Name: cell specific analysis of arabidopsis leaves using fluorescence activated cell sorting
Uploaded: 2012-10-04T13:00:00
Duration: 11 min 25 s
Description: Watch this Scientific Journal Video about Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting at JoVE.com

Werk in de Buchanan-Wollaston lab op cel-type en het ontwikkelingsstadium tot specifieke profilering wordt ondersteund door de AGRON-OMICS project (subsidie ​​# LSHG-CT-2006 tot 037.704) in de 6 e Kaderprogramma progamma van de Europese Commissie. Werk in de Gifford lab op cel-type specifieke profilering wordt ondersteund door een BBSRC New Investigator Grant (BB/H019502/1). De KC274 en KC464 Arabidopsis lijnen werden verkregen van AAR Webb (Universiteit van Cambridge).

1. Protoplast Generation <ol><li> Oogst bladmateriaal en snijd 1 mm brede stroken (figuur 1) met een scheermesje. Voor monsters die meer dan een enkel blad tot 15 bladeren kunnen eenvoudig worden gestapeld voor het snijden. </li><li> Onmiddellijk over blad strips in een 9 cm Petrischaal ronde met 20 ml oplossing A (400 mM mannitol, 20 mM MES-hydraat, 20 mM KCl, 10 mM CaCl2, 2 mM MgCl2, 0,1% BSA en 2,5 mM β-mercaptoethanol, pH 5,7) met inbegrip protoplasting enzymen (1,2% cellulose R-10, 0,6% cellulose RS en 0,4% macerozyme R-10) en RNase en transcriptie remmers (1 x ProtectRNA en 10 ug / ml Actinomycine D) voorzichtig scheiden blad en strips infiltreren vacuüm gedurende 2 x 5 min. </li><li> Place petrischaal op een schudapparaat ingesteld op 90 rpm bij kamertemperatuur en protoplast voor 3-4 uur. <ol><li> Tijdens de incubatie het blad strips worden gescheiden van elkaar door middel van eenset van platte pincet, op de helft van intervallen van een uur. </li></ol></li><li> Plaats een 70 pm cel zeef (Fisher Scientific) in een 50 ml buis en voorzichtig de protoplasting oplossing te filteren door. Dit verwijdert het blad strips die worden bijgehouden door de zeef terwijl de protoplasten doorlopen. </li><li> Was het blad strips met 4 ml oplossing A en voorzichtig filter door dezelfde zeef. </li><li> Breng de protoplasten in ronde bodem en centrifugeer de protoplast oplossing bij 300 xg gedurende 5 minuten tot pellet de protoplasten. </li><li> Zuig zoveel af van de supernatant mogelijk zonder de protoplasten. </li><li> Was de protoplasten met 5 ml oplossing A en centrifugeer bij 300 xg gedurende 5 minuten. Verwijder supernatant </li><li> Resuspendeer de protoplasten in een geschikt volume van oplossing A met een Pasteur pipet of een cut-off P1000 tip. </li></ol> 2. FACS van bladprotoplasten </p&gt; <ol><li> Onmiddellijk voor sorteren, resuspendeer de protoplasten met een (niet-cut) P1000 tip om protoplasten samenklonteren te voorkomen. </li><li> Breng protoplasten naar een sorteer buis door een 50 urn filter filcon (BD Biosciences) en verdun naar gelang van verstopping te voorkomen het mondstuk van de cel sorteerder. De protoplasten worden gesorteerd met behulp van een 100 urn nozzle bij een druk van 20 psi (omhulsel) en 21-21,5 psi (sample), een frequentie van 39,2 kHz en een incidentie van &lt;4000 (deze instellingen optimaal op BD Influx celsorteerder (BD Biosciences). Optimalisatie op andere mobiele sorteermachines kan nodig zijn aanpassingen aan deze instellingen). </li><li> GFP positieve protoplasten worden geïdentificeerd door een 488 nm argon laser en het uitzetten van de uitvoer van de 580/30 banddoorlaatfilter (oranje) versus de 530/40 banddoorlaatfilter (groen). GFP-positieve protoplasten worden in de hoge 530/low 580 inwoners, met niet-GFP protoplasten in de lage 530 / lage 580 inwoners en dode / stervende protoplasten en puin in de hoge 580 populatiening (figuur 2). <ol><li> Bij het ​​sorteren protoplasten waaruit RNA wordt geëxtraheerd, moet protoplasten direct worden gesorteerd in tenminste 4 volumes van een lysis buffer met een reductiemiddel (bijvoorbeeld β-mercaptoethanol). Bovendien moet het soort tijd van een monster beperkt tot 20-30 min, en maximaal twee tot drie monsters verwerkt tegelijk. </li><li> Voor visualisatie van gesorteerd protoplasten dient de protoplasten direct gesorteerd in ten minste 8 volumedelen oplossing A en vervolgens verzameld door centrifugatie om de protoplasten te concentreren. </li></ol></li></ol> 3. Representatieve resultaten Dit protocol beschrijft een werkwijze voor het verkrijgen protoplasten van Arabidopsis bladeren, die worden gebruikt voor fluorescentie geactiveerde celsortering (figuur 1). Protoplast in de aanwezigheid van RNase en transcriptionele remmers voorkomt dat de cellen from montage van een transcriptionele respons. Dit heeft tot gevolg hebben die tot veel dode en stervende protoplasten, die een aanzienlijke mate van autofluorescentie zijn. Bij het sorteren de protoplasten bereid met deze werkwijze is het dus zeer gebruikelijk om een ​​aantal verschillende populaties in grafieken van 580 nm 530 nm versus fluorescentie voor het sorteren. Voorbeelden samen met de sortering poorten in dit protocol worden getoond in Figuur 3. Protoplasten kunnen worden gesorteerd in 8 volumedelen oplossing A en opgevangen voor visualisatie de verrijking verifiëren. Figuur 2G toont een voorbeeld van het gebruik van de TP382 lijn, die GFP expressie in de sluitcellen. Voorbeelden van de opbrengsten verkregen met deze methode, zowel vóór als na amplificatie worden weergegeven in tabel 1. De verkregen hoeveelheden zijn voldoende voor amplificatie met behulp van de Ovation Pico WTA-systeem (500 pg-50 ng) en dus subsequent analyse door een van beide qPCR (Figuur 4), next generation sequencing of microarray. <img alt="Figuur 1" src="/files/ftp_upload/4214/4214fig1.jpg" /> Figuur 1. Algemene workflow voor het experiment. 1) Oogst bladeren van belangstelling van een GFP uiten Arabidopsis lijn. 2) Snel gesneden in ~ 1 mm brede stroken en onmiddellijk over te zetten naar protoplasting oplossing en vacuüm te infiltreren. 3) Incubeer gedurende 3-4 uur. 4) voorzichtig filtraat protoplastfusie oplossing door een 70 pm zeef, over te brengen naar beneden buizen en pellet protoplasten rond door centrifugeren. 5) Vlak voor het sorteren, resuspendeer protoplasten en transfer naar een sorteer buis door een 50 pm filter. 6) Sorteer GFP positieve en negatieve GFP levensvatbaar protoplasten. 7) Protoplasten kan nu worden geanalyseerd, hetzij visueel of met behulp van technieken zoals qPCR, next generation sequencing of microarray. Figuur 2. Het KC464, KC274 en TP382 lijnen gebruikt in deze studie. A) dwarsdoorsnede van een blad weer KC464 GFP expressie in de adaxiale epidermis. B) protoplasten uit bladeren KC464. C) dwarsdoorsnede van een blad weer KC274 GFP expressie in de vasculatuur. D) protoplasten uit bladeren KC274. E) TP382 blad weer GFP-expressie in de sluitcellen. F) protoplasten uit bladeren TP382. G) Voorbeeld van de verrijking verkregen door FACS van GFP expressie sluitcellen in de complexe achtergrond van blad cellen, waaruit blijkt GFP met protoplasten van de hoge 530/low 580 inwoners van protoplasten uit TP382 bladeren. AF: Confocale microscoop beelden; G: Fluorescentie microscoop beeld. Scale bars op beelden zijn 50 pm. <img alt="Figuur 3" src="/files/ftp_upload/4214/4214fig3.jpg" /><html> Figuur 3. Typische FACS verkrijging puntdiagrammen van de uitvoer van de 580/30 nm (oranje) vs 530/40 nm (groen) banddoorlaatfilters (BD Influx cell sorter). De getoonde sorteren poorten die gewoonlijk gebruikt tijdens het sorteren. A) puntdiagram van Col-4 leaf verkregen protoplasten protoplasted in afwezigheid van remmers, met een laag 530/low 580 bevolking. B) Dot plot van wt Col-4 leaf verkregen protoplasten protoplasted in de aanwezigheid van remmers, een verschuiving in de 580 fluorescentie vanwege stress en kleuring van de remmers. CE) puntdiagrammen van blad afgeleid uit de protoplasten KC74, KC464 en TP382 lijnen respectievelijk protoplasted in de aanwezigheid van remmers die de GFP die in de populaties hoge 530/low 580 populaties. De percentages van de gebeurtenissen in het GFP (hoge 530/low 580) populaties worden gegeven. <a href="http://www.jove.com/files/ftp_upload/4214/4214fig3large.jpg" target="_blank">Klik hier om een grotere afbeelding te bekijken</a> . e_content &quot;fo: keep-together.within-page =&quot; always &quot;&gt; <img alt="Figuur 4" src="/files/ftp_upload/4214/4214fig4.jpg" /> Figuur 4. GFP expressie in de representatieve populatie gated fracties zoals weergegeven in figuur 3. Twee biologische herhalingen werden voor elke fractie type, geamplificeerd met de Ovation Pico WTA System en qPCR met GFP-specifieke primers (tabel 2) werd vervolgens uitgevoerd. De weergegeven waarden zijn de hoogste (rood), laagste (groen) en de gemiddelde relatieve waarden. De hoge 580 bevolking was in dit geval in tweeën gesplitst, lage 530/low 580 en hoge 530/low 580, waarvoor een enkele biologische repliceren dus werd gebruikt alleen de enkele waarde is aangegeven. ACT2 (At3g18780) werd gebruikt als standaard voor alle monsters. Blad: Hele blad. Unsorted: Unsorted protoplasten. GFP1: hoge 530/low 580 en REST1: lage 530/low 580, GFP2: hoge 530/high 580 en REST2: 530/high laag 580, zoals in figuur 3 en de insert. De resultaten zijn een verificatie of optische beoordeling van GFP celinhoud in de gesorteerde fracties (bijvoorbeeld figuur 2G). <a href="http://www.jove.com/files/ftp_upload/4214/4214fig4large.jpg" target="_blank">Klik hier om een grotere afbeelding te bekijken</a> . <table border="1"><tbody><tr><td> Monster </td><td> Aantal bladeren </td><td> Aantal cellen </td><td> RNA opbrengst (Ng) </td><td> RNA opbrengst (Versterkt; ng) </td></tr><tr><td> Hele blad A Hele vleugel B </td><td> 1 1 </td><td> - - </td><td> 8001 10525 </td><td> 4623 *** 4572 *** </td></tr><tr><td> Unsorted protoplasten A Unsorted protoplasten B </td><td> 5 5 </td><td> - - </td><td> 2433 2625 </td><td> 1152 *** 3321 *** </td></tr><tr><td> GFP1 A REST1 A </td><td> 15 </td><td> 6039 (0,39% *) 55389 (6.40% *) </td><td> - ** - ** </td><td> 861 489 </td></tr><tr><td> GFP1 B REST1 B </td><td> 15 </td><td> 10.783 (0,63% *) 57.040 (7,49% *) </td><td> - ** - ** </td><td> 537 420 </td></tr><tr><td> GFP2 REST2 </td><td> 15 </td><td> 18.337 (1,49% *) 62.405 (73,49% *) </td><td> - ** - ** </td><td> 360 411 </td></tr></tbody></table> Tabel 1. Monsters met FACS geanalyseerd en qPCR te bepalen welke fractie bevatte levende GFP-expressie protoplasten. Ook in deze tabel is de totale RNA opbrengst ng voor en na amplificatie met de Ovation Pico WTA System (NuGen). GFP1, GFP2, en REST1 REST2 fracties worden getoond in het inzetstuk in figuur 4. * Het percentage cellen van de totale cel soort run is tussen haakjes naast het aantal cellen in de breuk. Deze percentages zijn niet gecorreleerd aanelkaar elk monster de FACS sorteren loopt fracties &#39;Rest&#39; zijn eerder dan voor GFP fracties vanwege het veel grotere aantal verzamelde Rest cellen gestopt. ** 50 ng gebruikt als input voor amplificatiereacties volgens de fabrikant protocol. <table border="1"><tbody><tr><td> Grondverf </td><td> Volgorde </td></tr><tr><td> mGFP5-ER.fw </td><td> GCCTGAGGGATACGTGCAGGAGA </td></tr><tr><td> mGFP5-ER.rv </td><td> TGGCGGGTCTTGAAGTTGGCT </td></tr><tr><td> ACT2.fw </td><td> GCCATCCAAGCTGTTCTCTC </td></tr><tr><td> ACT2.rv </td><td> GCCATCCAAGCTGTTCTCTC </td></tr></tbody></table> Tabel 2. QPCR primers.

<ol>
	<li>Efroni, I., Eshed, Y., Lifschitz, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphogenesis+of+Simple+and+Compound+Leaves:+A+Critical+Review.">Morphogenesis of Simple and Compound Leaves: A Critical Review.</a> Plant Cell. 22, 1019-1032 (2010).</li><li>Kleber, R., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+and+Quality+Assessment+of+RNA+From+Cell-Specific+Samples+Obtained+by+Laser+Microdissection.">Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection.</a> Methods Mol. Biol. 323, 367-377 (2006).</li><li>Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Gene+Expression+Map+of+the+Arabidopsis+root.">A Gene Expression Map of the Arabidopsis root.</a> Science. 302, 1956-1960 (2003).</li><li>Warnasooriya, S. N., Montgomery, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+Tissue-+and+Organ-specific+Phytochrome+Responses+using+FACS-assisted+Cell-type+Specific+Expression+Profiling+in+Arabidopsis+thaliana.">Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana.</a> J. Vis. Exp. (39), e1925 (2010).</li><li>Beal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Simple+Method+For+Gene+Expression+and+Chromatin+Profiling+of+Individual+Cell+Types+Within+a+Tissue.">A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue.</a> Dev. Cell. 18, 1030-1040 (2010).</li><li>Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Profiling+translatomes+of+discrete+cell+populations+resolves+altered+cellular+priorities+during+hypoxia+in+Arabidopsis.">Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis.</a> PNAS. 106, 18843-18848 (2009).</li><li>Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dominant+Root+Expression+Patterns+Revealed+in+a+High-Resolution+Spatiotemporal+Expression+Map.">Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map.</a> Science. 318, 801-806 (2007).</li><li>Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-specific+nitrogen+responses+mediate+developmental+plasticity.">Cell-specific nitrogen responses mediate developmental plasticity.</a> PNAS. 105, 803-808 (2008).</li><li>Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+identity+mediates+the+response+of+Arabidopsis+roots+to+abiotic+stress.">Cell identity mediates the response of Arabidopsis roots to abiotic stress.</a> Science. 320, 942-945 (2008).</li><li>Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Auxin+Gradient+and+Maximum+in+the+Arabidopsis+Root+Apex+Shown+by+High-Resolution+Cell-Specific+Analysis+of+IAA+Distribution+and+Synthesis.">An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis.</a> Plant Cell. 21, 1659-1668 (2009).</li><li>Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+map+of+the+Arabidopsis+shoot+apical+meristem+stem+cell+niche.">Gene expression map of the Arabidopsis shoot apical meristem stem cell niche.</a> PNAS. 106, 4941-4946 (2009).</li><li>Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+photosynthesis-related+gene+fusions+is+restricted+by+cell+type+in+transgenic+plants+and+in+transfected+protoplasts.">Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts.</a> PNAS. 87, 816-820 (1990).</li><li>Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+a+strong+Arabidopsis+guard+cell+promoter+and+it's+potential+as+a+research+tool.">Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool.</a> Plant Methods. 4, 6 (2008).</li><li>Gardner, M. J., Baker, A. J., Assie, J. -. M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GAL4+GFP+enhancer+trap+lines+for+analysis+of+stomatal+guard+cell+development+and+gene+expression.">GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression.</a> J. Exp. Bot. 60, 213-226 (2009).</li></ol>

Geen belangenconflicten verklaard.

We hebben een werkwijze beschreven dat het gebruik van Arabidopsis planten die GFP in de bladeren protoplast en volgende celsortering met FACS maakt. Deze methode levert voldoende hoeveelheden RNA te gebruiken voor amplificatie en daardoor daaropvolgende analyse door een qPCR of microarray. De fracties worden gesorteerd sterk verrijkt GFP-bevattende cellen, zoals aangetoond door qPCR (Figuur 2). Om een ​​hoge opbrengst van levende protoplasten is het essentieel snel werken tijdens de eerste stappen van de procedure, totdat het blad strips zijn vacuüm geïnfiltreerd met de inhibitor bevattende protoplast oplossing. Bovendien, bij het genereren van 1 mm blad strips is het zeer belangrijk te snijden of knippen de bladeren dan &quot;hakken&quot; of mash, omdat dat leidt tot overmatige slijtage en dus een lagere opbrengst protoplast. Een essentieel verschil tussen de hier beschreven methode en published methoden is het gebruik van RNase remmers en transcriptie remmers. De meeste methoden ontwikkeld voor Arabidopsis stammen waaruit protoplasten kunnen gemakkelijker worden gegenereerd. Echter werkt met bladeren, behalve mesofyl, moet de protoplast generatietijd verhogen. Daarom is het belangrijk om deze remmers omvatten om tegen veranderingen in genexpressie bescherming als gevolg van de protoplast generatie behandeling zelf (gegevens niet getoond). De aanwezigheid van de remmers leidt tot een onvermogen om een ​​transcriptie reactie te ontwikkelen, hetzij door het inschakelen of uitschakelen van genen, die waarschijnlijk om de protoplasten kwetsbaarder omdat dit leidt tot een verlies van plasticiteit waarmee tegen de spanningen van de protoplasting procedure. We hebben de hier beschreven werkwijze met succes met een aantal GFP tot expressie Arabidopsis lijnen. Belangrijk is, hebben we gebruik gemaakt van deze methode met GFP lijnen GFP tot expressie brengen, hetzij sterk inde kern, of veel zwakker in een cytosolisch non-localized/diffuse wijze, zoals het geval is met de KC464 en KC274 lijnen hier gebruikt. Beide soorten lijnen zijn geschikt voor de methode geven hoogverrijkt fracties van GFP-expressie protoplasten (figuur 2 en 3). De werkwijze kan gemakkelijk worden aangepast aan andere fluoroforen, hoewel de fluorofoor worden gekozen voor fluorescentie die significant verschilt van de autofluorescentie van dode / stervende cellen om het vermogen om levende cellen te selecteren behouden.

<table border="1"><tbody><tr><td> Naam van het reagens </td><td> Vennootschap </td><td> Catalogusnummer </td></tr><tr><td> Cellulase R-10 </td><td> Melford </td><td> C8001 </td></tr><tr><td> Cellulase RS </td><td> Melford </td><td> C8003 </td></tr><tr><td> Macerozyme R-10 </td><td> Melford </td><td> M8002 </td></tr><tr><td> BSA </td><td> Sigma-Aldrich </td><td> A3912 </td></tr><tr><td> ProtectRNA </td><td> Sigma-Aldrich </td><td> R7397 </td></tr><tr><td> Actinomycine D </td><td> Sigma-Aldrich </td><td> A1410 </td></tr><tr><td> 70 urn celzeef </td><td> Visser </td><td> FB35181 </td></tr><tr><td> 50 pm filcon cup-type filters </td><td> BD Biosciences </td><td> 340630 </td></tr></tbody></table>

cell specific analysis of arabidopsis leaves using fluorescence activated cell sorting

Na starten van het blad primordium wordt biomassa accumulatie voornamelijk bepaald door celproliferatie en uitbreiding in de bladeren 1. De Arabidopsis leaf is een complex orgaan bestaat uit vele verschillende celtypes en verschillende structuren. Tegelijkertijd de groeiende bladeren bevat cellen in verschillende stadia van ontwikkeling, met de cellen die het verst van de steel als eerste te stoppen uitbreiding ondergaan senescentie 1. Verschillende cellen in het blad Daarom verdelen, verlengen of differentiatie, actieve, gestrest of dood, en / of reageren op stimuli in sub-sets van de cellulaire type tegelijk. Hierdoor genomisch onderzoek van het blad uitdagende, bijvoorbeeld bij het analyseren van expressie gegevens van hele bladeren, signalen van genetische netwerken die in verschillende cellulaire respons zones of celtypen worden verward, wat resulteert in een onjuiste profiel wordt gegenereerd. Om dit aan te pakken, eneveral werkwijzen beschreven waarmee studies van cel genexpressie. Deze omvatten laser-capture microdissectie (LCM) 2 of GFP tot expressie brengende planten voor protoplast en volgende fluorescentie geactiveerde celsortering (FACS) 3,4, de recent beschreven INTACT voor nucleaire neerslag 5 en immunoprecipitatie van polysomen 6. FACS is met succes gebruikt voor een aantal studies, waaronder waaruit blijkt dat de celidentiteit en afstand van de wortelpunt een significant effect op de expressie profielen van een groot aantal genen 3,7 had. FACS van GFP lijnen zijn ook gebruikt om cel-specifieke transcriptionele regulatie in wortel stikstof reacties en laterale wortelvorming 8, 9 zoutstress auxine verdeling in de wortel 10 tonen en een genexpressie kaart van de Arabidopsis shoot apicale meristeem 11 maken. HoewelFACS is eerder gebruikt om Arabidopsis leaf verkregen protoplasten gebaseerd op autofluorescentie 12,13 sorteren, tot dusver het gebruik van FACS op Arabidopsis lijnen GFP tot expressie brengen in de bladeren zeer beperkt 4. In het volgende protocol beschrijven we een werkwijze voor het verkrijgen Arabidopsis bladprotoplasten die compatibel zijn met FACS terwijl het minimaliseren van het effect van de protoplast generatie regime. We tonen de werkwijze volgens de KC464 Arabidopsis lijn, die uitdrukkelijk GFP in de epidermis adaxiale 14, KC274 lijn, die uitdrukkelijk GFP in het vaatweefsel 14 en TP382 Arabidopsis lijn, die een dubbele GFP expressie construct gekoppeld aan een nucleair lokalisatiesignaal in de sluitcellen (data niet getoond, figuur 2). Momenteel gebruiken deze methode zowel celtype specifieke expressie tijdens de ontwikkeling en stress, alsook heterogene celpopulaties bestuderen in verschillende stadia van senescentie.

Watch this Scientific Journal Video about Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting at JoVE.com

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

Werkwijze voor het produceren<em&gt; Arabidopsis</em&gt; Bladprotoplasten die compatibel zijn met fluorescentie geactiveerde celsortering (FACS), waardoor studies van specifieke celpopulaties. Deze werkwijze is compatibel met elk<em&gt; Arabidopsis</em&gt; Lijn die GFP uitdrukt in een subset van cellen.

Cel specifieke analyse van<em&gt; Arabidopsis</em&gt; Bladeren met fluorescentie-geactiveerde celsortering

After initiation of the leaf primordium, biomass accumulation is controlled mainly by cell proliferation and expansion in the leaves1. However, the ...

Research

JoVE Journal

Biology

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

Fluorescence Activated Cell Sorting of Plant Protoplasts

Fluorescentie geactiveerde celsortering van plantenprotoplasten

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

Onderzoeken Tissue-en orgel-specifieke fytochroom Reacties met behulp van FACS-assisted Cell-type-specifieke expressie profilering in Arabidopsis thaliana</em

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called ...

Heterokaryon Technique for Analysis of Cell Type-specific Localization

Heterokaryon Techniek voor de analyse van celtype-specifieke lokalisatie

A significant number of proteins are regulated by subcellular trafficking or nucleocytolasmic shuttling.  These proteins display a diverse array of ...

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting (LIMACS): a Novel Method to Analyze Protein-lipid Interaction

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting LIMACS: a Novel Method to Analyze Protein-lipid Interaction

Lipide bolletjes-gemedieerde affiniteitschromatografie met behulp van Magnetic Activated Cell Sorting (LIMACS): een nieuwe methode om eiwit-lipide Interactie Analyze

The analysis of lipid protein interaction is difficult because lipids are embedded in cell membranes and therefore, inaccessible to most purification ...

Bromodeoxyuridine (BrdU) Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Bromodeoxyuridine BrdU Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Broomdeoxyuridine (BrdU) etikettering en Latere Fluorescentie Activated Cell Sorting voor cultuur-onafhankelijke Identificatie van opgeloste organische koolstof-afbrekende bacterioplankton

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification ...

A Simple Method for Imaging Arabidopsis Leaves Using Perfluorodecalin as an Infiltrative Imaging Medium

A Simple Method for Imaging Arabidopsis Leaves Using Perfluorodecalin as an Infiltrative Imaging Medium

Een eenvoudige methode voor de Imaging Arabidopsis Met behulp van Leaves Perfluorodecalin als een Infiltratieve Imaging Medium

The problem of acquiring high-resolution images deep into biological samples is widely acknowledged1. In air-filled tissue such as the spongy mesophyll of ...

Optimized Staining and Proliferation Modeling Methods for Cell Division Monitoring using Cell Tracking Dyes

Geoptimaliseerd kleuring en proliferatie Modeling Methoden voor de celdeling Monitoring met behulp van Cell Tracking Kleurstoffen

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of ...

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting (FACS)

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting FACS

Isolatie van normale en kankergeassocieerde fibroblasten van verse weefsels door fluorescentie-geactiveerde celsortering (FACS)

Cancer-associated fibroblasts (CAFs) are the most prominent cell type within the tumor stroma of many cancers, in particular breast carcinoma, and their ...

Single Cell Micro-aspiration as an Alternative Strategy to Fluorescence-activated Cell Sorting for Giant Virus Mixture Separation

Single cell micro-aspiratie als alternatieve strategie voor de fluorescentie-geactiveerde celsortering voor scheiding van gigantische virus mengsels

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or ...

Fluorescence-Activated Cell Sorting for the Isolation of Scleractinian Cell Populations

Fluorescentie-geactiveerde celsorde voor de isolatie van scleractinische celpopulaties

Coral reefs are under threat due to anthropogenic stressors. The biological response of coral to these stressors may occur at a cellular level, but the ...