Name: rna interference in ticks
Uploaded: 2011-01-20T19:00:00
Duration: 9 min 6 s
Description: Watch this Scientific Journal Video about RNA Interference in Ticks at JoVE.com

نشكر أعضاء مختبراتنا لإجراء مناقشات مثمرة والمساعدة التقنية. وقد أيد هذا العرض الفيديو من قبل العميد المشارك للأبحاث وإدارة البيولوجيا المرضية البيطرية ، ومركز للعلوم الصحية البيطرية ، جامعة ولاية أوكلاهوما. هبوا لر التر Sitlington تم تمويل البحث من قبل دي MINISTERIO Innovación ه Ciencia ، إسبانيا (BFU2008-01244/BMC المشروع) ، ومشروع CSIC جماعية لPA1002451 JF ، رئيسة للبحوث الحيوانية الغذائية إلى KMK ، CVHS 2009 RAC المنحة ، OAES صناديق صحة الحيوانية وزارة الزراعة ، وطني المنحة مبادرة البحوث التنافسية ، رقم 2007-04613.

1. جيل من الرنا المزدوج الجديلة. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> توليف الاشعال قليل النوكليوتيد تحتوي على تسلسل T7 مروج للالنسخ في المختبر وتوليف الرنا المزدوج الجديلة (على سبيل المثال ، لاستخدام ناخس variabilis subolesin الاشعال قليل النوكليوتيد D8AAT75 : 5&#39; - TAATACGACTCACTATAGGGTACTGACTGGGATCCCCTGCACAGT - 3 &quot;و D8DVT73 : 5&#39; - TAATACGACTCACTATAGGGTACTCGAGCTTGGTGGAAAGGACG - 3&#39;). </li><li style=";text-align:right;direction:rtl"> تضخيم الجين الهدف بواسطة RT - PCR باستخدام 10 بمول كل التمهيدي قليل النوكليوتيد و10-10 نانوغرام من الحمض النووي الريبي مجموع القراد. </li><li style=";text-align:right;direction:rtl"> تنقية المنتج PCR. </li><li style=";text-align:right;direction:rtl"> توليف الرنا المزدوج الجديلة باستخدام 8 ميكرولتر للمنتج PCR المنقى. </li><li style=";text-align:right;direction:rtl"> قياس الطيف بواسطة الرنا المزدوج الجديلة. </li></ol> 2. القراد مع حقن الرنا المزدوج الجديلة. 2.1. إعداد القراد عن طريق الحقن. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> أولا ، اغسل القراد في سلسلة من الحلول التي تهز لهم في كل حل في أنبوب الطرد المركزي المتاح 50 مل ، الصب الحل من خلال شاشة سلكية غرامة على أعلى أنبوب للاحتفاظ القراد. تسلسل الحلول لالقراد غسل ماء الصنبور ، و 3 ٪ فوق أكسيد الهيدروجين ، واثنين من يغسل الماء المقطر ، والإيثانول 70 ٪ واثنين اخرين من يغسل بالماء المقطر. </li><li style=";text-align:right;direction:rtl"> وصمة عار الجافة القراد على مناشف ورقية. </li><li style=";text-align:right;direction:rtl"> عد القراد في مجموعات من 20 إلى 50 ، وهذا يتوقف على التجربة ، ومكان القراد من كل مجموعة في كوب من البلاستيك 1.25 أوقية مع غطاء محكم تركيبها والتسمية مع عدد المجموعة التجريبية. </li></ol> 2.2. قراد فريق الحقن. رني فريق يتكون من ثلاثة أشخاص : (1) شخص واحد كل المناصب علامة على شريط لاصق مزدوج الملصقة على ورقة من الشمع الأحمر الأسنان ، (2) شخص واحد يضخ القراد و (3) شخص واحد يشرف على بعد القراد الحقن ، ويتنفس CO 2 على القراد لتفعيلها وبحساب القراد يعيشون في الكؤوس المسمى مع عدد المجموعة التجريبية. يجب على جميع أعضاء الفريق ارتداء قفازات المتاح. 2.3. وضع علامات التجزئة للحقن. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> التقاط القراد باستخدام الملقط دومون الجميلة وضعه الجانب البطني حتى على شريط لاصق مزدوج اضافته على ورقة 3 &quot;× 6&quot; من الشمع الأحمر الأسنان. يتم وضع عن كثب القراد معا في مجموعات من 5 القراد. </li><li style=";text-align:right;direction:rtl"> وضع شريط صغير من الشريط اللاصق على فمها لجميع القراد 5 من أجل كبح جماح المزيد منها ولكن مع ترك معظم الجسم يتعرض بحيث يمكن ملاحظة عملية الحقن التي حاقن القراد (الشكل 1). </li></ol> 2.4. حقن القراد. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> وسيتم حقن القراد في الربع السفلي الأيمن من السطح البطني من الهيكل الخارجي. </li><li style=";text-align:right;direction:rtl"> أولا ، بيرس ثقب في الهيكل الخارجي باستخدام حقنة الانسولين Monoject مزودة ½ &quot;، 29 إبرة قياس (الشكل 2A). </li><li style=";text-align:right;direction:rtl"> حقن القراد مباشرة مع 0،2-0،5 ميكرولتر من محلول الرنا المزدوج الجديلة (5 × 10 حتي 05 أكتوبر 11 × 10 الجزيئات في ميكرولتر) باستخدام حقنة مخصصة هاميلتون الصنع يبلغ 1 بوصة ، و 33 إبرة قياس نقطة مع 45 درجة مشطوف (الشكل 2B) . ينبغي أن توضع الإبرة جيدا في تجويف القراد لضمان التنسيب والإبقاء على الرنا المزدوج الجديلة. بعض السوائل من المرجح أن يتخلصوا من موقع الحقن (الشكل 2C). وينبغي الحرص على عدم ضخ أكثر من القراد والتي من شأنها أن تسبب فقدان الدملمف ويمكن أن يسبب وفاة القراد. </li><li style=";text-align:right;direction:rtl"> تنظيف حقنة هاميلتون بعد الانتهاء من الحقن في كل مجموعة تجريبية. قبل استخدام لمجموعة أخرى تجريبية. ملء الحقنة الأولى من دورق يحتوي على 3 ٪ فوق أكسيد الهيدروجين ثم طرد في حاوية النفايات ، وكرر 15 مرة. ملء الحقنة التي تحتوي على كوب من الماء المعقم ، ثم طرد في حاوية النفايات ، وكرر 15 مرة. الحرص على عدم ثني المكبس من المحاقن هاملتون ، لأنه إذا عازمة ، الغطاس لن تتحرك بسلاسة ، والاستجابة لمسة رقيقة المطلوبة للحقن من القراد. </li></ol> 2.5. علاج القراد بعد الحقن. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> يلتقط القراد حقنه مباشرة من الشريط لزجة مع مضاعفة الغرامة ملقط ووضعها في وعاء من البلاستيك الانتعاش (حوالي 6 &quot;× 6&quot; وتحيط بشريط لمنع هروب القراد). سوف تكون خاملة لفترة وجيزة القراد بعد الحقن ولكن ينبغي أن تبدأ قريبا في الزحف نحو الصحن. </li><li style=";text-align:right;direction:rtl"> CO 2 على التنفس القراد مباشرة بعد وضعها في حاوية للمساعدة في الانتعاش تنشيط القراد. بمجرد أن يتم الزحف القراد ونشطة ، وسوف يشفي الجرح الحقن بسرعة وسوف البقاء على قيد الحياة على الأرجح. </li><li style=";text-align:right;direction:rtl"> عد القراد وفقا لعدد في كل مجموعة تجريبية وضعها في كوب من البلاستيك المسمى مزودة بغطاء محكم. ينبغي حقن القراد استبدال لاستبدال أي أن أي توفي قبل حقن المجموعة التالية التجريبية. </li></ol> 2.6. قراد القابضة. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> مكان القراد في غرفة الرطوبة (12hr النور : 12 ساعة في الإضاءة الداكنة 22-25 درجة مئوية ، ونسبة 95 ٪ حumidity) وعقد لمدة 1 يوم. </li><li style=";text-align:right;direction:rtl"> القراد في مكان القراد تغذية الخلايا ، واحد في المجموعة التجريبية ، لصقها على الأغنام ، والسماح لهم بأن يغذ مع عدد متساو من uninjected القراد ذكرا أو أنثى (أيهما الجنس لم يكن حقن). الإناث القراد التي تتغذى على امتلاء ، وانخفضت تلك التي يتم إزالتها من الأغنام بعد 10 يوما من التغذية أو عند الإناث مراقبة قبالة المضيفة يتم جمعها وزنه. </li><li style=";text-align:right;direction:rtl"> مكان القراد في كرتون ، وعقد في غرفة الرطوبة حتى الانتهاء من oviposition. تقييم oviposition بواسطة الترجيح كتلة البيض التي تنتجها جميع القراد في المجموعة. </li></ol> 2.7. تحليل النمط الظاهري التجزئة بعد رني. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تقييم وضع علامة النمط الظاهري بعد الرضاعة من خلال تحديد عدد من القراد التي نجت ، والوزن القراد ، والخصوبة oviposition البيض. ومع ذلك ، قد يتم تنفيذ تحليلات أخرى اعتمادا على الجينات المستهدفة وأهداف الدراسة. </li></ol> 3. تحليل لتأكيد إسكات الجينات التي كتبها RT - PCR. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تشريح الغدد اللعابية والشجاعة من القراد فردية من مجموعات المراقبة حقن حقن الرنا المزدوج الجديلة وبعد والتغذية. </li><li style=";text-align:right;direction:rtl"> استخراج الحمض النووي الريبي مجموع من عينات الأنسجة الفردية. </li><li style=";text-align:right;direction:rtl"> تحليل النصوص الجينات المستهدفة في الأنسجة الفردية في الوقت الحقيقي RT - PCR وتطبيع مستويات الحمض النووي الريبي لمكافحة القراد 16S الرنا الريباسي باستخدام الأسلوب genNorm (أسلوب ddCT كما تنفذها بيو راد iQ5 الإصدار القياسي ، الإصدار 2.0). </li><li style=";text-align:right;direction:rtl"> تشغيل منحنيات التفكك في نهاية رد فعل لضمان تشكيل واحد فقط amplicon وأن تفسد amplicons باستمرار في نطاق نفس درجة الحرارة عن كل عينة. </li><li style=";text-align:right;direction:rtl"> مقارنة مستويات مرنا (تطبيع القيم CT) بين السيطرة وحقن الرنا المزدوج الجديلة حقن القراد باستخدام طالبة سيصدره اختبار t (P = 0.05). </li></ol> 4. ممثل النتائج : وصف بروتوكول وقد استخدمت هنا في المختبر لدينا [رني في العديد من الأنواع المختلفة القراد ixodid (الجدول 1). كمية الرنا المزدوج الجديلة حقنها في القراد يتفاوت مع حجم القراد ؛ الأنواع أكبر التجزئة يمكن أن تستوعب حجم أكبر. ينبغي حقن القراد السيطرة السلبية مع الرنا المزدوج الجديلة غير ذات صلة. ويمكن استخدام dsRNAs عدة مثل subolesin 14-19،22-25،27-32،34 وبيتا أكتين 20،21 والضوابط الإيجابية. علما أنه من المهم أن تغسل الحقنة بين العلاجات لتجنب الخلط حلول الرنا المزدوج الجديلة. إذا لم يفعل البروتوكول بشكل صحيح ، يجب الحصول على أقل من 5 ٪ من وفيات إجراء الحقن بعد 24 ساعة. ويرد النمط الظاهري نموذجي بعد ضربة قاضية الجينات في القراد في الشكل 3 مع فريق من القراد حقنوا برك من الرنا المزدوج الجديلة من أجل وضع علامة الشاشة لمستضدات الواقية. <table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> قراد الأنواع </td><td> حقن الرنا المزدوج الجديلة </td><td> المراجع </td></tr><tr><td> اللبود الكتفي </td><td> [كدنا] مكتبة ، subolesin ، أكتين ، nucleotidase ، NF - KB ، akirin </td><td> 21 ، 22 ، 29 ، 30 </td></tr><tr><td> ناخس variabilis </td><td> subolesin ، GST ، اليوبيكويتين ، vATPase ، selenoproteins M وW2A ، الجذعية المكونة للدم / السلف خلايا البروتين مثل الوحيدات 26S أكتين Proteasome ، ferritin1 ، varisin ، akirin </td><td> 15 ، 19 ، 22 ، 24 ، 26 ، 30-32 </td></tr><tr><td> ناخس الجلد الهامشي </td><td> subolesin </td><td> 22 </td></tr><tr><td> اليغموش الأمريكي </td><td> [كدنا] مكتبة ، subolesin ، akirin </td><td> 17 ، 22 ، 30 </td></tr><tr><td> اليغموش الهبراوي </td><td> subolesin ، voraxin </td><td> 28 </td></tr><tr><td> مروحية الرأس الدموية </td><td> Rs86 ، subolesin </td><td> 22 ، 23 </td></tr><tr><td> مروحية الرأس المتثني </td><td> GST ، اليوبيكويتين ، selenoprotein ، Bm86 ، Bm91 ، subolesin ومعهد جوته ، GIII ، EF1a ، سوطي الشكل بروتين الحرير ، وفون ويلبراند عامل </td><td> 16 ، 18 ، 25 ، 27 </td></tr><tr><td> مروحية الرأس الحلقي </td><td> اليوبيكويتين ، subolesin ، EF1a ، GIII </td><td> 16 </td></tr></tbody></table> الجدول 1. القراد الأنواع التي تم فيها استخدام بروتوكول رني. <img src="/files/ftp_upload/2474/2474fig1.jpg" alt="الشكل 1" /> الشكل 1. تنسيب القراد ، حتى الجانب البطني ، على شريط لاصق مزدوج انضمت إلى ورقة من الشمع الأحمر الأسنان. توضع القراد في مجموعات من 5 ، وبعد ذلك يتم وضع شريط صغير من الشريط اللاصق على فمها من أجل تأمين مزيد من القراد بينما يسمح للحاقن لمراقبة الجسم من خلال وضع علامة الحقن. <img src="/files/ftp_upload/2474/2474fig2.jpg" alt="الشكل 2" /> الشكل 2. الإجراء يتضمن حقن (أ) ثقب السفلي رباعي اليمنى من الهيكل الخارجي القراد مع سي الأنسولينringe مزودة إبرة قياس 29 من أجل إنشاء موقع الحقن ، (ب) الحقن المباشر للالرنا المزدوج الجديلة في هذا الموقع باستخدام حقنة هاميلتون مع إبرة قياس 33 منها (ج) على الأرجح سوف يؤدي إلى تسرب بعض الدملمف قراد / السوائل. <img src="/files/ftp_upload/2474/2474fig3.jpg" alt="الشكل 3" /> الشكل 3. لجنة من ست مجموعات التجزئة التي كانت تستخدم للكشف عن رني مستضدات القراد واقية في americanum اليغموش. ويمكن رؤية التغييرات في القراد المظهري بالمقارنة مع مراقبة إيجابية رني subolesin والسيطرة السلبية الرنا المزدوج الجديلة غير ذات صلة. في هذه التجربة تم تحليلها إحصائيا تأثير على وفيات رني القراد ، والأوزان ، وoviposition من كل مجموعة.

<ol>
	<li>de la Fuente, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overview:+Ticks+as+vectors+of+pathogens+that+cause+disease+in+humans+and+animals.">Overview: Ticks as vectors of pathogens that cause disease in humans and animals.</a> Front. Biosci. 13, 6938-6946 (2008).</li><li>Peter, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mosquito+control-Lessons+from+the+past,+solutions+for+the+future.">mosquito control-Lessons from the past, solutions for the future.</a> Vet. Parasitol. 132, 205-215 (2005).</li><li>Barker, S. C., Murrell, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematics+and+evolution+of+ticks+with+a+list+of+valid+genus+and+species+names.">Systematics and evolution of ticks with a list of valid genus and species names.</a> Parasitol. 129, S15-S36 (2004).</li><li>Willadsen, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tick+control:+Thoughts+on+a+research+agenda.">Tick control: Thoughts on a research agenda.</a> Vet. Parasitol. 138, 161-168 (2006).</li><li>de la Fuente, J., Kocan, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+development+of+vaccines+for+control+of+ixodid+tick+species.">Strategies for development of vaccines for control of ixodid tick species.</a> Parasite Immunol. 28, 275-283 (2006).</li><li>Fire, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 391, 806-811 (1998).</li><li>Cerutti, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference:+traveling+in+the+cell+and+gaining+functions.">RNA interference: traveling in the cell and gaining functions.</a> Trends Genet. 19, 39-46 (2003).</li><li>Kavi, H. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+silencing+in+Drosophila.">RNA silencing in Drosophila.</a> FEBS Lett. 579, 5940-5949 (2005).</li><li>Mello, C. C., Conte, D. J. r. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Revealing+the+world+of+RNA+interference.">Revealing the world of RNA interference.</a> Nature. 431, 338-342 (2004).</li><li>Zhou, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference+and+potential+applications.">RNA interference and potential applications.</a> Curr. Top. Med. Chem. 6, 901-911 (2006).</li><li>Ramakrishnan, V. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+RNA+interference+in+tick+salivary+gland+research.">Application of RNA interference in tick salivary gland research.</a> J. Biomol. Tech. 16, 297-305 (2005).</li><li>Aljamali, M. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference:+applicability+in+tick+research.">RNA interference: applicability in tick research.</a> Exp. Appl. Acarol. 28, 89-96 (2002).</li><li>Aljamali, M. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference+in+ticks:+a+study+using+histamine+binding+protein+dsRNA+in+the+female+tick+Amblyomma+americanum.">RNA interference in ticks: a study using histamine binding protein dsRNA in the female tick Amblyomma americanum.</a> Insect. Mol. Biol. 12, 299-305 (2003).</li><li>de la Fuente, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference+for+the+study+and+genetic+manipulation+of+ticks.">RNA interference for the study and genetic manipulation of ticks.</a> Trends Parasitol. 23, 427-433 (2007).</li><li>de la Fuente, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genomic+studies+of+tick+cells+in+response+to+infection+with+the+cattle+pathogen,+Anaplasma+marginale.">Functional genomic studies of tick cells in response to infection with the cattle pathogen, Anaplasma marginale.</a> Genomics. 90, 712-722 (2007).</li><li>Almaz&#228;N, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+Rhipicephalus+(Boophilus)+microplus+candidate+protective+antigens+for+the+control+of+cattle+tick+infestations.">Identification and characterization of Rhipicephalus (Boophilus) microplus candidate protective antigens for the control of cattle tick infestations.</a> Parasitol. Res. 106, 471-479 (2010).</li><li>de la Fuente, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+protective+antigens+by+RNA+interference+for+control+of+the+lone+star+tick,+Amblyomma+americanum.">Identification of protective antigens by RNA interference for control of the lone star tick, Amblyomma americanum.</a> Vaccine. 28, 1786-1795 (2010).</li><li>Zivkovic, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+expression+of+genes+in+salivary+glands+of+male+Rhipicephalus+(Boophilus)+microplus+in+response+to+infection+with+Anaplasma+marginale.">Differential expression of genes in salivary glands of male Rhipicephalus (Boophilus) microplus in response to infection with Anaplasma marginale.</a> BMC Genomics. 11, 186-186 (2010).</li><li>de la Fuente, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reduction+of+tick+infections+with+Anaplasma+marginale+and+A.+phagocytophilum+by+targeting+the+tick+protective+antigen+subolesin.">Reduction of tick infections with Anaplasma marginale and A. phagocytophilum by targeting the tick protective antigen subolesin.</a> Parasitol. Res. 100, 85-91 (2006).</li><li>Narasimhan, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disruption+of+Ixodes+scapularis+anticoagulation+by+using+RNA+interference.">Disruption of Ixodes scapularis anticoagulation by using RNA interference.</a> Proc. Natl. Acad. Sci U.S.A. 101, 1141-1146 (2004).</li><li>de la Fuente, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference+screening+in+ticks+for+identification+of+protective+antigens.">RNA interference screening in ticks for identification of protective antigens.</a> Parasitol. Res. 96, 137-141 (2005).</li><li>de la Fuente, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+tick+protective+antigen,+4D8,+is+a+conserved+protein+involved+in+modulation+of+tick+blood+ingestion+and+reproduction.">The tick protective antigen, 4D8, is a conserved protein involved in modulation of tick blood ingestion and reproduction.</a> Vaccine. 24, 4082-4095 (2006).</li><li>de la Fuente, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synergistic+effect+of+silencing+the+expression+of+tick+protective+antigens+4D8+and+Rs86+in+Rhipicephalus+sanguineus+by+RNA+interference.">Synergistic effect of silencing the expression of tick protective antigens 4D8 and Rs86 in Rhipicephalus sanguineus by RNA interference.</a> Parasitol. Res. 99, 108-113 (2006).</li><li>de la Fuente, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autocidal+control+of+ticks+by+silencing+of+a+single+gene+by+RNA+interference.">Autocidal control of ticks by silencing of a single gene by RNA interference.</a> Biochem. Biophys. Res. Commun. 344, 332-338 (2006).</li><li>Nijhof, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bm86,+Bm91+and+subolesin,+in+the+silencing+of+the+tick+protective+antigens.">Bm86, Bm91 and subolesin, in the silencing of the tick protective antigens.</a> Int. J. Parasitol. 37, 653-662 (2007).</li><li>Kocan, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+the+defensin,+varisin,+in+male+Dermacentor+variabilis+by+RNA+interference+results+in+reduced+Anaplasma+marginale+infections.">Silencing of the defensin, varisin, in male Dermacentor variabilis by RNA interference results in reduced Anaplasma marginale infections.</a> Exp. Appl. Acarol. 46, 17-28 (2008).</li><li>de la Fuente, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+of+the+role+of+tick+subolesin+in+gene+expression.">Evidence of the role of tick subolesin in gene expression.</a> BMC Genomics. 9, 372-372 (2008).</li><li>Smith, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+impact+of+RNA+interference+of+the+subolesin+and+voraxin+genes+in+male+Amblyomma+hebraeum+(Acari:+Ixodidae)+on+female+engorgement+and+oviposition.">The impact of RNA interference of the subolesin and voraxin genes in male Amblyomma hebraeum (Acari: Ixodidae) on female engorgement and oviposition.</a> Exp. Appl. Acarol. 47, 71-86 (2009).</li><li>Galindo, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tick+subolesin+is+an+ortholog+of+the+akirins+described+in+insects+and+vertebrates.">Tick subolesin is an ortholog of the akirins described in insects and vertebrates.</a> Dev. Comp. Immunol. 33, 612-617 (2009).</li><li>Canales, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conservation+and+immunogenicity+of+the+mosquito+ortholog+of+the+tick+protective+antigen,+subolesin.">Conservation and immunogenicity of the mosquito ortholog of the tick protective antigen, subolesin.</a> Parasitol. Res. 105, 97-111 (2009).</li><li>Kocan, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+genes+involved+in+Anaplasma+marginale-tick+interactions+affects+the+pathogen+developmental+cycle+in+Dermacentor+variabilis.">Silencing of genes involved in Anaplasma marginale-tick interactions affects the pathogen developmental cycle in Dermacentor variabilis.</a> BMC Dev. Biol. 9, 42-42 (2009).</li><li>Zivkovic, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subolesin+expression+in+response+to+pathogen+infection+in+ticks.">Subolesin expression in response to pathogen infection in ticks.</a> BMC Immunol. 11, 7-7 (2010).</li><li>Karim, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genomics+tool:+gene+silencing+in+Ixodes+scapularis+eggs+and+nymphs+by+electroporated+dsRNA.">Functional genomics tool: gene silencing in Ixodes scapularis eggs and nymphs by electroporated dsRNA.</a> BMC Biotechnol. 10, 1-1 (2010).</li><li>Kocan, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transovarial+silencing+of+the+subolesin+gene+in+three-host+ixodid+tick+species+after+injection+of+replete+females+with+subolesin+dsRNA.">Transovarial silencing of the subolesin gene in three-host ixodid tick species after injection of replete females with subolesin dsRNA.</a> Parasitol. Res. 100, 1411-1415 (2007).</li><li>de la Fuente, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+the+tick-pathogen+interface+for+novel+control+strategies.">Targeting the tick-pathogen interface for novel control strategies.</a> Front. Biosci. 13, 6947-6956 (2008).</li><li>Kurscheid, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+of+a+tick+RNAi+pathway+by+comparative+genomics+and+reverse+genetics+screen+of+targets+with+known+loss-of-function+phenotypes+in+Drosophila.">Evidence of a tick RNAi pathway by comparative genomics and reverse genetics screen of targets with known loss-of-function phenotypes in Drosophila.</a> BMC Mol. Biol. 10, 26-26 (2009).</li></ol>

الإعلان عن أي تضارب في المصالح.

على الرغم من أن وصفت وسائل أخرى لرني القراد في 14 و 33 ، وصفت حقن الرنا المزدوج الجديلة هنا هو الأكثر استخداما على نطاق واسع في كل من غير مغذى (الجدول 1) وتغذى القراد 16،25،34. وقد تبين رني أن يكون أداة قيمة لدراسة وظائف الجينات التجزئة ، وتوصيف واجهة القراد الممرض والفرز وتحديد خصائص وقائية من المضادات القراد 14،35. على وجه الخصوص ، أصبح رني الأداة الأكثر قيمة للتحليلات الفنية في القراد 35. منهجيا ، وسوف تتطور رني الأرجح أكثر كفاءة في أساليب التي قد تسمح ضربة قاضية الجين في عدد كبير من الأفراد. ينبغي تحسين آلية الرنا المزدوج الجديلة التي يسببها رني القراد في المساهمة في التوصل إلى فهم أفضل والاستفادة من هذا النهج الوراثية في هذا النوع 35،36. مدى خارج الهدف آثار رني في القراد هو أيضا مسألة مهمة لا بد من معالجتها بشكل كامل 14،27. أخيرا ، سوف رني الأرجح تقديم مساهمات شاملة لدراسة تنظيم الجينات والبيولوجيا أنظمة التجزئة والقراد الممرض واجهة قد يكون لها تأثير على تطوير لقاحات لمكافحة تفشي التجزئة ونقل مسببات الأمراض التي تنتقل عن طريق القراد.

<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">	
		
		<div>
		<table border="1">
		<thead>
		<tr>
		<th>Material Name</th>
		<th>Type</th>
		<th>Company</th>
		<th>Catalogue Number</th>
		<th>Comment</th>
		</tr>
		</thead>
		<tbody>
		
<tr>
<td>Access RT-PCR system</td>
<td>&nbsp;</td>
<td>Promega</td>
<td>A1250</td>
<td>&nbsp;</td>
<tr>
<td>Purelink PCR purification kit</td>
<td>&nbsp;</td>
<td>Invitrogen</td>
<td>K3100-02</td>
<td>&nbsp;</td>
<tr>
<td>Megascript RNAi kit</td>
<td>&nbsp;</td>
<td>Ambion</td>
<td>AM1626M</td>
<td>&nbsp;</td>
<tr>
<td>Red dental wax</td>
<td>&nbsp;</td>
<td>Electron Microscopy Sciences</td>
<td>72674</td>
<td>&nbsp;</td>
<tr>
<td>Plastic cups, 1.25 oz and lids</td>
<td>&nbsp;</td>
<td>Solo Cup Company, Urbana Ill.</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<tr>
<td>Fine forceps</td>
<td>&nbsp;</td>
<td>Electron Microscopy Sciences</td>
<td>Various</td>
<td>&nbsp;</td>
<tr>
<td>Insulin syringe</td>
<td>&nbsp;</td>
<td>Monoject</td>
<td>&nbsp;</td>
<td>Fitted with a &frac12;&#x201D;, 29 gauge needle</td>
</tr>
<tr>
<td>Hamilton syringe</td>
<td>&nbsp;</td>
<td>Hamilton</td>
<td>701SN,33/.375&#x201D;/45DGR</td>
<td>Custom made</td>
</tr>
<tr>
<td>TriReagent</td>
<td>&nbsp;</td>
<td>Sigma</td>
<td>93289</td>
<td>&nbsp;</td>
<tr>
<td>iScript One-Step RT-PCR Kit with SYBR Green</td>
<td>&nbsp;</td>
<td>Bio-Rad</td>
<td>170-8892</td>
<td>&nbsp;</td>
<tr>
<td>Real-time PCR detection system</td>
<td>&nbsp;</td>
<td>Bio-Rad</td>
<td>Several</td>
<td>Please refer to <a href="http://www.bio-rad.com/">http://www.bio-rad.com/</a></td>
</tr>		</tbody>
		</table>
		</div>

rna interference in ticks

القراد والطفيليات الخارجية بالعة الدم يلزم من الحيوانات البرية والداجنة والبشر ، وتعتبر في جميع أنحاء العالم والثانية لبعوض الناقل للأمراض البشرية (1) وناقلات أهم تؤثر على صناعة الماشية في جميع أنحاء العالم 2. تصنف القراد في Acari فرعية ، Parasitiformes النظام ، Ixodida رتيبة ، وتوزع في جميع أنحاء العالم من القطب الشمالي الى المناطق الاستوائية 3. على الرغم من الجهود للسيطرة على تفشي التجزئة ، وهذه الطفيليات الخارجية لا تزال تمثل مشكلة خطيرة على صحة الإنسان والحيوان 4،5. تدخل الحمض النووي الريبي (رني) 6 هو حمض النووي عكس النهج القائم على الوراثية التي تنطوي على خلل في التعبير الجيني من أجل تحديد وظيفة الجين أو تأثيره على المسار الأيضي. الرناوات التدخل الصغيرة (siRNAs) هي جزيئات المستجيب للمسار رني التي بدأها المزدوج تقطعت بهم السبل الحمض النووي الريبي (الرنا المزدوج الجديلة) ونتائج قوية في تدهور محددة تسلسل mRNAs حشوية تحتوي على نفس تسلسل الزناد الرنا المزدوج الجديلة 7-9. وقد اكتشفت بعد الترانسكربتي آليات إسكات جينات الرنا المزدوج الجديلة التي بدأتها في جميع حقيقيات النوى درست حتى الآن ، وقد رني نموا سريعا في مجموعة متنوعة من الكائنات الحية كأداة لدراسات الجينوم الفنية وغيرها من التطبيقات 10. أصبح رني الأكثر استخداما إسكات الجينات التقنية في القراد وغيرها من الكائنات حيث النهج البديلة للتلاعب الجيني ليست متوافرة أو غير موثوق 5،11. وقد تم توصيف وراثية محدودة من القراد حتى التطبيق مؤخرا رني 12،13. في الوقت القصير الذي تم رني المتاحة ، وقد ثبت لها أن تكون أداة قيمة لدراسة وظائف الجينات التجزئة ، وتوصيف واجهة القراد الممرض والفرز وتحديد خصائص وقائية من المضادات القرادة 14. هنا ، هو طريقة لوصف رني من خلال حقن الرنا المزدوج الجديلة في القراد غير مغذى. فمن المرجح أن المعرفة المكتسبة من هذا النهج التجريبية ستساهم بشكل ملحوظ في فهم الأنظمة البيولوجية الأساسية وتطوير لقاحات لمكافحة تفشي التجزئة ومنع انتقال مسببات الأمراض التي تنتقل عن طريق القراد 15-19.

Watch this Scientific Journal Video about RNA Interference in Ticks at JoVE.com

RNA Interference in Ticks

وصفت طريقة للتدخل الحمض النووي الريبي (رني) عن طريق الحقن في القراد من الرنا المزدوج الجديلة غير مغذى. رني هي الأكثر استخداما إسكات الجينات التقنية في القراد حيث اقتصر على استخدام وسائل أخرى للتلاعب الجيني.

التدخل في الحمض النووي الريبي القراد

Ticks are obligate hematophagous ectoparasites of wild and domestic animals and humans, and are considered to be second worldwide to mosquitoes as vectors ...

Research

JoVE Journal

Immunology and Infection

Development of Cell-type specific anti-HIV gp120 aptamers for siRNA delivery

تطوير خلية من نوع معين الأبتامرات gp120 المضادة لفيروس الإيدز لتسليم سيرنا

The global epidemic of infection by HIV has created an urgent need for new classes of antiretroviral agents. The potent ability of small interfering ...

Saliva, Salivary Gland, and Hemolymph Collection from Ixodes scapularis Ticks

Saliva, Salivary Gland, and Hemolymph Collection from Ixodes scapularis Ticks

اللعاب، الغدد اللعابية، وجمع اللمف الدموي من القراد اللبود الكتفي

Ticks are found worldwide and afflict humans with many tick-borne illnesses. Ticks are vectors for pathogens that cause Lyme disease and tick-borne ...

Feeding of Ticks on Animals for Transmission and Xenodiagnosis in Lyme Disease Research

Transmission of the etiologic agent of Lyme disease, Borrelia burgdorferi, occurs by the  attachment and blood feeding of Ixodes species ticks on ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

باستخدام الحمض النووي الريبي التدخل للتحقيق في الاستجابة المناعية الفطرية في الفأر الضامة

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Nucleocapsid Annealing-Mediated Electrophoresis (NAME) Assay Allows the Rapid Identification of HIV-1 Nucleocapsid Inhibitors

Nucleocapsid Annealing-Mediated Electrophoresis NAME Assay Allows the Rapid Identification of HIV-1 Nucleocapsid Inhibitors

قفيصة منواة التليين بوساطة الكهربائي (NAME) الفحص يسمح للتحديد السريع لHIV-1 قفيصة منواة مثبطات

RNA or DNA folded in stable tridimensional folding are interesting targets in the development of antitumor or antiviral drugs. In the case of HIV-1, viral ...

Applying an Inducible Expression System to Study Interference of Bacterial Virulence Factors with Intracellular Signaling

تطبيق نظام التعبير محرض لدراسة التدخل من العوامل البكتيرية الفوعة مع اشارة بين الخلايا

The technique presented here allows one to analyze at which step a target protein, or alternatively a small molecule, interacts with the components of a ...

RNA Purification from Intracellularly Grown Listeria monocytogenes in Macrophage Cells

RNA Purification from Intracellularly Grown Listeria monocytogenes in Macrophage Cells

RNA تنقية من داخل الخلية المزروعة<em&gt; المستوحدة الليستيريا</em&gt; في خلايا البلاعم

Analysis of the transcriptome of bacterial pathogens during mammalian infection is a valuable tool for studying genes and factors that mediate infection. ...

Small RNA Transfection in Primary Human Th17 Cells by Next Generation Electroporation

الصغيرة RNA ترنسفكأيشن في الخلايا الأولية Th17 الإنسان من قبل الجيل القادم Electroporation لل

CD4+ T cells can differentiate into several subsets of effector T helper cells depending on the surrounding cytokine milieu. Th17 cells can be generated ...

Identification of Coding and Non-coding RNA Classes Expressed in Swine Whole Blood

وأعرب عن تحديد الترميز وفئات الحمض النووي الريبي غير الترميز في الخنازير الدم كله

The advent of innovative and increasingly powerful next generation sequencing techniques has opened new avenues into the ability to examine the underlying ...

Confocal Imaging of Double-Stranded RNA and Pattern Recognition Receptors in Negative-Sense RNA Virus Infection

تصوير [كنفوكل] الحمض النووي الريبي مزدوج-الذين تقطعت بهم السبل ونمط الاعتراف مستقبلات في الإصابة بفيروسات الرنا الشعور السلبي

Double-stranded (ds) RNA is produced as a replicative intermediate during RNA virus infection. Recognition of dsRNA by host pattern recognition receptors ...