Name: cell specific analysis of arabidopsis leaves using fluorescence activated cell sorting
Uploaded: 2012-10-04T13:00:00
Duration: 11 min 25 s
Description: Watch this Scientific Journal Video about Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting at JoVE.com

לעבוד ביוקנן-ולאסטון המעבדה על תאים מסוג מסוים והתפתחותי פרופיל במה נתמכת על ידי אגרון-OMICS הפרויקט (מענק # LSHG-CT-2006-037704) במסגרת Progamme 6 שנים לנציבות האירופיות. העבודה במעבדת גיפורד באפיון ספציפי של תאים מהסוג נתמכת על ידי BBSRC ניו חוקר מענק (BB/H019502/1). את KC274 וKC464 קווי ארבידופסיס התקבלו מAAR ווב (אוניברסיטת קיימברידג&#39;).

1. Protoplast הדור <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> חומרי קציר עלים ולחתוך לרצועות ברוחב 1 מ&quot;מ (איור 1) עם סכין גילוח. לדגימות המכילות יותר מעלים עד 15 עלים בודדים יכולות להיערם בקלות לפני החיתוך. </li><li style=";text-align:right;direction:rtl"> מייד להעביר רצועות עלים לתוך צלחת פטרי עגולה 9 סנטימטר המכיל 20 מיליליטר פתרון (400 המ&quot;מ מניטול, מימה 20 מ&quot;מ MES, 20 המ&quot;מ KCl, 10 mM CaCl 2, 2 המ&quot;מ MgCl 2, 0.1% BSA ו2.5 מ&quot;מ β-mercaptoethanol, pH 5.7) כולל אנזימי protoplasting (צלולוזת R-10, 0.6% התאיים RS ו 0.4% macerozyme R-10 1.2%) וRNase ומעכבי תעתיק (1 × ProtectRNA ו10 מיקרוגרם / המ&quot;ל actinomycin D); עדינות להפריד את העלים ורצועות ואקום לחדור ל2 × 5 דקות. </li><li style=";text-align:right;direction:rtl"> צלחת פטרי מקום בהקפה ייקרה להגדיר עד 90 סל&quot;ד בטמפרטורת חדר וprotoplast עבור שעות 3-4. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> במהלך הדגירה את רצועות עלים צריכות להיות מופרדות אחד מהשני, על ידי שימוש בסט של פינצטה השטוחה, במחצית מרווחים לפי השעה. </li></ol></li><li style=";text-align:right;direction:rtl"> הנח 70 מיקרומטר תא מסננת (הפישר סיינטיפיק) בצינור מ&quot;ל 50 ועדינות לסנן פתרון protoplasting דרך. הפעולה זו תסיר את רצועות עלים, שתישארנה בידי המסננת ובמקביל לאפשר את protoplasts לעבור. </li><li style=";text-align:right;direction:rtl"> שוטף את רצועות עלים עם 4 פתרון מ&quot;ל ועדינות מסנן דרך אותה המסננת. </li><li style=";text-align:right;direction:rtl"> העבירו את protoplasts לתוך צינורות תחתונים עגולים וחובצה את פתרון protoplast ב 300 XG למשך 5 דקות לגלולה את protoplasts. </li><li style=";text-align:right;direction:rtl"> בעדינות לשאוב אותו במידה של supernatant ככל האפשר מבלי להפריע לprotoplasts. </li><li style=";text-align:right;direction:rtl"> שטוף את protoplasts עם פתרון 5 מ&quot;ל וצנטריפוגה XG ב 300 למשך 5 דקות. הסרת supernatant </li><li style=";text-align:right;direction:rtl"> Resuspend את protoplasts בנפח מתאים לפתרון, באמצעות פיפטה פסטר או טיפ P1000 חתך. </li></ol> 2. FACS של Protoplasts עלים </p&gt; <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מייד לפני המיון, resuspend את protoplasts באמצעות (ללא חתך) P1000 קצה להימנע protoplasts clumping יחד. </li><li style=";text-align:right;direction:rtl"> העברת protoplasts לצינור מיון 50 מיקרומטר filcon מסנן (BD Biosciences) ולדלל מתאימים כדי למנוע סתימת הנחיר של סדרן התא. את protoplasts מסודר באמצעות פיית מיקרומטר 100 בלחץ של 20 אטמוספרות (נדן) ו21-21.5 psi (מדגם), בתדר של 39.2 קילוהרץ ושיעור אירועים של &lt;4000 (הגדרות אלה הן אופטימליות על סדרן תא זרם BD . אופטימיזציה (BD Biosciences) על מכונות מיון תא אחרות ייתכן שתצטרך התאמות להגדרות אלה). </li><li style=";text-align:right;direction:rtl"> protoplasts החיובי GFP מזוהה באמצעות 488 ננומטר ארגון ליזר והתוויית הפלט מ580 / 30 bandpass המסנן (כתום) לעומת מסנן bandpass 530/40 (ירוק). protoplasts החיובי GFP יהיה ב580 אוכלוסיית 530/low הגבוהה, עם protoplasts הלא GFP ב580 אוכלוסייה 530 הנמוכות / נמוכה ומת / protoplasts הגוסס ופסולת בגובה 580 popuרח (איור 2). <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בעת מיון protoplasts שממנו יהיה חילוץ רנ&quot;א, protoplasts יש למיין ישירות לתוך לפחות 4 כרכים של חיץ תמוגה מכיל סוכן צמצום (למשל β-mercaptoethanol). בנוסף, בפעם הסוג של מדגם יחיד צריכה להיות מוגבלת ל20-30 דקות, ועד למקסימום של 2-3 דגימות מעובד בכל זמן נתון. </li><li style=";text-align:right;direction:rtl"> להדמיה של protoplasts הממוין, את protoplasts יש למיין ישירות לתוך לפחות 8 כרכים של פתרון ושנאסף לאחר מכן על ידי צנטריפוגה לרכז את protoplasts. </li></ol></li></ol> 3. נציג תוצאות פרוטוקול זה מתאר שיטה לקבלת protoplasts מעלי ארבידופסיס, המשמשים למיון תא הופעל פלואורסצנטי (איור 1). דור Protoplast בנוכחות RNase ומעכבי תעתיק מונע f התאיםrom הרכבת תגובת תעתיק. זה עושה לי תוצאה מהוליד רב protoplasts המת והגוסס, אשר יש רמה משמעותית של autofluorescence. כשממיין את protoplasts הוכן בשיטה זו לכן זה מאוד נפוץ לראות כמה אוכלוסיות שונות בגרפים של 580 ננומטר לעומת קרינת ננומטר 530 שמש למיון. דוגמאות לכך, יחד עם שערי המיון השתמשו בפרוטוקול זה מוצגות באיור 3. Protoplasts ניתן למיין ל8 כרכים של פתרון ונאסף להדמיה כדי לאמת את ההעשרה. האיור 2G מראה דוגמה לכך באמצעות קו TP382, המבטא GFP בתאי השמירה. דוגמאות לתשואות שהשיגו בשיטה זו, היא לפני והן אחרי ההגברה, מוצגים בטבלת 1. הסכומים שהתקבלו מספיקים להגברת שימוש במערכת Ovation פיק WTA (500 pg-50 ng) ולכן זה<html> ניתוח ubsequent ידי אחד qPCR (איור 4), רצף הדור הבא או microarray. <img alt="איור 1" src="/files/ftp_upload/4214/4214fig1.jpg" /> איור 1. עבודה כוללת לניסוי. 1) הקציר מותיר ריבית מלהביע GFP קו ארבידופסיס. 2) לחתוך במהירות לתוך ~ 1 רצועות רחבות מ&quot;מ ולהעביר באופן מיידי את אלה לפתרון והוואקום protoplasting לחדור. 3) דגירה עבור שעות 3-4. 4) בעדינות פתרון תסנין protoplast דרך מסנן מיקרומטר 70, להעביר לעגל צינורות תחתונים וprotoplasts גלולה ידי צנטריפוגה. 5) מייד לפני המיון, protoplasts resuspend והעברה לצינור מיון דרך 50 מיקרומטר מסנן. 6) protoplasts קיימא שלילי GFP מיין GFP חיובי ו. 7) Protoplasts כעת ניתן לנתח אם באופן חזותי או באמצעות טכניקות כגון qPCR, רצף הדור הבא או microarray. together.within עמודים = &quot;תמיד&quot;&gt; <img alt="איור 2" src="/files/ftp_upload/4214/4214fig2.jpg" /> איור 2. את KC464, KC274 וTP382 הקווים השתמשו במחקר זה. א) סעיף רוחבי של KC464 עלה מראה ביטוי של GFP באפידרמיס adaxial. B) Protoplasts נגזר מKC464 עלים. ג) סעיף רוחבי של KC274 עלה מראה ביטוי של GFP בכלי הדם. ד) Protoplasts נגזר מKC274 עלים. E) עלה TP382 מראה ביטוי של GFP בתאי השמירה. F) Protoplasts נגזר מTP382 עלים. ז) דוגמה להעשרה הושגה על ידי FACS של GFP להביע תאי שמירה ברקע המורכב של תאי עלים, מראה GFP המכיל protoplasts מ580 אוכלוסיית 530/low הגבוהה של protoplasts נגזר מTP382 עלים. AF: תמונות confocal מיקרוסקופ; G: תמונת מיקרוסקופ פלואורסצנטי. ברי קנה מידה בתוך תמונות הם 50 מיקרומטר. <img alt="איור 3" src="/files/ftp_upload/4214/4214fig3.jpg" /><html> איור 3. FACS חלקות נקודת רכישה אופייניות של הפלט מ580 / 30 ננומטר (כתום) לעומת ננומטר 530/40 (ירוק) מסנני bandpass (סדרן תא זרם BD). את שערי המיון המוצג הם אלה משמשות בדרך כלל במיון. א) עלילת דוט של Col-4 protoplasts עלים נגזרים, protoplasted בהיעדר מעכבים, מראה 580 אוכלוסיית 530/low יחידה ונמוכה. B) עלילת דוט מWT protoplasts Col-4 עלים נגזר, protoplasted בנוכחות מעכבים, מראה שינוי ב580 פלואורסצנטי בשל לחץ וצביעה על ידי המעכבים. הספירה) דוט חלקות protoplasts נגזר עלים מKC74, KC464 וTP382 קווים, בהתאמה, protoplasted בנוכחות מעכבים, מראים GFP המכיל אוכלוסיות ב530/low הגבוה 580 אוכלוסיות. את האחוזים של האירועים בGFP (הגבוה 530/low 580) אוכלוסיות נתונים. <a href="http://www.jove.com/files/ftp_upload/4214/4214fig3large.jpg" target="_blank">לחץ כאן לצפייה בדמות גדולה.</a> e_content &quot;fo: לשמור-together.within עמודים =&quot; תמיד &quot;&gt; <img alt="איור 4" src="/files/ftp_upload/4214/4214fig4.jpg" /> איור 4. ביטוי של GFP בשברי האוכלוסייה המגודרים היציגים כפי שמוצג באיור 3. שתיים ביולוגיים משכפל התקבלו לכל סוג חלקיק, מוגבר באמצעות Ovation פיק WTA המערכת וqPCR באמצעות פריימרים ספציפיים GFP (טבלה 2) אז בוצע. ערכים המוצגים הם (אדום) את הערכים הגבוהים ביותר, הנמוכים ביותר (ירוק) וממוצע יחסית. 580 האוכלוסייה הגבוהה הייתה במקרה זה נחצה לשניים, נמוך 530/low 580 ו530/low גבוה 580, שללשכפל ביולוגי יחיד היה בשימוש, כך שרק הערך היחיד שהיא מוצגת. Act2 (At3g18780) שמש כתקן עבור כל המדגמים. עלים: כל עלה. לא ממוין: protoplasts לא ממוין. GFP1: 530/low גבוה 580 וRest1: 530/low הנמוך 580, GFP2: 530/high הגבוה 580 וRest2: 530/high הנמוך 580, כפי שמתואר באיור 3 והוספה. התוצאות הן אימות of הערכות אופטיות של תוכן תא ה-GFP בשברים הממוינים (למשל 2G איור). <a href="http://www.jove.com/files/ftp_upload/4214/4214fig4large.jpg" target="_blank">לחצו כאן לצפייה בדמות גדולה.</a> <table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> מדגם </td><td> מספר עלים </td><td> מספר תאים </td><td> RNA תשואה (נ&quot;ג) </td><td> RNA תשואה (מוגבר; ng) </td></tr><tr><td> עלה שלם B עלה השלם </td><td> 1 1 </td><td> - - </td><td> 8001 10525 </td><td> 4623 *** 4572 *** </td></tr><tr><td> protoplasts לא ממוין B protoplasts Unsorted </td><td> 5 5 </td><td> - - </td><td> 2433 2625 </td><td> 1152 *** 3321 *** </td></tr><tr><td> GFP1 Rest1 </td><td> 15 </td><td> 6039 (0.39% *) 55389 (6.40% *) </td><td> - ** - ** </td><td> 861 489 </td></tr><tr><td> GFP1 B Rest1 B </td><td> 15 </td><td> 10783 (0.63% *) 57040 (7.49% *) </td><td> - ** - ** </td><td> 537 420 </td></tr><tr><td> GFP2 Rest2 </td><td> 15 </td><td> 18337 (1.49% *) 62405 (73.49% *) </td><td> - ** - ** </td><td> 360 411 </td></tr></tbody></table> לוח 1. דוגמאות שנאספו ונותחו בעזרת FACS עם qPCR כדי לקבוע איזה חלק הכיל protoplasts החי GFP להביע-. כמו כן, נכללת בטבלה זו היא מוחלטת תשואת RNA בng לפני ואחרי ההגברה עם Ovation פיק WTA המערכת (NuGEN). GFP1, GFP2, Rest1 וRest2 שברים כמוצגים בעלון באיור 4. * אחוז מהתאים של טווח סוג התא הכולל ניתן בסוגריים ליד מספר התאים בשבריר. אחוזים אלה אינם קשורים לאחד את השני לכל דגימה כסוג FACS פועל לשברים &quot;לנוח&quot; נעצרו מוקדם יותר לשברי GFP עקב המספר הגדול בהרבה של תאי מנוחה שנאספו. ** 50 ng משמש כקלט להגברת תגובות, לפי הפרוטוקול של היצרן. <table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> תחל </td><td> רצף </td></tr><tr><td> mGFP5-ER.fw </td><td> GCCTGAGGGATACGTGCAGGAGA </td></tr><tr><td> mGFP5-ER.rv </td><td> TGGCGGGTCTTGAAGTTGGCT </td></tr><tr><td> ACT2.fw </td><td> GCCATCCAAGCTGTTCTCTC </td></tr><tr><td> ACT2.rv </td><td> GCCATCCAAGCTGTTCTCTC </td></tr></tbody></table> לוח 2. פריימרים qPCR.

<ol>
	<li>Efroni, I., Eshed, Y., Lifschitz, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphogenesis+of+Simple+and+Compound+Leaves:+A+Critical+Review.">Morphogenesis of Simple and Compound Leaves: A Critical Review.</a> Plant Cell. 22, 1019-1032 (2010).</li><li>Kleber, R., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+and+Quality+Assessment+of+RNA+From+Cell-Specific+Samples+Obtained+by+Laser+Microdissection.">Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection.</a> Methods Mol. Biol. 323, 367-377 (2006).</li><li>Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Gene+Expression+Map+of+the+Arabidopsis+root.">A Gene Expression Map of the Arabidopsis root.</a> Science. 302, 1956-1960 (2003).</li><li>Warnasooriya, S. N., Montgomery, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+Tissue-+and+Organ-specific+Phytochrome+Responses+using+FACS-assisted+Cell-type+Specific+Expression+Profiling+in+Arabidopsis+thaliana.">Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana.</a> J. Vis. Exp. (39), e1925 (2010).</li><li>Beal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Simple+Method+For+Gene+Expression+and+Chromatin+Profiling+of+Individual+Cell+Types+Within+a+Tissue.">A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue.</a> Dev. Cell. 18, 1030-1040 (2010).</li><li>Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Profiling+translatomes+of+discrete+cell+populations+resolves+altered+cellular+priorities+during+hypoxia+in+Arabidopsis.">Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis.</a> PNAS. 106, 18843-18848 (2009).</li><li>Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dominant+Root+Expression+Patterns+Revealed+in+a+High-Resolution+Spatiotemporal+Expression+Map.">Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map.</a> Science. 318, 801-806 (2007).</li><li>Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-specific+nitrogen+responses+mediate+developmental+plasticity.">Cell-specific nitrogen responses mediate developmental plasticity.</a> PNAS. 105, 803-808 (2008).</li><li>Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+identity+mediates+the+response+of+Arabidopsis+roots+to+abiotic+stress.">Cell identity mediates the response of Arabidopsis roots to abiotic stress.</a> Science. 320, 942-945 (2008).</li><li>Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Auxin+Gradient+and+Maximum+in+the+Arabidopsis+Root+Apex+Shown+by+High-Resolution+Cell-Specific+Analysis+of+IAA+Distribution+and+Synthesis.">An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis.</a> Plant Cell. 21, 1659-1668 (2009).</li><li>Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+map+of+the+Arabidopsis+shoot+apical+meristem+stem+cell+niche.">Gene expression map of the Arabidopsis shoot apical meristem stem cell niche.</a> PNAS. 106, 4941-4946 (2009).</li><li>Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+photosynthesis-related+gene+fusions+is+restricted+by+cell+type+in+transgenic+plants+and+in+transfected+protoplasts.">Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts.</a> PNAS. 87, 816-820 (1990).</li><li>Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+a+strong+Arabidopsis+guard+cell+promoter+and+it's+potential+as+a+research+tool.">Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool.</a> Plant Methods. 4, 6 (2008).</li><li>Gardner, M. J., Baker, A. J., Assie, J. -. M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GAL4+GFP+enhancer+trap+lines+for+analysis+of+stomatal+guard+cell+development+and+gene+expression.">GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression.</a> J. Exp. Bot. 60, 213-226 (2009).</li></ol>

אין ניגודי האינטרסים הכריזו.

כבר תארנו שיטה המאפשרת שימוש בצמחי ארבידופסיס מבטאים GFP את העלים לדור protoplast ומיון התא הבא באמצעות FACS. שיטה זו מניבה כמויות מספיקות של רנ&quot;א שישמש להגברה ולכן לאחר ניתוח על ידי אחד או qPCR microarray. השברים הממוינים מועשרים לתאי GFP המכיל, כפי שהוכיחו qPCR (איור 2). כדי להשיג תשואות גבוהות של protoplasts חיות זה הוא קריטי לעבודה במהירות במהלך השלבים הראשונים של התהליך, עד שרצועות העלים היו ואקום הסתנן עם פתרון protoplast מעכב המכיל. בנוסף, בעת יצירת רצועות עלי 1 מ&quot;מ זה מאוד חשוב לחתוך או לחתוך את העלים ולא &quot;צ&#39;ופ&quot; או לכתוש אותן, כפי שזה מוביל לפגיעה מוגזמת ובכך תשואת protoplast נמוכה יותר. הבדל קריטי בין השיטה המתוארת כאן וpublishe האחרשיטות d היא השימוש במעכבי RNase ומעכבי תעתיק. רוב השיטות שפותחו לשורשי ארבידופסיס, שממנו ניתן להפיק protoplasts בקלות רבה יותר. עם זאת, כשעובד עם עלים, למעט mesophyll, יש צורך להגדיל את זמן דור protoplast. לכן חשוב לכלול מעכבים אלה כדי להגן מפני שינויים בביטוי גנים כתוצאה מטיפול protoplast הדור עוצמה (מידע לא מוצג). עם זאת, נוכחותם של המעכבים מובילה לחוסר יכולת לפתח תגובת שעתוק, או על ידי החלפת גנים או לבטל, העשוי להפוך את protoplasts פגיע יותר כמו זה מוביל לאובדן הגמישות שבה כדי לאזן את הלחצים של protoplasting הליך. יש לנו להשתמש בשיטה המתוארת כאן בהצלחה עם מספר GFP-לבטא קווי ארבידופסיס. חשוב מכך, יש לנו להשתמש בשיטה זו עם קווי GFP להביע GFP באופן חזק בהגרעין, או הרבה יותר חלש באופן cytosolic non-localized/diffuse, כפי שקורה עם KC464 וKC274 קווים המשמשים כאן. שני הסוגים של קווים תואמים את השיטה ואת תשואת שברים מועשרים ברמה גבוהה של protoplasts GFP להביע-(איור 2 ו 3). השיטה יכולה להתאים בקלות לfluorophores האחר, אם כי יש לבחור fluorophore לניאון שהוא שונה באופן משמעותי מautofluorescence של תאים מתים / למות כדי לשמר את היכולת לבחור בתאים חיים.

<table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> שם המגיב </td><td> חברה </td><td> מספר קטלוגים </td></tr><tr><td> Cellulase R-10 </td><td> Melford </td><td> C8001 </td></tr><tr><td> Cellulase RS </td><td> Melford </td><td> C8003 </td></tr><tr><td> Macerozyme R-10 </td><td> Melford </td><td> M8002 </td></tr><tr><td> BSA </td><td> סיגמה אולדריץ </td><td> A3912 </td></tr><tr><td> ProtectRNA </td><td> סיגמה אולדריץ </td><td> R7397 </td></tr><tr><td> Actinomycin D </td><td> סיגמה אולדריץ </td><td> A1410 </td></tr><tr><td> מסננת תא 70 מיקרומטר </td><td> דיג </td><td> FB35181 </td></tr><tr><td> 50 מיקרומטר filcon מסנני כוס מסוג </td><td> BD Biosciences </td><td> 340630 </td></tr></tbody></table>

cell specific analysis of arabidopsis leaves using fluorescence activated cell sorting

לאחר תחילת primordium העלה, הצטברות ביומסה נשלטת בעיקר על ידי תרבות של תאים והתרחבות העלים 1. עם זאת, עלה ארבידופסיס הוא איבר מורכב מורכבים מסוגים רבים ושונים של תאים וכמה מבנים. במקביל, עלה הגידול מכיל תאים בשלבים שונים של פיתוח, עם תאים הרחוקים מהפטוטרת להיות הראשון לעצור את ההרחבה ולעבור הזדקנות 1. תאים שונים בתוך העלה, אפוא, חלוקה, מאריכים או מבדל; פעיל, לחוץ או מת; ו / או להגיב לגירויים בתת קבוצות של הסוג הסלולרי שלהם בכל זמן נתון. זה עושה את המחקר הגנומי של מאתגר עלה: למשל בעת ניתוח נתוני ביטוי מעלים שלמים, אותות מרשתות גנטיות הפועלות באזורים ברורים סלולריים תגובה או סוגי תאים יהיה מבולבל, וכתוצאה מפרופיל מדויק שנוצר. לכתובת זו, שלשיטות everal כבר תאר המאפשרות לימודים של ביטוי גני התא ספציפי. אלה כוללים microdissection ליזר לכידה (LCM) 2 או צמחים המבטאים GFP משמשים למיון לאחר פלואורסצנטי הופעל תא (FACS) 3,4, המערכת השלמה שתוארה לאחרונה למשקעים גרעיניים 5 ו immunoprecipitation של 6 polysomes הדור וprotoplast. FACS שמש בהצלחה במשך מספר מחקרים, כולל ההצגה שזהות התא והמרחק מקצה השורש הייתה השפעה משמעותית על פרופילי הביטוי של מספר רב של גנים 3,7. FACS של קווי GFP יש גם שמש כדי להדגים בקרת שעתוק תא ספציפי בתגובות חנקן שורש ופיתוח לרוחב שורש 8, מתח מלח הפצת אוקסין 9 בשורש 10 וליצור מפה של ביטוי גני meristem הקודקוד לירות ארבידופסיס 11. למרותFACS יש בעבר נהג למיין protoplasts נגזר העלה ארבידופסיס מבוסס על autofluorescence 12,13, עד כה השימוש בFACS על קווי ארבידופסיס מבטאים GFP בעלים כבר מאוד מוגבל 4. בפרוטוקול הבא אנו מתארים שיטה לקבלת protoplasts העלה ארבידופסיס התואמים FACS תוך מזעור ההשפעה של משטר דור protoplast. אנחנו מדגימים את השיטה באמצעות קו ארבידופסיס KC464, שמביע GFP באפידרמיס adaxial 14, KC274 הקו, אשר מביעים GFP ברקמת כלי הדם 14 וקו ארבידופסיס TP382, שמבטא GFP כפול לבנות צמוד לאות לוקליזציה גרעינית ב את תאי שמירה (מידע לא מוצג; איור 2). כרגע אנחנו משתמשים בשיטה זו כדי ללמוד גם ביטוי תא מסוג מסוים במהלך פיתוח ומתח, כמו גם אוכלוסיות תאים הטרוגניים בשלבים שונים של הזדקנות.

Watch this Scientific Journal Video about Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting at JoVE.com

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

שיטה להפקה<em&gt; ארבידופסיס</em&gt; Protoplasts עלים התואמים את מיון תא הופעל פלואורסצנטי (FACS), המאפשר ללימודים של אוכלוסיות תאים ספציפיות. שיטה זו תואמת לכל<em&gt; ארבידופסיס</em&gt; קו שמבטא GFP בתת קבוצה של תאים.

ניתוח ספציפי של תא<em&gt; ארבידופסיס</em&gt; עלים באמצעות מיון תא הופעל פלואורסצנטי

After initiation of the leaf primordium, biomass accumulation is controlled mainly by cell proliferation and expansion in the leaves1. However, the ...

Research

JoVE Journal

Biology

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

Fluorescence Activated Cell Sorting of Plant Protoplasts

מיון פלואורסצנטי תא פעיל של Protoplasts הצמח

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

חקירת רקמות ו איברים ספציפיים התגובות Phytochrome באמצעות FACS בסיוע נייד מסוג פרופיל ביטוי ספציפי ארבידופסיס thaliana</em

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called ...

Heterokaryon Technique for Analysis of Cell Type-specific Localization

Heterokaryon טכניקה לניתוח של לוקליזציה Cell סוג ספציפי

A significant number of proteins are regulated by subcellular trafficking or nucleocytolasmic shuttling.  These proteins display a diverse array of ...

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting (LIMACS): a Novel Method to Analyze Protein-lipid Interaction

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting LIMACS: a Novel Method to Analyze Protein-lipid Interaction

שלפוחיות בתיווך זיקה ליפידים כרומטוגרפיה באמצעות Cell מגנטי מיון פעיל (LIMACS): שיטה חדשה לנתח חלבון, שומנים אינטראקציה

The analysis of lipid protein interaction is difficult because lipids are embedded in cell membranes and therefore, inaccessible to most purification ...

Bromodeoxyuridine (BrdU) Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Bromodeoxyuridine BrdU Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Bromodeoxyuridine (BrdU) תיוג ומיון לאחר פלואורסצנטי תא פעיל עבור זיהוי, תרבות עצמאית של פחמן אורגני מומסים משפיל Bacterioplankton

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification ...

A Simple Method for Imaging Arabidopsis Leaves Using Perfluorodecalin as an Infiltrative Imaging Medium

A Simple Method for Imaging Arabidopsis Leaves Using Perfluorodecalin as an Infiltrative Imaging Medium

שיטה פשוטה הדמיה ארבידופסיס מותיר שימוש Perfluorodecalin כנושאת הדמיה Infiltrative

The problem of acquiring high-resolution images deep into biological samples is widely acknowledged1. In air-filled tissue such as the spongy mesophyll of ...

Optimized Staining and Proliferation Modeling Methods for Cell Division Monitoring using Cell Tracking Dyes

אופטימיזציה שיטות דוגמנות מכתימה והפצת נשק לניטור חלוקת תא באמצעות צבעי מעקב סלולרי

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of ...

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting (FACS)

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting FACS

בידוד של פיברובלסטים נורמלים והסרטן הקשורים מרקמות טריות על ידי מיון תא הופעל פלואורסצנטי (FACS)

Cancer-associated fibroblasts (CAFs) are the most prominent cell type within the tumor stroma of many cancers, in particular breast carcinoma, and their ...

Single Cell Micro-aspiration as an Alternative Strategy to Fluorescence-activated Cell Sorting for Giant Virus Mixture Separation

תא בודד מיקרו-שאיפה כאסטרטגיה חלופית מיון תאים פלואורסצנטית מופעל עבור הפרדה וירוס ענק תערובת

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or ...

Fluorescence-Activated Cell Sorting for the Isolation of Scleractinian Cell Populations

תא מיון המופעל על ידי קרינה פלואורסצנטית לבידוד של אוכלוסיות תאים בלובן המין

Coral reefs are under threat due to anthropogenic stressors. The biological response of coral to these stressors may occur at a cellular level, but the ...