleri genellikle rekombinant proteinler6daha yüksek miktarlarda üretmek için seçili iken eş transfections, virüs amplifikasyon ve plak deneyleri Sf9 hücreleri üzerinde yapılmaktadır. Hi5 hücreleri mutasyona uğramış virüs üretmek için onların eğilimi nedeniyle üretimi ve virüs ettiklerinizden amplifikasyon için uygun değildir fazlalaştı. Geleneksel olarak, 25-30 ° C sıcaklık aralığı böcek hücreleri ekimi için iyi olarak kabul edilir. Ancak, 27-28 ° C en uygun sıcaklık böcek hücre büyüme ve enfeksiyon7,için8olduğu bildirilmiştir.
Giriş Gen önceki bir güçlü sinyal sırasında salgılanan proteinler yüksek ifade için gereklidir. Sinyal sıra verimli bir şekilde çevrilmiş Rekombinant protein endoplazmik retikulum protein salgılanması ve translasyonel modifikasyonlar uygun katlama ve sabitleme3için gerekli için deliklere. Protein GP64/67, bal arısı melittin ve diğerleri, baculovirus örtmek gibi sinyal peptid dizileri, baculovirus-aracılı ifade sistemleri3salgı rekombinant proteinlerin ifadesi kolaylaştırmak için seçildi. GP67 sinyal peptid getirilmesi ile karşılaştırıldığında içsel sinyal peptid hedef gen9kullanarak salgılanan bir Rekombinant protein, ifade verimini artırmak için gösterilmiştir. Hemolin bir bakteri enfeksiyonu10indüklenen dev ipek güve Hyalophora cecropia, hemolymph proteindir. İndüklenen ifade nispeten yüksek seviyede nedeniyle, gen sinyal peptid dizisi rekombinant proteinlerin salgılanmasını ifade baculovirus-böcek hücre sisteminde arabuluculuk için kullanılabilir.
A. thaliana Tracheary öğesi farklılaşma inhibitör faktör reseptör (TDR) ve polen reseptör kinaz her ikisi de proteinler11,12 bitki lösin yönünden zengin tekrar reseptör benzeri kinaz (LRR-RLK) ailesine ait 3 (PRK3) . Yapısı ve fonksiyonu, bu ailenin diğer bitki salgılanan proteinler yapısal ve biyokimyasal karakterizasyonu kolaylaştırmak için bitki reseptör protein, de eğitim için baculovirus-böcek hücre ifade sistem için değiştirildi protein verim kalitesi ve üretim geliştirmek. Ekstrasellüler etki alanları TDR ve PRK3 başarıyla baculovirus-böcek hücre ifade sisteminde iki değiştirilmiş ifade vektörel çizimler kullanarak ifade edilmiştir. Her iki ekstrasellüler etki alanı TDR ve PRK3 proteinlerin kristalize. Ya bir GP67 ya da hemolin sinyal dizisi düzenleyici ve birden çok klonlama arasında dahil ederek ifade ve arıtma rekombinant salgılanan bitki proteinleri iki değiştirilmiş baculovirus ifade vektörel çizimler ile büyük miktarda Bu makale raporları siteleri.

<table>
	<tbody>
		<tr>
			<td>Incubator shaker</td>
			<td>VWR</td>
			<td>Model Excella E25</td>
			<td>27 oC</td>
		</tr>
		<tr>
			<td>Incubator</td>
			<td>VWR</td>
			<td>Model 2005</td>
			<td>27 oC</td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>BECKMAN</td>
			<td>Model J-6</td>
			<td>with a swing bucket rotor</td>
		</tr>
		<tr>
			<td>Herculase II Fusion DNA Polymerase</td>
			<td>Agilent</td>
			<td>600677-51</td>
			<td>For PCR amplification of DNA</td>
		</tr>
		<tr>
			<td>Thermal Cycler</td>
			<td>BIO-RAD</td>
			<td>Model C1000 Touch</td>
			<td>For PCR amplification of DNA</td>
		</tr>
		<tr>
			<td>Incubator shaker</td>
			<td>New Brunswick Scientific</td>
			<td>Model I 24</td>
			<td>For growing baceria culture</td>
		</tr>
		<tr>
			<td>Customer DNA synthesis</td>
			<td>GENSCRIPT</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>BamHI (HF)</td>
			<td>New England Biolabs</td>
			<td>R3136S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>BglII</td>
			<td>New England Biolabs</td>
			<td>R0144S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>NotI (HF)</td>
			<td>New England Biolabs</td>
			<td>R3189S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>XhoI</td>
			<td>New England Biolabs</td>
			<td>R0146S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>New England Biolabs</td>
			<td>M0202T</td>
			<td>DNA ligation</td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction Kit</td>
			<td>Qiagen</td>
			<td>28704</td>
			<td>DNA purification from Agorase gel</td>
		</tr>
		<tr>
			<td>QIAprep Spin Miniprep Kit</td>
			<td>Qiagen</td>
			<td>27104</td>
			<td>Plasmid DNA purification from bacteria culture</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Thermo Fisher Scientific</td>
			<td>15510-019</td>
			<td>For DNA gel electropherosis</td>
		</tr>
		<tr>
			<td>MAX Efficiency DH5&#945; competen cell</td>
			<td>Invitrogen</td>
			<td>18-258-012</td>
			<td>For transformation of DNA ligation mixture</td>
		</tr>
		<tr>
			<td>Lennox L LB Broth</td>
			<td>Research Product International Corp.</td>
			<td>L24066-5000.0</td>
			<td>For making bacteria culture</td>
		</tr>
		<tr>
			<td>Ampicillin sodium salt</td>
			<td>Thermo Fisher Scientific</td>
			<td>11593-019</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Kanamycin Sulfate</td>
			<td>Thermo Fisher Scientific</td>
			<td>15160-054</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Tetracycline</td>
			<td>Thermo Fisher Scientific</td>
			<td>64-75-5</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Gentamicin</td>
			<td>Thermo Fisher Scientific</td>
			<td>15710-064</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>MAX Efficiency DH10Bac competent cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>10361-012</td>
			<td>For making bacmid DNA</td>
		</tr>
		<tr>
			<td>S.O.C. Medium</td>
			<td>Thermo Fisher Scientific</td>
			<td>15544-034</td>
			<td>For DNA transformation</td>
		</tr>
		<tr>
			<td>CellFECTIN II Reagent</td>
			<td>Thermo Fisher Scientific</td>
			<td>10362-101</td>
			<td>Insect cell transfection reagent</td>
		</tr>
		<tr>
			<td>Bac-to-Bac Expression System</td>
			<td>Thermo Fisher Scientific</td>
			<td>10359-016</td>
			<td>Baculovirus-insect cells expression kit</td>
		</tr>
		<tr>
			<td>Bluo-gal</td>
			<td>Thermo Fisher Scientific</td>
			<td>15519-028</td>
			<td>For isolation of recominant Bacmid DNA</td>
		</tr>
		<tr>
			<td>IPTG</td>
			<td>Thermo Fisher Scientific</td>
			<td>15529-019</td>
			<td>For isolation of recominant Bacmid DNA</td>
		</tr>
		<tr>
			<td>pFastBac1</td>
			<td>Thermo Fisher Scientific</td>
			<td>10360014</td>
			<td>Baculorirus expression vector</td>
		</tr>
		<tr>
			<td>Sf9 cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>11496015</td>
			<td>Sf9 monolayer cells</td>
		</tr>
		<tr>
			<td>Hi5 cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>B85502</td>
			<td>High Five insect cells</td>
		</tr>
		<tr>
			<td>Grace&#8217;s insect medium, unsupplemented</td>
			<td>Thermo Fisher Scientific</td>
			<td>11595030</td>
			<td>Sf9 cell transfection minimum medium</td>
		</tr>
		<tr>
			<td>Grace&#8217;s insect medium, supplemented</td>
			<td>Thermo Fisher Scientific</td>
			<td>11605102</td>
			<td>Sf9 monolayer cell culture complete medium</td>
		</tr>
		<tr>
			<td>Sf-900 II SFM</td>
			<td>Thermo Fisher Scientific</td>
			<td>10902104</td>
			<td>Sf9 suspension cell culture medium without FBS</td>
		</tr>
		<tr>
			<td>Express Five SFM</td>
			<td>Thermo Fisher Scientific</td>
			<td>10486025</td>
			<td>Hi5 cell culture medium</td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>15140122</td>
			<td>100 ml (10,000 I.U./ml)</td>
		</tr>
		<tr>
			<td>L-Glutamine (200 mM)&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>25030081</td>
			<td>100 ml</td>
		</tr>
		<tr>
			<td>FBS Certified</td>
			<td>Thermo Fisher Scientific</td>
			<td>16000-044</td>
			<td>500 ml</td>
		</tr>
		<tr>
			<td>6-well plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>08-772-1B</td>
			<td>Flat-bottom</td>
		</tr>
		<tr>
			<td>150 mm plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>353025</td>
			<td>100/case</td>
		</tr>
		<tr>
			<td>1.5 ml Microcentrifuge Tubes</td>
			<td>USA Scientific</td>
			<td>1415-2500</td>
			<td>500 tubes/bag</td>
		</tr>
		<tr>
			<td>15 ml conical screw cap centrifuge tubes</td>
			<td>USA Scientific</td>
			<td>1475-0511</td>
			<td>25 tubes/bag</td>
		</tr>
		<tr>
			<td>50 ml conical screw cap centrifuge tubes</td>
			<td>USA Scientific</td>
			<td>1500-1211</td>
			<td>25 tubes/bag</td>
		</tr>
		<tr>
			<td>Ni-NTA Superflow</td>
			<td>Qiagen</td>
			<td>30430</td>
			<td>NiNTA resin</td>
		</tr>
		<tr>
			<td>pH-indicator strips</td>
			<td>EMD Millipore Corporation</td>
			<td>1.09535.0001</td>
			<td>pH 0 - 14</td>
		</tr>
	</tbody>
</table>

modifying baculovirus expression vectors to produce secreted plant proteins in insect cells

Rekombinant salgı ökaryotik proteinler yapısal ve biyokimyasal araştırmalar ifade etmek bilim adamları için bir mücadele vardı. Böcek hücre baculovirus-aracılı ifade sistem rekombinant ökaryotik salgı proteinler bazı translasyonel modifikasyonlar ile ifade etmek için kullanılan sistemlerinden biridir. Salgı proteinler için protein glikozilasyon, disülfür bağları oluşumu ve diğer translasyonel modifikasyonlar salgı yollar aracılığıyla yönlendirilmesi gerekir. Varolan böcek hücre ifade salgı bitki proteinlerin artırmak için bir baculovirus ifade vektör ya bir GP67 eklenmesi ya da bir hemolin sinyal peptid sırası organizatörü ve çoklu klonlama siteleri arasında tarafından değiştirilir. Bu yeni tasarlanmış değiştirilmiş vektör sistemi başarıyla Arabidopsis thalianaçözünür rekombinant salgılanan bitki reseptör proteinler yüksek bir verim üretti. İki ifade bitki proteinleri, Arabidopsis TDR ve PRK3 plazma membran reseptörleri, ekstrasellüler etki x-ışını crystallographic çalışmalar için kristalize. Değiştirilmiş vektör sistemi salgı rekombinant proteinler de hayvan krallığının bir ifade için kullanılabilir gelişmiş bir araçtır.

Şekil 1' de gösterildiği gibi iki değiştirilmiş pFastBac1 baculovirus ifade vektörel çizimler salgılanan proteinler ile GP67 ya da hemolin sinyal sıra hedef gen içsel sinyal sırasını değiştirmek için ifade etmek için kullanılmıştır. Viral GP67 ve böcek hemolin genler hücrelerde yüksek salgı ifade düzeyleri olmasını gösterdi. Füzyon protein ile ikisinden biri bu iki sinyal sıralarının salgı ifade düzeyleri büyük ölçüde ...

Watch this Scientific Journal Video about Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells at JoVE.com

Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

Bitki proteinleri böcek hücrelerinde salgılanan Baculovirus ifade vektörel çizimler oluşturmak için değiştirme

Burada, bitki salgılanan proteinler için protein kristalizasyon büyük miktarlarda üretmek için böcek hücre ve baculovirus protein ifade sistemi kullanan iletişim kurallarını mevcut. Bir baculovirus ifade vektör GP67 ya da böcek hemolin sinyal peptid bitki protein salgılanması ifade böcek hücrelerinde ile değiştirildi.

It has been a challenge for scientists to express recombinant secretory eukaryotic proteins for structural and biochemical studies. The ...

modifying-baculovirus-expression-vectors-to-produce-secreted-plant

Research

JoVE Journal

Biochemistry

11.4K Görüntüleme.  North Carolina State University. Burada, bitki salgılanan proteinler için protein kristalizasyon büyük miktarlarda üretmek için böcek hücre ve baculovirus protein ifade sistemi kullanan iletişim kurallarını mevcut. Bir baculovirus ifade vektör GP67 ya da böcek hemolin sinyal peptid bitki protein salgılanması ifade böcek hücrelerinde ile değiştirildi.

Video: Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug used to treat depression and anxiety by binding to the serotonin transporter with high-affinity, blocking serotonin reuptake. Here we report an efficient procedure and a set of tools to stabilize, express, purify, and crystallize serotonin transporter-antibody complexes bound to S-citalopram and other antidepressants. Mutations which stabilize the serotonin transporter were identified using an S-citalopram binding assay. Serotonin transporter expressed in baculovirus-transduced HEK293S GnTI- cells, was reconstituted into proteoliposomes and used to raise high-affinity antibodies. We have developed a strategy to discover antibodies that are useful for structural studies. A straightforward approach for the expression of antibody fragments in Sf9 cells has also been established. Transporter-antibody complexes purified using this procedure are well-behaved and readily crystallize, producing complexes with S-citalopram that diffract X-rays to 3-4 &#197; resolution. The strategies developed here can be utilized to determine the structure of other challenging membrane proteins.

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

This manuscript describes how to screen for thermostabilizing mutations, purify the human serotonin transporter, generate high affinity antibodies, and crystallize the serotonin transporter-antibody complex bound to the antidepressant drug S-citalopram. This protocol can be adapted to the study of other challenging membrane transporters, receptors, and channels.

Termo, İfade, saflaştırılması, ve İnsan serotonin Transporter Kristalizasyon Bound<em&gt; S</em&gt; -citalopram

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug ...

Biyokimya

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from the oxidation of reduced compounds such as nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FADH2). The complete annotation of the Arabidopsis thaliana genome has established it as the most widely used plant model system, and thus the need to purify mitochondria from a variety of organs (leaf, root, or flower) is necessary to fully utilize the tools that are now available for Arabidopsis to study mitochondrial biology. Mitochondria are isolated by homogenization of the tissue using a variety of approaches, followed by a series of differential centrifugation steps producing a crude mitochondrial pellet that is further purified using continuous colloidal density gradient centrifugation. The colloidal density material is subsequently removed by multiple centrifugation steps. Starting from 100 g of fresh leaf tissue, 2 - 3 mg of mitochondria can be routinely obtained. Respiratory experiments on these mitochondria display typical rates of 100 - 250 nmol O2 min-1 mg total mitochondrial protein-1 (NADH-dependent rate) with the ability to use various substrates and inhibitors to determine which substrates are being oxidized and the capacity of the alternative and cytochrome terminal oxidases. This protocol describes an isolation method of mitochondria from Arabidopsis thaliana leaves using continuous colloidal density gradients and an efficient respiratory measurements of purified plant mitochondria.

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

As mitochondria are only a small percentage of the plant cell, they need to be purified for a range of studies. Mitochondria can be isolated from a variety of plant organs by homogenization, followed by differential and density gradient centrifugation to obtain a highly purified mitochondrial fraction.

Yalıtım ve solunum ölçümleri mitokondri Arabidopsis thaliana üzerinden

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from ...

Caffeine Extraction, Enzymatic Activity and Gene Expression of Caffeine Synthase from Plant Cell Suspensions

Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in popular drinks such as coffee and tea. This secondary metabolite is regarded as a chemical defense because it has antimicrobial activity and is considered a natural insecticide. Caffeine can also produce negative allelopathic effects that prevent the growth of surrounding plants. In addition, people around the world consume caffeine for its analgesic and stimulatory effects. Due to interest in the technological applications of caffeine, research on the biosynthetic pathway of this compound has grown. These studies have primarily focused on understanding the biochemical and molecular mechanisms that regulate the biosynthesis of caffeine. In vitro tissue culture has become a useful system for studying this biosynthetic pathway. This article will describe a step-by-step protocol for the quantification of caffeine and for measuring the transcript levels of the gene (CCS1) encoding caffeine synthase (CS) in cell suspensions of C. arabica L. as well as its activity.

This protocol describes an efficient methodology for the extraction and quantification of caffeine in cell suspensions of C. arabica L. and an experimental process for evaluating the enzymatic activity of caffeine synthase with the expression level of the gene that encodes this enzyme.

Kafein ayıklama, enzimatik aktivite ve kafein Synthase bitki hücre kullanılamaz hale gelen gen ifadesi

Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in popular drinks such as coffee and tea. This secondary metabolite is regarded as a ...

Dissipative Microgravimetry to Study the Binding Dynamics of the Phospholipid Binding Protein Annexin A2 to Solid-supported Lipid Bilayers Using a Quartz Resonator

The dissipative quartz crystal microbalance technique is a simple and label-free approach to measure simultaneously the mass uptake and viscoelastic properties of the absorbed/immobilized mass on sensor surfaces, allowing the measurements of the interaction of proteins with solid-supported surfaces, such as lipid bilayers, in real-time and with a high sensitivity. Annexins are a highly conserved group of phospholipid-binding proteins that interact reversibly with the negatively charged headgroups via the coordination of calcium ions. Here, we describe a protocol that was employed to quantitatively analyze the binding of annexin A2 (AnxA2) to planar lipid bilayers prepared on the surface of a quartz sensor. This protocol is optimized to obtain robust and reproducible data and includes a detailed step-by-step description. The method can be applied to other membrane-binding proteins and bilayer compositions.

Here, we present an experimental protocol that can be employed to determine the binding affinities and mode of interaction of label-free phospholipid-binding protein annexin A2 with immobilized solid-supported bilayers (SLB) by simultaneously measuring the mass uptake and the viscoelastic properties of the protein annexin A2.

A2 bir kuvars rezonatör kullanarak katı destekli Lipid Bilayers için Annexin Protein bağlayıcı fosfolipid bağlama dinamikleri çalışmaya dissipative Microgravimetry

The dissipative quartz crystal microbalance technique is a simple and label-free approach to measure simultaneously the mass uptake and viscoelastic ...

How to Quantify the Fraction of Photoactivated Fluorescent Proteins in Bulk and in Live Cells

Photoactivatable and -convertible fluorescent proteins (PA-FPs) have been used in fluorescence live-cell microscopy for analyzing the dynamics of cells and protein ensembles. Thus far, no method has been available to quantify in bulk and in live cells how many of the PA-FPs expressed are photoactivated to fluoresce.
Here, we present a protocol involving internal rulers, i.e., genetically coupled spectrally distinct (photoactivatable) fluorescent proteins, to ratiometrically quantify the fraction of all PA-FPs expressed in a cell that are switched on to be fluorescent. Using this protocol, we show that different modes of photoactivation yielded different photoactivation efficiencies. Short high-power photoactivation with a confocal laser scanning microscope (CLSM) resulted in up to four times lower photoactivation efficiency than hundreds of low-level exposures applied by CLSM or a short pulse applied by widefield illumination. While the protocol has been exemplified here for (PA-)GFP and (PA-)Cherry, it can in principle be applied to any spectrally distinct photoactivatable or photoconvertible fluorescent protein pair and any experimental set-up.

Here, we present a protocol that involves genetically coupled spectrally distinct photoactivatable and fluorescent proteins. These fluorescent protein chimeras permit quantification of the PA-FP fraction that is photoactivated to be fluorescent, i.e., the photoactivation efficiency. The protocol reveals that different modes of photoactivation yield different photoactivation efficiencies.

Nasıl Photoactivated floresan proteinler toplu olarak ve canlı hücrelerdeki kısmını ölçmek için

Photoactivatable and -convertible fluorescent proteins (PA-FPs) have been used in fluorescence live-cell microscopy for analyzing the dynamics of cells ...

Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological functions. Such interactions can be highly dynamic, meaning the interacting subunits are constantly associated and dissociated at certain rates. While measuring the binding affinity using techniques such as quantitative pull-down reveals the strength of the interaction, studying the binding kinetics provides insights on how fast the interaction occurs and how long each complex can exist. Furthermore, measuring the kinetics of an interaction in the presence of an additional factor, such as a protein exchange factor or a drug, helps reveal the mechanism by which the interaction is regulated by the other factor, providing important knowledge for the advancement of biological and medical research. Here, we describe a protocol for measuring the binding kinetics of a protein complex that has a high intrinsic association rate and can be dissociated quickly by another protein. The method uses fluorescence resonance energy transfer to report the formation of the protein complex in vitro, and it enables monitoring the fast association and dissociation of the complex in real time on a stopped-flow fluorimeter. Using this assay, the association and dissociation rate constants of the protein complex are quantified.

Protein-protein interactions are critical for biological systems, and studies of the binding kinetics provide insights into the dynamics and function of protein complexes. We describe a method that quantifies the kinetic parameters of a protein complex using fluorescence resonance energy transfer and the stopped-flow technique. &#160;

Protein kompleksleri milisaniyelik zaman ölçekte dinamikleri çalışmaya vitro Floresans rezonans enerji transferi içinde kullanma

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological ...

Expression, Purification, Crystallization, and Enzyme Assays of Fumarylacetoacetate Hydrolase Domain-Containing Proteins

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this superfamily generally display multi-functionality, involving mainly hydrolase and decarboxylase mechanisms. This article presents a series of consecutive methods for the expression and purification of FAHD proteins, mainly FAHD protein 1 (FAHD1) orthologues among species (human, mouse, nematodes, plants, etc.). Covered methods are protein expression in E. coli, affinity chromatography, ion exchange chromatography, preparative and analytical gel filtration, crystallization, X-ray diffraction, and photometric assays. Concentrated protein of high levels of purity (&#62;98%) may be employed for crystallization or antibody production. Proteins of similar or lower quality may be employed in enzyme assays or used as antigens in detection systems (Western-Blot, ELISA). In the discussion of this work, the identified enzymatic mechanisms of FAHD1 are outlined to describe its hydrolase and decarboxylase bi-functionality in more detail.

Expression and purification of fumarylacetoacetate hydrolase domain-containing proteins is described with examples (expression in E. coli, FPLC). Purified proteins are used for crystallization and antibody production and employed for enzyme assays. Selected photometric assays are presented to display the multi-functionality of FAHD1 as oxaloacetate decarboxylase and acylpyruvate hydrolase.

Fumarylacetoasetat Hydrolase etki alanı Içeren proteinleri ifade, arıtma, kristalizasyon ve enzim Asdimleri

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this ...

Obtaining High-Quality Transcriptome Data from Cereal Seeds by a Modified Method for Gene Expression Profiling

The characterization of gene expression is dependent on RNA quality. In germinating, developing and mature cereal seeds, the extraction of high-quality RNA is often hindered by high starch and sugar content. These compounds can reduce both the yield and the quality of the extracted total RNA. The deterioration in quantity and quality of total RNA can subsequently have a significant impact on the downstream transcriptomic analyses, which may not accurately reflect the spatial and/or temporal variation in the gene expression profile of the samples being tested. In this protocol, we describe an optimized method for extraction of total RNA with sufficient quantity and quality to be used for whole transcriptome analysis of cereal grains. The described method is suitable for several downstream applications used for transcriptomic profiling of developing, germinating, and mature cereal seeds. The method of transcriptome profiling using a microarray platform is shown. This method is specifically designed for gene expression profiling of cereals with described genome sequences. The detailed procedure from microarray handling to final quality control is described. This includes cDNA synthesis, cRNA labelling, microarray hybridization, slide scanning, feature extraction, and data quality validation. The data generated by this method can be used to characterize the transcriptome of cereals during germination, in various stages of grain development, or at different biotic or abiotic stress conditions. The results presented here exemplify high-quality transcriptome data amenable for downstream bioinformatics analyses, such as the determination of differentially expressed genes (DEGs), characterisation of gene regulatory networks, and conducting transcriptome-wide association study (TWAS).

A method for transcriptome profiling of cereals is presented. The microarray-based gene expression profiling starts with the isolation of high-quality total RNA from cereal grains and continues with the generation of cDNA. After cRNA labelling and microarray hybridization, recommendations are given for signal detection and quality control.

Gen Ekspresyonu Profilleme için Modifiye Yöntemi ile Tahıl Tohumlarından Yüksek Kaliteli Transkripsiyon Verilerinin Elde Edilmesi

The characterization of gene expression is dependent on RNA quality. In germinating, developing and mature cereal seeds, the extraction of high-quality ...

Transverse Sectioning of Mature Rice (Oryza sativa L.) Kernels for Scanning Electron Microscopy Imaging Using Pipette Tips as Immobilization Support

Starch granules (SGs) exhibit different morphologies depending on the plant species, especially in the endosperm of the Poaceae family. Endosperm phenotyping can be used to classify genotypes based on SG morphotype using scanning electron microscopic (SEM) analysis. SGs can be visualized using SEM by slicing through the kernel (pericarp, aleurone layers, and endosperm) and exposing the organellar contents. Current methods require the rice kernel to be embedded in plastic resin and sectioned using a microtome or embedded in a truncated pipette tip and sectioned by hand using a razor blade. The former method requires specialized equipment and is time-consuming, while the latter introduces a new host of problems depending on rice genotype. Chalky rice varieties, particularly, pose a problem for this type of sectioning due to the friable nature of their endosperm tissue. Presented here is a technique for preparing translucent and chalky rice kernel sections for microscopy, requiring only pipette tips and a scalpel blade. Preparing the sections within the confines of a pipette tip prevents rice kernel endosperm from shattering (for translucent or &#8216;vitreous&#8217; phenotypes) and crumbling (for chalky phenotypes). Using this technique, endosperm cell patterning and the structure of intact SGs can be observed.

Transverse Sectioning of Mature Rice Oryza sativa L. Kernels for Scanning Electron Microscopy Imaging Using Pipette Tips as Immobilization Support

This protocol allows for the preparation of transverse sections of cereal seeds (e.g., rice) for the analysis of endosperm and starch granule morphology using scanning electron microscopy.

Olgun Pirincin Enine Kesiti (Oryza sativa L.) Hareketsizleştirme Desteği Olarak Pipet İpuçlarını Kullanarak Elektron Mikroskopi Görüntülemesini Taramak için Çekirdekler

Starch granules (SGs) exhibit different morphologies depending on the plant species, especially in the endosperm of the Poaceae family. Endosperm ...

Phosphoproteomic Strategy for Profiling Osmotic Stress Signaling in Arabidopsis

Protein phosphorylation is crucial for the regulation of enzyme activity and gene expression under osmotic condition. Mass spectrometry (MS)-based phosphoproteomics has transformed the way of studying plant signal transduction. However, requirement of lots of starting materials and prolonged MS measurement time to achieve the depth of coverage has been the limiting factor for the high throughput study of global phosphoproteomic changes in plants. To improve the sensitivity and throughput of plant phosphoproteomics, we have developed a stop and go extraction (stage) tip based phosphoproteomics approach coupled with Tandem Mass Tag (TMT) labeling for the rapid and comprehensive analysis of plant phosphorylation perturbation in response to osmotic stress. Leveraging the simplicity and high throughput of stage tip technique, the whole procedure takes approximately one hour using two tips to finish phosphopeptide enrichment, fractionation, and sample cleaning steps, suggesting an easy-to-use and high efficiency of the approach. This approach not only provides an in-depth plant phosphoproteomics analysis (&#62; 11,000 phosphopeptide identification) but also demonstrates the superior separation efficiency (&#60; 5% overlap) between adjacent fractions. Further, multiplexing has been achieved using TMT labeling to quantify the phosphoproteomic changes of wild-type and snrk2 decuple mutant plants. This approach has successfully been used to reveal the phosphorylation events of Raf-like kinases in response to osmotic stress, which sheds light on the understanding of early osmotic signaling in land plants.

Phosphoproteomic Strategy for Profiling Osmotic Stress Signaling in Arabidopsis

Presented here is a phosphoproteomic approach, namely stop and go extraction tip based phosphoproteomic, which provides high-throughput and deep coverage of Arabidopsis phosphoproteome. This approach delineates the overview of osmotic stress signaling in Arabidopsis.

Bitki proteinleri böcek hücrelerinde salgılanan Baculovirus ifade vektörel çizimler oluşturmak için değiştirme

PLAYLIST