Name: in vitro assay to evaluate the impact of immunoregulatory pathways on hiv-specific cd4 t cell effector function
Uploaded: 2013-10-15T17:45:00
Description: Watch this Scientific Journal Video about In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function at JoVE.com

우리는 항 PD-L1 차단 항체를 제공 고든 프리먼 감사합니다. 우리는 매사 추세 츠 종합 병원이 프로젝트에 자신의 귀중한 역할에 대한 모든 연구 참가자의 임상 및 실험실 직원을 감사드립니다. 국립 심장 폐 건강의 국립 연구소의 혈액 연구소 (RO1 HL-092565, DEK)이 연구는 알레르기의 국립 연구소와 국립 보건원 (DEK PO1 AI-080192)의 전염병에 의해 지원되었다. DEK는 퀘벡 건강 연구 기금의 연구 학술 경력 수상 (FR​​QS)에 의해 지원된다. FP는 연구와 하버드 글로벌 건강 연구소 (HGHI)에 매사 추세 츠 종합 병원 집행위원회의 화목 교부금에 의해 지원됩니다.

1. 피콜 분리를 통해 고갈 된 PBMC의 분리 <ol><li> 전체 혈액의 50 μL / ㎖에서 인간 CD8 + 공핍 칵테일을 첨가하여 CD8 + T 세포를 고갈. </li><li> 잘 섞어 실온 (18-25 ℃)에서 20 분 동안 품어. </li><li> 배양 후, (칼슘 + 마그네슘 또는 2 +없이 행크의 균형 소금 솔루션) HBSS로 전체 혈액을 혼합 Histopaque을 통해 계층. 30 분 (노 브레이크, 느린 가속) 340 RCF에 스핀. </li><li> PBMC를 수집하고 새로운 50 M...

<ol>
	<li>Zajac, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+immune+evasion+due+to+persistence+of+activated+T+cells+without+effector+function.">Viral immune evasion due to persistence of activated T cells without effector function.</a> J. Exp. Med. 188, 2205-2213 (1998).</li><li>Wherry, E. J., Blattman, J. N., Murali-Krishna, K., vander Most, R., Ahmed, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+persistence+alters+CD8+T-cell+immunodominance+and+tissue+distribution+and+results+in+distinct+stages+of+functional+impairment.">Viral persistence alters CD8 T-cell immunodominance and tissue distribution and results in distinct stages of functional impairment.</a> J. Virol. 77, 4911-4927 (2003).</li><li>Kwon, D. S., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+and+detrimental+roles+of+IL-10+in+HIV+pathogenesis.">Protective and detrimental roles of IL-10 in HIV pathogenesis.</a> Eur. Cytokine Netw. 21, 208-214 (2010).</li><li>Porichis, F., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+PD-1+in+HIV+pathogenesis+and+as+target+for+therapy.">Role of PD-1 in HIV pathogenesis and as target for therapy.</a> Curr. HIV/AIDS Rep. 9, 81-90 (2012).</li><li>Wherry, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T+cell+exhaustion.">T cell exhaustion.</a> Nat. 12, 492-499 (2011).</li><li>Trautmann, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Upregulation+of+PD-1+expression+on+HIV-specific+CD8++T+cells+leads+to+reversible+immune+dysfunction.">Upregulation of PD-1 expression on HIV-specific CD8+ T cells leads to reversible immune dysfunction.</a> Nat. Med. 12, 1198-1202 (2006).</li><li>Day, C. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+expression+on+HIV-specific+T+cells+is+associated+with+T-cell+exhaustion+and+disease+progression.">PD-1 expression on HIV-specific T cells is associated with T-cell exhaustion and disease progression.</a> Nature. 443, 350-354 (2006).</li><li>Brockman, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-10+is+up-regulated+in+multiple+cell+types+during+viremic+HIV+infection+and+reversibly+inhibits+virus-specific+T+cells.">IL-10 is up-regulated in multiple cell types during viremic HIV infection and reversibly inhibits virus-specific T cells.</a> Blood. 114, 346-356 (2009).</li><li>Barber, D. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Restoring+function+in+exhausted+CD8+T+cells+during+chronic+viral+infection.">Restoring function in exhausted CD8 T cells during chronic viral infection.</a> Nature. 439, 682-687 (2006).</li><li>Zhang, J. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+up-regulation+is+correlated+with+HIV-specific+memory+CD8++T-cell+exhaustion+in+typical+progressors+but+not+in+long-term+nonprogressors.">PD-1 up-regulation is correlated with HIV-specific memory CD8+ T-cell exhaustion in typical progressors but not in long-term nonprogressors.</a> Blood. 109, 4671-4678 (2007).</li><li>Ndhlovu, Z. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-dimensional+immunomonitoring+models+of+HIV-1-specific+CD8+T-cell+responses+accurately+identify+subjects+achieving+spontaneous+viral+control.">High-dimensional immunomonitoring models of HIV-1-specific CD8 T-cell responses accurately identify subjects achieving spontaneous viral control.</a> Blood. 121, 801-811 (2013).</li><li>Porichis, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Responsiveness+of+HIV-specific+CD4+T+cells+to+PD-1+blockade.">Responsiveness of HIV-specific CD4 T cells to PD-1 blockade.</a> Blood. 118, 965-974 (2011).</li><li>Kwon, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD4++CD25++regulatory+T+cells+impair+HIV-1-specific+CD4+T+cell+responses+by+upregulating+interleukin-10+production+in+monocytes.">CD4+ CD25+ regulatory T cells impair HIV-1-specific CD4 T cell responses by upregulating interleukin-10 production in monocytes.</a> 86, 6586-6594 (2012).</li></ol>

뜨는 컬렉션이 실험 설계의 필수적인 부분입니다. 루미 넥스 분석을위한 상층 액을 수확하면, 분액 만들어주기 - 해동 동결에 의한 단백질 분해를 방지하기 위해 -80 ° C에 보관 하였다. 냉동과 해동 단백질 및 동결 해빙을 최소화하여 가혹한 과정이 될 수 있습니다, 신호 분석에 극대화 될 것입니다. 따라서, 동일한 횟수를 동결 - 해동 된 분액에서 작업 할 때 반복 가능하고보다 정확한 데이터를 ?...

영구 바이러스 감염 동안 바이러스의 특정 T-세포는 T 세포의 고갈로 알려진 과정에서 기능적 결함을 취득. 초기 만성 바이러스 감염의 쥐 LCMV 모델에서 생체 내 연구에 지쳐 바이러스 특정 T 세포는 바이러스 성 감염 세포에 대한 세포 용해 기능을 감소 증식 할 수있는 능력을 잃게하고 IL-2, TNF-와 같은 사이토 카인을 생산하는 능력을 감소 한 것으로 나타났다 α 1,2를 IFN-γ는. 같은 PD-1과 IL-10 등의 면역 조절 경로의 복잡한 네트워크는 만성 감염시 상향 조절 및 (3,4 검토) T 세포 기능 장애에 기여하고 있습니다.에서 LCMV 마우스에이 억제 경로에 대한 항체를 차단 생체 관리 모델은 T 세포 고갈 (5 검토) 부분적으로 가역적 인 현상임을 나타내는 소진 바이러스 특정 T 세포의 기능 및 향상된 바이러스 제거를 복원. 일에 발견전자 LCMV 모델은 신속하게 HBV, HCV와 HIV 5와 같은 인간의 만성 바이러스 성 감염으로 확장되었다. 만성 HIV-1 감염, PD-1과 IL-10 경로는 감염된 과목에서 상향 조절하고 CD4와 반대로 바이러스 부하와 직접, 질병의 진행의 매개 변수와 상관 관계가 6-8을 계산합니다. LCMV 마우스 모델과 비슷, 인간의 T 세포 고갈이 부분적으로 가역적 인 현상, 나타내는 HIV 특정 CD4와 CD8 T 세포의 체외 복원 증식 PD-1, IL-10 경로의 항체 봉쇄. 그러나, 섬세한 인간의 샘플에 대한 실험의 성격뿐만 아니라 체외 분석, 이러한 개입에 의해 달성되는 기능 복원 프로필의 철저한 조사의 감도의 한계로 인해 막히게 결석. 대량 살상 무기 확산의 분석은, 지금까지 대부분의 연구에서 시험 만 신뢰할 수있는 시험 관내 분석했습니다, 그러나이 상호의 영향에 대한 증거의 놀라운 부족하다에 ventions : 세포 독성 T 세포의 1) 살상 능력, 2) 바이러스 복제에 대한 T 세포의 항 바이러스 효과, 3) 사이토 카인 분비 프로필 및 다른 세포 서브셋에 CD4 T 세포 도움에 4) 효과. 세포 내 사이토 카인 염색법 (ICS)는 매우 유용하고 널리 사용되는 유동 마우스 및 인간 모두에서 다양한 종류의 세포에서 사이토 카인의 생산을 검출하는 데 사용되는 기초 세포 계측법 분석이다. 또한 억제 경로의 항체 봉쇄의 효과를 조사하기 위해 사용되어왔다. ICS 내 분석, 사이토 카인 분비는 Brefeldin 및 / 또는 모 넨신의 첨가에 의해 차단된다. 세포 안에 갇혀 사이토 카인은 다음 다색 유동 세포 계측법을 사용하여 형광 항체로 검출된다. 일반적으로 항원 첨가 2 시간 이내에 첨가 Brefeldin 및 모 넨신, 모두 세포에 독성 때문에 분석의 기간은 일반적으로 항원 자극 후 10 또는 12 시간으로 제한된다. ICS 분석에 유용 내가되었습니다 강력한 기술이다N 세포를 항체에 노출 후 15 시간의 특정 기간 후에 압축 해제 된 마우스에서 항체 개입 차단의 생체 내 투여의 효과의 조사. 그러나, 인간의 샘플에서 억제 수용체의 봉쇄의 영향을 평가하는이 실험 방법의 응용 프로그램에 대한 몇 가지 제한 사항이 있습니다. 체외에서 10 또는 12 시간 자극 (인간 샘플 전형적 케이스)의 억제 경로의 항체 중재를 수행 할 때 표준 ICS 분석법에 의해 측정 한, 대부분의 경우에 억제 수용체의 봉쇄가 항원 특이적인 T 세포 응답의 주파수를 변경하지 않는다 6, 7. 평균 또는 평균 형광 강도로 측정 한 셀 당 사이토 카인 생산의 측정은 일치하지 않는 결과 6, 7, 10을 받고 있습니다. 한편, ICS는 이후 늦은 시점에서 수행 될 때 자극 (즉 육일), 사이토 카인 분비 C의 개수의 변화ELL 학생은 관찰 할 수있다. 차이가 변경된 증식, 생존, 그리고 6시 지정된 기간 동안 축적 이펙터 기능의 변화의 결합 된 효과입니다. 부분적으로 이러한 한계를 극복하기위한 한 가지 방법은 증식이 발생하기를 기다리지 않고 사이토 카인 분비 차단제의 첨가 전에 항원으로 오랜 기간 (예를 들면 36 시간, 60 시간, 등.) 동안 배양한다. 우리는 성공적 HIV 특정 CD4 및 CD8 T 세포 11,12 의해 사이토 카인 분비의 동력학을 결정하기 위해이 방법을 사용하고 있으나,이 방법은 작은 반응을 검출 할 수없고, 전체 사이토 카인 분비가 발생의 통합 결과를주지 않을 것이다 자극입니다. 따라서, ICS가 supernatan에서 사이토 카인의 mRNA 정량 또는 사이토 카인 분비의 측정에 비해 활성화 된 T 세포에 의해 생산 된 사이토 카인의 양에 억제 경로의 봉쇄의 영향을 검출하는 방법에 충분히 민감 아니다같은 시간 지점에서 t. 또한, 활성화 된 T 세포에 의해 생성되는 사이토 카인의 대부분이 긍정적이거나 부정적인 피드백에 기여에 의해 분비 방식으로 행동은 항원 제시 세포와의 상호 작용을 반복합니다. 따라서, ICS 분석 중에 Brefeldin 또는 모 넨신 첨가는 사이토 카인 분비를 방지하고, 따라서 T 세포의 자극은 최적이 아니다. 마지막으로, ICS 여러 사이토 카인의 검출은 유동 세포 계측법과 사이토 카인의 검출뿐만 아니라 특정 패널에 동시에 사용할 수있는 형광 색소의 수에 제약 조건에 대한 가용성과 항체의 감도에 의해 제한됩니다. 우리는 세포 (장갑차) 및 자연 살해 세포 (NK 세포)를 항원 제시하는 HIV 특정 CD4 T 세포에 의해 사이토 카인 분비를 조절하고 이후 CD4 도움말에서 면역 조절 경로의 영향을 평가하는 매우 중요한 생체 외 실험 방법을 개발했다. 이 방법은 또한 IMPA을 평가할 수있다PBMC를에서 CD4 T 세포를 파괴하거나 만 CD8 T 세포에 의해 인식되는 최적의 펩티드로 자극하여 CD8 T 세포의 기능에 억제 분자의 봉쇄 CT. 2) 넓은 패널을 조사 1) 제조 사이토킨 수준의 더 정확한 정량화를 수행 세포 내 사이토 카인 염색법 어 세이는 달리, 우리는 행 수 있도록하기 위해 HIV 특정 CD4 T 세포에 의한 사이토 카인의 분비를 방해하지 않기로 사이토 카인 또는 이펙터 분자, 3) 다른 세포 서브셋에 HIV 특정 CD4 T 세포에 의해 생산 된 사이토 카인의 영향을 평가. 우리는 관심의 면역 조절 경로에 대한 항체를 차단 존재 HIV-1 개그 펩티드 풀과 CD8 고갈 된 PBMC를 자극한다. 배양, 보통 48 시간 원하는 시간 후, 우리는 비드 어레이와 사이토 카인의 분비를 측정하고 다른 세포 부분 집합의 표현형 분석을 위해 또는 전사 분석을위한 하나 세포 펠렛을 수집하는 상층 액을 수집합니다. 의 t에서,주의그의 48 시간 시점, 우리는 T 세포 (12) 증식의 중요한 인구를 감지하지 않습니다. 이것은 유연한 접근이며,이 설계의 여러 가지 다른 적응 가설을 해결하기 위해 적용될 수있다. 예를 들어, (예 등 HIV 특정 CD4 T 세포 또는 PD-1 높은 CD4 T 세포, 등.) 개별 셀의 부분 집합은 상층 액과 세포 펠렛을 수집 한 다음 36 시간 동안 추가 배양하기 전에 배양 12 시간 후 정렬 할 수 있습니다 더 구체적으로 된 PBMC의 정의 모집단에 의한 사이토 카인 분비에 봉쇄 개입의 영향을 조사한다.

<table border="1">
		<tbody>
		 <tr>
			<td>Name of Reagent/Material</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		 </tr>
		 <tr>
			<td>Hanks Balanced Salt Solution without Ca2+ or Mg2+</td>
			<td>Sigma</td>
			<td>H9394</td>
			<td></td>
		 </tr>
		 <tr>
			<td>RPMI 1640</td>
			<td>Sigma</td>
			<td>R0883</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Histopaque-1077</td>
			<td>Sigma</td>
			<td>10771</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Human Serum AB</td>
			<td>Gemini BioProducts</td>
			<td>100-512</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Penicillin/Streptomycin</td>
			<td>Mediatech</td>
			<td>30 001 CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>L-glutamine</td>
			<td>Mediatech</td>
			<td>25 005 CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>HEPES buffer</td>
			<td>Mediatech</td>
			<td>25060CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>FcR blocking reagent, human</td>
			<td>Miltenyi</td>
			<td>130-059-901</td>
			<td></td>
		 </tr>
		 <tr>
			<td>RosetteSep Human CD8+ Depletion Cocktail </td>
			<td>Stem Cell </td>
			<td>15663</td>
			<td></td>
		 </tr>
		 <tr>
			<td>LIVE/DEAD Fixable Dead Cell Stain Kit, for UV excitation</td>
			<td>Invitrogen</td>
			<td>L23105</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Rneasy Mini Kit</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Improm-II Reverse Transcription System</td>
			<td>Promega</td>
			<td>A3800</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Brilliant II SYBR qPCR Low Rox Master Mix</td>
			<td>Agilent</td>
			<td>600830</td>
			<td></td>
		 </tr>
		 <tr>
			<td>BD Cytofix/Cytoperm Fixation/Permeabilization Solution Kit</td>
			<td>BD</td>
			<td>554714</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Tween-20</td>
			<td>Fisher</td>
			<td>BP337100</td>
			<td></td>
		 </tr>
		 <tr>
			<td>IFN-&gamma; primer</td>
			<td>Invitrogen</td>
			<td></td>
			<td>FOR: CGAGATGACTTCGAAAAGCTGA REV: TCTTCGACCTCGAAACAGCA</td>
		 </tr>
		 <tr>
			<td>GAPDH primer</td>
			<td>Invitrogen</td>
			<td></td>
			<td>FOR: TCATCATCTCTGCCCCCTCT REV: AGTGATGGCATGGACTGTGG</td>
		 </tr>
		</tbody>
 </table>

in vitro assay to evaluate the impact of immunoregulatory pathways on hiv-specific cd4 t cell effector function

T 세포 고갈은 만성 바이러스 감염 동안 실패 병원체 정리의 주요 요인이다. 같은 PD-1과 IL-10 등의 면역 조절 경로는이 지속적인 항원 노출에 상향 조절 및 확산의 손실 감소 세포 용해 기능에 기여하고, CD4와 CD8 T 세포에 의해 사이​​토 카인의 생산을 손상됩니다. LCMV 감염의 뮤린 모델에서 T 세포 반응을 증강 이러한 두 경로에 대한 항체를 블로킹 투여. 그러나, 사람의 샘플에서 세포의 사이토 카인 분비와 같은 차단의 효과를 측정하는 시험 관내 분석은 현재 존재하지 않는다. 우리의 프로토콜과 실험 방법은 정확하고 효율적으로 HIV에 감염된 과목에서 HIV 특정 CD4 T 세포에 의한 사이토 카인 생산의 복원을 정량화 할 수있게. 여기, 우리는 HIV 특정 CD4 T 세포와 다른 CEL에 미치는 영향에 의해 사이토 카인의 분비를 측정 할 수있는 시험 관내 실험 설계를 묘사L의 부분 집합. CD8 T 세포는 전혈로부터 고갈시키고, 잔존 된 PBMC는 피콜 분리 방법을 통해 분리 하였다. CD8 고갈 된 PBMC는 다음 HIV-1 개그 펩타이드 수영장 자극 한 후, 세포를 37 ° C, 5 % CO 2에서 배양하고, PD-L1 및 / 또는 IL-10Rα에 대한 항체를 차단하고 함께 배양 하였다. 48 시간, 상층 액 구슬의 배열 및 세포 펠렛에 의해 사이​​토 카인 분석을 위해 수집 한 후 QRT-PCR을 이용하여 세포 계측법 또는 전사 분석 흐름을 이용하여 표현형 분석도 수집했다. 더 자세한 분석을 위해, 서로 다른 세포 집단이 된 PBMC에서 선택적 집합 고갈 또는 같은 분석에서 평가되기 전에 유동 세포 계측법을 사용하여 정렬을 얻을 수 있었다. 이들 방법은 항원 특이적인 T-헬퍼 세포에 의해 시토 킨 생산의 조절을 결정하고, 면역 세포의 개체군 간의 기능적 상호 작용을 결정하는 매우 민감하고 구체적인 방법을 제공한다.

이 시험 관내 시스템을 사용하여 사이토 카인을 측정 할 때, 자극 제어 명에 비해 항원 특이적인 반응을 구별 할 수있을 것이 필수적이다. 일반적으로, 우리는 자극 제어하는​​ 분석의 선형 범위 내에서 있었다 없음에 비해 사이토 카인 수준의 최소 3 배 증가를 제공 항원 자극의 값으로 긍정적 인 반응을 고려했다. 우리는 약한 항원 특이 CD4 T 세포 반응을 관찰하기 위해 우리를있게, 0.16 P...

Watch this Scientific Journal Video about In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function at JoVE.com

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

우리는 HIV 특정 CD4 T 세포에 의한 사이토 카인 분비의 조절에 면역 경로의 역할을 조사하기 위해 시험 관내 분석을 개발 하였다.

시험 관내 분석에서 HIV 특정 CD4 T 세포의 이펙터 기능에 면역 경로의 영향을 평가하기

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are ...

Research

JoVE Journal

Immunology and Infection

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

Retroviral Transduction of T-cell Receptors in Mouse T-cells

마우스 T - 세포에서 T - 세포 수용체의 Retroviral 전달

T-cell receptors (TCRs) play a central role in the immune system. TCRs on T-cell surfaces can specifically recognize peptide antigens presented by antigen ...

연구

면역학 및 감염병학

Isolation and Th17 Differentiation of Na&iuml;ve CD4 T Lymphocytes

Isolation and Th17 Differentiation of Na&#239;ve CD4 T Lymphocytes

분리 및 나이브 CD4 T 림프구의 TH17 분화

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets ...

Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay

Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay

를 사용하여 폐렴 구균 식민지에서 생균제의 효과를 조사<em&gt; 체외</em&gt; 준수의 분석

Adherence of Streptococcus pneumoniae (the pneumococcus) to the epithelial lining of the nasopharynx can result in colonization and is considered a ...

Transplantation of Tail Skin to Study Allogeneic CD4 T Cell Responses in Mice

마우스에 동종 CD4 T 세포 반응을 연구하기 위해 테일 피부 이식

The study of T cell responses and their consequences during allo-antigen recognition requires a model that enables one to distinguish between donor and ...

Image-based Flow Cytometry Technique to Evaluate Changes in Granulocyte Function In Vitro

Image-based Flow Cytometry Technique to Evaluate Changes in Granulocyte Function In Vitro

이미지 기반 유동 세포 계측법 기술은 과립구 기능의 변화를 평가하기<em&gt; 체외</em

Granulocytes play a key role in the body&#8217;s innate immune response to bacterial and viral infections. While methods exist to measure granulocyte ...

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

이펙터 CD4의 입양 전송하여 쥐과 장내 염증의 유도<sup&gt; +</sup&gt; CD45RB<sup&gt; 높은</sup&gt; 면역 결핍 마우스에게 T 세포

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages ...

Mouse Na&#239;ve CD4+ T Cell Isolation and In vitro Differentiation into T Cell Subsets

Mouse Na&#239;ve CD4+ T Cell Isolation and In vitro Differentiation into T Cell Subsets

마우스 나이브 CD4<sup&gt; +</sup&gt; T 세포의 분리 및<em&gt; 시험관</em&gt; T 세포 하위 집합으로 차별화

Antigen inexperienced (na&#239;ve) CD4+ T cells undergo expansion and differentiation to effector subsets at the time of T cell receptor (TCR) recognition ...

Application of Long-term cultured Interferon-&#947; Enzyme-linked Immunospot Assay for Assessing Effector and Memory T Cell Responses in Cattle

소에 이펙터 및 메모리 T 세포 반응을 평가하기위한 장기 배양 인터페론-γ 효소 링크 된 Immunospot 분석의 응용 프로그램

Effector and memory T cells are generated through developmental programing of na&#239;ve cells following antigen recognition. If the infection is ...

Imaging CD4 T Cell Interstitial Migration in the Inflamed Dermis

염증이 진피의 이미징 CD4 T 세포 간질 마이그레이션

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral ...

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

<em&gt; 체외</em&gt; 임피던스 분광학을 사용하여 혈액 - 뇌 장벽 모델 : T 세포 - 내피 세포 상호 작용에 초점

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal ...