Name: a fluorescence-based exonuclease assay to characterize dmwrnexo, orthologue of human progeroid wrn exonuclease, and its application to other nucleases
Uploaded: 2013-12-23T13:00:00
Description: Watch this Scientific Journal Video about A Fluorescence-based Exonuclease Assay to Characterize DmWRNexo, Orthologue of Human Progeroid WRN Exonuclease, and Its Application to Other Nucleases at JoVE

We thank the cross-council New Dynamics of Ageing Programme for funding this work [ES/G037086/1] and Prof Dave Sherratt (Department of Biochemistry, University of Oxford) for access to the Fuji FLA-3000.

1. Preparation of Substrate Oligonucleotides
<ol>
	<li>Synthesize custom oligonucleotides.
	<ol>
		<li>Design one single-stranded oligonucleotide with a 5&#39;-conjugated fluorescein molecule; this will be the backbone for every substrate. (Note that this is for a 3&#39;-5&#39; exonuclease; for a 5&#39;-3&#39; polarity exonuclease use a 3&#39;-conjugated backbone strand). If polarity is not known, both 3&#39; and 5&#39; should be tested.</li>
		<li>Design complementary strands such that when annealed to the fluorescent...

<ol>
	<li>Mason, P. A., Cox, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+DNA+exonucleases+in+protecting+genome+stability+and+their+impact+on+ageing.">The role of DNA exonucleases in protecting genome stability and their impact on ageing.</a> Age (Dordr. 34, 1317-1340 (2012).</li><li>Payne, M., Hickson, I. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+instability+and+cancer:+lessons+from+analysis+of+Bloom's+syndrome).">Genomic instability and cancer: lessons from analysis of Bloom's syndrome).</a> Biochem. Soc. Trans. 37, 553-559 (2009).</li><li>Yu, C. E., Oshima, J., Fu, Y. H., Wijsman, E. M., Hisama, F., Alisch, R., Matthews, S., Nakura, J., Miki, T., Ouais, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Positional+cloning+of+the+Werner's+syndrome+gene.">Positional cloning of the Werner's syndrome gene.</a> Science. 272, 258-262 (1996).</li><li>Huang, S., Li, B., Gray, M. D., Oshima, J., Mian, I. S., Campisi, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+premature+ageing+syndrome+protein,+WRN,+is+a+3'--&gt;5'+exonuclease.">The premature ageing syndrome protein, WRN, is a 3'--&gt;5' exonuclease.</a> Nat. Genet. 20, 114-116 (1998).</li><li>Goto, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Syndrome-causing+mutations+in+Werner+syndrome.">Syndrome-causing mutations in Werner syndrome.</a> Biosci. Trends. 2, 147-150 (2008).</li><li>Perry, J. J., Yannone, S. M., Holden, L. G., Hitomi, C., Asaithamby, A., Han, S., Cooper, P. K., Chen, D. J., Tainer, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=WRN+exonuclease+structure+and+molecular+mechanism+imply+an+editing+role+in+DNA+end+processing.">WRN exonuclease structure and molecular mechanism imply an editing role in DNA end processing.</a> Nat. Struct. Mol. Biol. 13, 414-422 (2006).</li><li>Opresko, P. L., Laine, J. P., Brosh, R. M., Seidman, M. M., Bohr, V. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordinate+action+of+the+helicase+and+3'+to+5'+exonuclease+of+Werner+syndrome+protein.">Coordinate action of the helicase and 3' to 5' exonuclease of Werner syndrome protein.</a> J. Biol. Chem. 276, 44677-44687 (2001).</li><li>Plchova, H., Hartung, F., Puchta, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+characterization+of+an+exonuclease+from+Arabidopsis+thaliana+reveals+similarities+to+the+DNA+exonuclease+of+the+human+Werner+syndrome+protein.">Biochemical characterization of an exonuclease from Arabidopsis thaliana reveals similarities to the DNA exonuclease of the human Werner syndrome protein.</a> J. Biol. Chem. 278, 44128-44138 (2003).</li><li>Hartung, F., Plchova, H., Puchta, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterisation+of+RecQ+homologues+in+Arabidopsis+thaliana.">Molecular characterisation of RecQ homologues in Arabidopsis thaliana.</a> Nucleic Acids Res. 28, 4275-4282 (2000).</li><li>Saunders, R. D., Boubriak, I., Clancy, D. J., Cox, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+a+Drosophila+ortholog+of+WRN+exonuclease+that+is+required+to+maintain+genome+integrity.">Identification and characterization of a Drosophila ortholog of WRN exonuclease that is required to maintain genome integrity.</a> Aging Cell. 7, 418-425 (2008).</li><li>Cox, L. S., Boubriak, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+Instability+in+Premature+Aging,+in+DNA+Damage+Repair,+Repair+Mechanisms+and+Aging.">DNA Instability in Premature Aging, in DNA Damage Repair, Repair Mechanisms and Aging.</a> Thomas, A.E., Eds. Nova Science Publishers. , 1-34 (2010).</li><li>Cox, L. S., Clancy, D. J., Boubriak, I., Saunders, R. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+Werner+Syndrome+in+Drosophila+melanogaster:+hyper-recombination+in+flies+lacking+WRN-like+exonuclease.">Modeling Werner Syndrome in Drosophila melanogaster: hyper-recombination in flies lacking WRN-like exonuclease.</a> Ann. N.Y. Acad. Sci. 1119, 274-288 (2007).</li><li>Boubriak, I., Mason, P. A., Clancy, D. J., Dockray, J., Saunders, R. D., Cox, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DmWRNexo+is+a+3'-5'+exonuclease:+phenotypic+and+biochemical+characterization+of+mutants+of+the+Drosophila+orthologue+of+human+WRN+exonuclease.">DmWRNexo is a 3'-5' exonuclease: phenotypic and biochemical characterization of mutants of the Drosophila orthologue of human WRN exonuclease.</a> Biogerontology. 10, 267-277 (2009).</li><li>Mason, P. A., Boubriak, I., Robbins, T., Lasala, R., Saunders, R., Cox, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Drosophila+orthologue+of+progeroid+human+WRN+exonuclease,+DmWRNexo,+cleaves+replication+substrates+but+is+inhibited+by+uracil+or+abasic+sites+:+Analysis+of+DmWRNexo+activity+in+vitro.">The Drosophila orthologue of progeroid human WRN exonuclease, DmWRNexo, cleaves replication substrates but is inhibited by uracil or abasic sites : Analysis of DmWRNexo activity in vitro.</a> Age (Dordr). , (2012).</li><li>Machwe, A., Xiao, L., Orren, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Length-dependent+degradation+of+single-stranded+3'+ends+by+the+Werner+syndrome+protein+(WRN):+implications+for+spatial+orientation+and+coordinated+3'+to+5'+movement+of+its+ATPase/helicase+and+exonuclease+domains.">Length-dependent degradation of single-stranded 3' ends by the Werner syndrome protein (WRN): implications for spatial orientation and coordinated 3' to 5' movement of its ATPase/helicase and exonuclease domains.</a> BMC Mol. Biol. 7, 6 (2006).</li><li>Mangerich, A., Veith, S., Popp, O., Fahrer, J., Martello, R., Bohr, V. A., Burkle, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+WRN+exonuclease+activity+by+isotope+dilution+mass+spectrometry.">Quantitative analysis of WRN exonuclease activity by isotope dilution mass spectrometry.</a> Mech. Ageing Dev. 133, 575-579 (2012).</li><li>Xue, Y., Ratcliff, G. C., Wang, H., Davis-Searles, P. R., Gray, M. D., Erie, D. A., Redinbo, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+minimal+exonuclease+domain+of+WRN+forms+a+hexamer+on+DNA+and+possesses+both+3'-+5'+exonuclease+and+5'-protruding+strand+endonuclease+activities.">A minimal exonuclease domain of WRN forms a hexamer on DNA and possesses both 3'- 5' exonuclease and 5'-protruding strand endonuclease activities.</a> Biochemistry. 41, 2901-2912 (2002).</li><li>Machwe, A., Ganunis, R., Bohr, V. A., Orren, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+blockage+of+the+3'--&gt;5'+exonuclease+activity+of+WRN+protein+by+certain+oxidative+modifications+and+bulky+lesions+in+DNA.">Selective blockage of the 3'--&gt;5' exonuclease activity of WRN protein by certain oxidative modifications and bulky lesions in DNA.</a> Nucleic Acids Res. 28, 2762-2770 (2000).</li></ol>

Determination of exonuclease activity of purified proteins requires the analysis of DNA cleavage products. Sequential cleavage of DNA by exonucleases can be visualized by separation of labeled cleavage products on acrylamide gels. Historically this involved end-labeling of the DNA substrate with a radiolabel (e.g. 32P or 35S), but with the disadvantages inherent in use of radiolabel (cost, safety issues, and instability over time). To overcome these problems, we have developed an exonucleas...

Nucleases serve a vital role in cells in removing damaged DNA, resolving nonduplex structures such as Holliday junctions and providing proof-reading capacity during DNA replication, both intrinsic within DNA polymerases and extrinsic to them1. Nucleases can act either by sequentially degrading DNA from free ends (exonucleases) or by cleaving internal phosphodiester bonds within a longer DNA molecule (endonucleases). Loss of nuclease activity can result in highly specific genome instability phenotypes. While mutation of the RecQ helicase family member BLM result in excessively high rates of sister chromatid exchange and globally elevated cancer rates (reviewed byPayne and Hickson2), mutation of the highly related WRN protein leads to premature aging3; the major significant difference between these two family members is the presence of a 3&#39;-5&#39; exonuclease domain with in WRN4. Evidence of a critical role of the WRN exonuclease in maintaining genome stability has accumulated from analysis of genotypes in WS patients5, together with point mutation and deletion studies in human cells, backed by crystallographic studies of the isolated exonuclease domain6. However, cooperation and cross talk between WRN&#39;s exonuclease activity and its central helicase activity7 makes it difficult to tease apart the functionality of each and their relative contributions to genome stability. In plants and lower metazoan animals, WRN exonuclease activity is present on a single polypeptide lacking helicase activity8-10 (reviewed in&#160;Cox and Boubriak11); it has been demonstrated biochemically in Arabidopsis that this exonuclease acts coordinately with the cognate WRN helicase, effectively reconstituting the combined enzyme activities observed in vertebrate WRN9. We have studied WRN exonuclease in Drosophila since the excellent genetic tools allow analysis of the impact of exonuclease mutation (without impacting on the presumptive cognate helicase) at the whole organism level and through development10,12. Moreover, we have cloned, expressed, and purified recombinant Drosophila WRN exonuclease (DmWRNexo) allowing full biochemical analysis of its enzyme properties13,14.
Nuclease analysis in vitro has traditionally been conducted using radiolabeled oligonucleotides, assessing degradation by looking for laddering of products on acrylamide gels4,8,15. While sensitive, such assays are not quantitatively reproducible day-to-day because of radioactive decay of the labeled substrates. Additionally, handling and disposal of radioactive reagents pose significant environmental and health issues; sourcing of radiolabel is also becoming increasingly problematic. An alternative recent method assesses the amount of the final degradation product by mass spectrometry16. However, it is time consuming (taking several days), requires specialized equipment, and the readout is the amount of end product (single nucleotide) so is not suitable for sensitive measurement of aspects such as enzyme processivity or for determining whether some nucleotides, sequences, or modifications lead to nuclease pausing or halt. To overcome these problems, we have adapted the traditional gel-based assays for use with fluorescent oligonucleotide substrates, generating stably labeled substrates that can be used reproducibly over long time periods and thus allow direct comparison of nuclease activities under different conditions.

<table border="1">
	<tbody>
		<tr>
			<td></td>
			<td></td>
			<td width="10%"></td>
			<td>Reagent/Material</td>
		</tr>
		<tr>
			<td>Custom oligonucleotides</td>
			<td>Eurogentec</td>
			<td></td>
			<td>It is necessary to obtain these at high purity e.g. with PAGE purification.</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>5&#39;FLO</td>
			<td>fluoresescein-5&#39; GAACTATGGCTCTC 
			GAGTGCTAGGACATGTCTGA 
			CTACGTACAAGTCACC - 3&#39;</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>bubble</td>
			<td>5&#39;- GGTGACTTGTACGT 
			AGTCAGACATGTCCTAGCAC 
			TCGAGAGCCATAGTTC-3&#39;</td>
		</tr>
		<tr>
			<td>40% 19:1 Acrylamide solution</td>
			<td>Severn Biotech</td>
			<td>20-2400-05</td>
			<td>CAUTION: potent neurotoxin so gloves should be worn at all times</td>
		</tr>
		<tr>
			<td>His-Trap columns (1 ml)</td>
			<td>GE Healthcare</td>
			<td>17-5247-01</td>
			<td></td>
		</tr>
		<tr>
			<td>All other reagents</td>
			<td>any reputable supplier</td>
			<td></td>
			<td>Molecular biology grade is necessary (DNase-free); microfuge tubes similarly should be DNase- and RNase-free</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td></td>
			<td>Equipment</td>
		</tr>
		<tr>
			<td>Hoefer SE400 gel apparatus</td>
			<td>Hoefer</td>
			<td>SE400-15-1.5</td>
			<td></td>
		</tr>
		<tr>
			<td>FLA-3000 (phosphor and fluorescence imager)</td>
			<td>Fuji</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Image Reader V2.02</td>
			<td>FujiFilm</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Image Gauge V3.3</td>
			<td>FujiFilm</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

a fluorescence-based exonuclease assay to characterize dmwrnexo, orthologue of human progeroid wrn exonuclease, and its application to other nucleases

WRN exonuclease is involved in resolving DNA damage that occurs either during DNA replication or following exposure to endogenous or exogenous genotoxins. It is likely to play a role in preventing accumulation of recombinogenic intermediates that would otherwise accumulate at transiently stalled replication forks, consistent with a hyper-recombinant phenotype of cells lacking WRN. In humans, the exonuclease domain comprises an N-terminal portion of a much larger protein that also possesses helicase activity, together with additional sites important for DNA and protein interaction. By contrast, in Drosophila, the exonuclease activity of WRN (DmWRNexo) is encoded by a distinct genetic locus from the presumptive helicase, allowing biochemical (and genetic) dissection of the role of the exonuclease activity in genome stability mechanisms. Here, we demonstrate a fluorescent method to determine WRN exonuclease activity using purified recombinant DmWRNexo and end-labeled fluorescent oligonucleotides. This system allows greater reproducibility than radioactive assays as the substrate oligonucleotides remain stable for months, and provides a safer and relatively rapid method for detailed analysis of nuclease activity, permitting determination of nuclease polarity, processivity, and substrate preferences.

Performing in vitro analysis of exonuclease activity requires a number of preparatory steps in addition to the actual analysis. An overview of the procedures is shown in Figure 1. 
Prior to conducting fluorescence-based exonuclease assays, it is critical to optimize detection of the fluorescently labeled oligonucleotide substrate following separation on urea-acrylamide gels using a suitable fluorescence imaging system. Filter choice is extremely important as this can ...

Watch this Scientific Journal Video about A Fluorescence-based Exonuclease Assay to Characterize DmWRNexo, Orthologue of Human Progeroid WRN Exonuclease, and Its Application to Other Nucleases at JoVE

A Fluorescence-based Exonuclease Assay to Characterize DmWRNexo, Orthologue of Human Progeroid WRN Exonuclease, and Its Application to Other Nucleases

Exonucleases play critical roles in ensuring genome stability. Loss of WRN exonuclease function results in premature aging. Studying substrates and other requirements of the nuclease in vitro can help elucidate its role in vivo. Here we demonstrate a rapid and reproducible fluorescence-based assay to measure its nuclease activity.

WRN exonuclease is involved in resolving DNA damage that occurs either during DNA replication or following exposure to endogenous or exogenous genotoxins. ...

Research

JoVE Journal

Biology

The Ladder Rung Walking Task: A Scoring System and its Practical Application.

Progress in the development of animal models for/stroke, spinal cord injury, and other neurodegenerative disease requires tests of high sensitivity to ...

Chromatin Immunoprecipitation (ChIP) to Assay Dynamic Histone Modification in Activated Gene Expression in Human Cells

Chromatin Immunoprecipitation ChIP to Assay Dynamic Histone Modification in Activated Gene Expression in Human Cells

In response to a variety of extracellular ligands, the STAT (signal transducer and activator of transcription) transcription factors are rapidly recruited ...

An Allele-specific Gene Expression Assay to Test the Functional Basis of Genetic Associations

The number of significant genetic associations with common complex traits is constantly increasing. However, most of these associations have not been ...

Reconstruction of 3-Dimensional Histology Volume and its Application to Study Mouse Mammary Glands

Histology volume reconstruction facilitates the study of 3D shape and volume change of an organ at the level of macrostructures made up of cells. It can ...

Characterization of G Protein-coupled Receptors by a Fluorescence-based Calcium Mobilization Assay

For more than 20 years, reverse pharmacology has been the preeminent strategy to discover the activating ligands of orphan G protein-coupled receptors ...

Use of MALDI-TOF Mass Spectrometry and a Custom Database to Characterize Bacteria Indigenous to a Unique Cave Environment (Kartchner Caverns, AZ, USA)

Use of MALDI-TOF Mass Spectrometry and a Custom Database to Characterize Bacteria Indigenous to a Unique Cave Environment Kartchner Caverns, AZ, USA

MALDI-TOF mass spectrometry has been shown to be a rapid and reliable tool for identification of bacteria at the genus and species, and in some cases, ...

A Method for Selecting Structure-switching Aptamers Applied to a Colorimetric Gold Nanoparticle Assay

Small molecules provide rich targets for biosensing applications due to their physiological implications as biomarkers of various aspects of human health ...

Using Digital Image Correlation to Characterize Local Strains on Vascular Tissue Specimens

Characterization of the mechanical behavior of biological and engineered soft tissues is a central component of fundamental biomedical research and ...

Targeted RNA Sequencing Assay to Characterize Gene Expression and Genomic Alterations

RNA sequencing (RNAseq) is a versatile method that can be utilized to detect and characterize gene expression, mutations, gene fusions, and noncoding ...

A Simple Fluorescence-based Reporter Assay to Identify Cellular Components Required for Ricin Toxin A Chain (RTA) Trafficking in Yeast

A Simple Fluorescence-based Reporter Assay to Identify Cellular Components Required for Ricin Toxin A Chain RTA Trafficking in Yeast

Bacterial and plant A/B toxins exploit the natural trafficking pathways in eukaryotic cells to reach their intracellular target(s) in the cytosol and to ...