Name: investigating the effects of probiotics on pneumococcal colonization using an in vitro adherence assay
Uploaded: 2014-04-28T13:45:00
Description: Watch this Scientific Journal Video about Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay at JoVE.com

وأيد هذا العمل من خلال تمويل من معهد أبحاث الطفولة مردوخ وبرنامج دعم البنية التحتية التشغيلية للحكومة فيكتوريا.

1. إعداد الظهارية وخلايا البكتيرية <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ذوبان بال-23 الخلايا الظهارية <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> Prewarm الدنيا وسائل الإعلام الأساسية (MEM) تحتوي على 10٪ مصل بقري جنيني (FBS) في حمام مائي 37 درجة مئوية ...

<ol>
	<li>O'Brien, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burden+of+disease+caused+by+Streptococcus+pneumoniae+in+children+younger+than+5+years:+global+estimates.">Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates.</a> Lancet. 374, 893-902 (2009).</li><li>Bogaert, D., de Groot, R., Hermans, P. W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptococcus+pneumoniae+colonisation:+the+key+to+pneumococcal+disease.">Streptococcus pneumoniae colonisation: the key to pneumococcal disease.</a> Lancet Infect. Dis. 4 (04), 144-154 (2004).</li><li>Weinberger, D. M., Malley, R., Lipsitch, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype+replacement+in+disease+after+pneumococcal+vaccination.">Serotype replacement in disease after pneumococcal vaccination.</a> Lancet. 378 (10), 1962-1973 (2011).</li><li>Jacoby, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modelling+the+co-occurrence+of+Streptococcus+pneumoniae+with+other+bacterial+and+viral+pathogens+in+the+upper+respiratory+tract.">Modelling the co-occurrence of Streptococcus pneumoniae with other bacterial and viral pathogens in the upper respiratory tract.</a> Vaccine. 25, 2458-2464 (2007).</li><li>Kwambana, B., Barer, M., Bottomley, C., Adegbola, R., Antonio, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+acquisition+and+high+nasopharyngeal+co-colonisation+by+Streptococcus+pneumoniae+and+three+respiratory+pathogens+amongst+Gambian+new-borns+and+infants.">Early acquisition and high nasopharyngeal co-colonisation by Streptococcus pneumoniae and three respiratory pathogens amongst Gambian new-borns and infants.</a> BMC Infect. Dis. 11, (2011).</li><li>Licciardi, P. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protecting+against+pneumococcal+disease:+critical+interactions+between+probiotics+and+the+airway+microbiome.">Protecting against pneumococcal disease: critical interactions between probiotics and the airway microbiome.</a> PLoS Pathog. 8, (2012).</li><li>Popova, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beneficial+effects+of+probiotics+in+upper+respiratory+tract+infections+and+their+mechanical+actions+to+antagonize+pathogens.">Beneficial effects of probiotics in upper respiratory tract infections and their mechanical actions to antagonize pathogens.</a> J. Appl. Microbiol. 113 (6), 1305-1318 (2012).</li><li>Pracht, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PavA+of+Streptococcus+pneumoniae+modulates+adherence,+invasion,+and+meningeal+inflammation.">PavA of Streptococcus pneumoniae modulates adherence, invasion, and meningeal inflammation.</a> Infect. Immun. 73, 2680-2689 (2005).</li><li>Adamou, J. E., Wizemann, T. M., Barren, P., Langermann, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adherence+of+Streptococcus+pneumoniae+to+human+bronchial+epithelial+cells+(BEAS-2B).">Adherence of Streptococcus pneumoniae to human bronchial epithelial cells (BEAS-2B).</a> Infect. Immun. 66, 820-822 (1998).</li><li>Wong, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+Streptococcus+pneumoniae+adherence+to+human+epithelial+cells+in+vitro+by+the+probiotic+Lactobacillus+rhamnosus+GG.">Inhibition of Streptococcus pneumoniae adherence to human epithelial cells in vitro by the probiotic Lactobacillus rhamnosus GG.</a> BMC Res. Notes. 6 (1), 135 (2013).</li><li>Wescombe, P. A., Heng, N. C. K., Burton, J. P., Chilcott, C. N., Tagg, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptococcal+bacteriocins+and+the+case+for+Streptococcus+salivarius+as+model+oral+probiotics.">Streptococcal bacteriocins and the case for Streptococcus salivarius as model oral probiotics.</a> Future Microbiol. 4, 819-835 (2009).</li><li>Di Pierro, F., Adami, T., Rapacioli, G., Giardini, N., Streitberger, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+evaluation+of+the+oral+probiotic+Streptococcus+salivarius+K12+in+the+prevention+of+recurrent+pharyngitis+and/or+tonsillitis+caused+by+Streptococcus+pyogenes+in+adults.">Clinical evaluation of the oral probiotic Streptococcus salivarius K12 in the prevention of recurrent pharyngitis and/or tonsillitis caused by Streptococcus pyogenes in adults.</a> Expert. Opin. Biol. Ther. 13 (3), 339-343 (2013).</li><li>Fiedler, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+mechanisms+of+respiratory+tract+streptococci+against+Streptococcus+pyogenes+biofilm+formation+and+epithelial+cell+infection.">Protective mechanisms of respiratory tract streptococci against Streptococcus pyogenes biofilm formation and epithelial cell infection.</a> Appl. Environ. Microbiol. 79, 1265-1276 (2013).</li><li>Slotved, H. C., Satzke, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+growth+of+pneumococcal+isolates+representing+23+different+serotypes.">In vitro growth of pneumococcal isolates representing 23 different serotypes.</a> BMC Res. Notes. 6, 10-1186 (2013).</li><li>Carvalho, M. d. G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+and+improvement+of+real-time+PCR+assays+targeting+lytA,+ply,+and+psaA+genes+for+detection+of+pneumococcal+DNA.">Evaluation and improvement of real-time PCR assays targeting lytA, ply, and psaA genes for detection of pneumococcal DNA.</a> J. Clin. Microbiol. 45, 2460-2466 (2007).</li><li>Tonnaer, E. L. G. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+glycosaminoglycans+in+the+attachment+of+pneumococci+to+nasopharyngeal+epithelial+cells.">Involvement of glycosaminoglycans in the attachment of pneumococci to nasopharyngeal epithelial cells.</a> Microbes Infect. 8, 316-322 (2006).</li><li>Smith-Vaughan, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+nasal+bacterial+load+and+its+association+with+otitis+media.">Measuring nasal bacterial load and its association with otitis media.</a> BMC Ear Nose Throat Disord. 6, (2006).</li><li>Letourneau, J., Levesque, C., Berthiaume, F., Jacques, M., Mourez, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+assay+of+bacterial+adhesion+onto+mammalian+epithelial+cells.">In vitro assay of bacterial adhesion onto mammalian epithelial cells.</a> J. Vis. Exp. , (2011).</li></ol>

جزء حاسم من هذا الاختبار هو إضافة تركيزات مناسبة من S. اللعابية والمكورات الرئوية في الأقسام 3.1.7 و3.1.12. وتقدر تركيزات باستخدام قراءات OD ولكن لم يتم تحديد قائح بالضبط حتى تحسب لوحات في اليوم التالي. لهذا السبب، فإننا ننصح أداء منحنيات النمو لقياس OD وتعول قابلة للحي?...

العقدية الرئوية (المكورة الرئوية و) هي نوع من البكتيريا موجبة الجرام التي يمكن أن تسبب العدوى بما في ذلك الالتهاب الرئوي والتهاب الأذن الوسطى، والتهاب السحايا. بل هو سبب رئيسي للمرض في الأطفال في البلدان المنخفضة الدخل ومسؤولة عن ما يقدر ب 800،000 حالة وفاة للأطفال دون سن الخامسة سنويا 1. وكثيرا ما تتم المكورات الرئوية في البلعوم الأنفي للأطفال الصغار. على الرغم من أن هذا الاستعمار يعتبر عموما أعراض، فإنه يسبق عدوى المكورات الرئوية وبمثابة خزان للبكتيريا في التجمعات البشرية 2. تطعيم المكورات الرئوية بشكل فعال يقلل من نقل الأنماط المصلية الواردة في اللقاح. ومع ذلك، هناك أكثر من 90 الأنماط المصلية للمكورات الرئوية، والتطعيم يمكن أن يؤدي إلى استبدال النمط المصلي، حيث يتبع القضاء على الأنماط المصلية لقاح ارتفاع في النقل والأمراض الناجمة عن الأنماط المصلية nonvaccine 3. أيضا، في بعض المجموعات السكانية المعرضة للخطر، المكورات الرئويةالاستعمار غالبا ما يحدث في الحياة في وقت مبكر جدا، قبل إعطاء الجرعة الأولى لقاح 4،5. في الآونة الأخيرة، وقد اقترح استخدام البروبيوتيك باعتباره استراتيجية إضافية لمنع الالتهاب الرئوي الاستعمار 6،7. وقد استخدمت في المختبر فحوصات التمسك دراسة التقيد المكورات الرئوية 8،9. وقد تم تكييف هذه المقايسات للتحقيق في تأثير بروبيوتيك rhamnosus اكتوباكيللوس GG (LGG) على الالتزام المكورات الرئوية 10. بالإضافة إلى LGG وغيرها من بكتيريا حمض اللاكتيك، المكورات العقدية اللعابية، وهو من سكان شيوعا من تجويف الفم، وقد تم التحقيق باعتباره بروبيوتيك المحتملة لالجهاز التنفسي بسبب الاستعمار إمكاناتها وقدرتها على تثبيط المكورات الرئوية ومسببات الأمراض التنفسية الأخرى في المختبر 11 - 13. بروتوكول المعروضة هنا يصف مقايسة التقيد تستخدم للتحقيق في آثار S. اللعابية K12 على الالتزام المكورات الرئويةإلى خط الخلايا الظهارية البشرية CCL-23. قبل استخدامها في الفحص، وجرى تقييم عزلات المكورات الرئوية لقدرات الالتزام، والنمو وخصائص الالتزام يمكن أن تختلف بشكل كبير بين العزلات 10،14. منحنيات نمو المكورات الرئوية وS. أجريت اللعابية لتحديد مرحلة منتصف السجل والتركيز تقدير (وحدات تشكيل مستعمرة أو كفو / مل) من خلال الكثافة الضوئية (OD، الشكل 1). فمن المستحسن لدراسة النمو من خلال عدد قابلة للحياة والتطوير التنظيمي لكل عزل قبل استخدامها في الفحص. هذا الاختبار لا يمكن أن يؤديها في أي مختبر زراعة الأنسجة مع مرافق القياسية والمعدات. في هذا البروتوكول، وآثار ثلاث جرعات من S. اللعابية تدار 1 ساعة قبل إضافة المكورات الرئوية على التزام S. PMP843 الرئوية، وهو النمط المصلي 19F عزل النقل المستمدة من مسحة البلعوم، ويتم فحص. يتم عرض طريقتين مختلفتين لتقدير المكورات الرئوية تمسكا: الطلاء على أجار الدم لردعالألغام التهم قابلة للحياة، واستخراج الحمض النووي والكشف عن الجين lytA المكورات الرئوية التي كتبها QPCR 15. تمسك بروتوكول الفحص الأساسية يمكن تعديلها بسهولة لاختبار الجرعات أو الوقت لإقامة البروبيوتيك مختلفة، ويمكن أن تستخدم أيضا مع السلالات أو الأنواع البكتيرية الأخرى.

<table border="0" cellpadding="0" cellspacing="0" width="1318">
	<colgroup>
		<col />
		<col />
		<col />
		<col span="2" />
	</colgroup>
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:264px;">Minimum Essential Media (MEM)</td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td style="width:147px;">SH30244.01</td>
			<td style="width:377px;"> </td>
			<td style="width:377px;"> </td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:264px;">Fetal Bovine Serum (FBS)</td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td>SH30084.03</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">T-75 Flask</td>
			<td style="width:155px;">Nunc</td>
			<td>156472</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">CCL-23 cells</td>
			<td style="width:155px;">ATCC</td>
			<td style="width:147px;">CCL-23</td>
			<td style="width:377px;"> </td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Trypsin</td>
			<td>Life Technologies</td>
			<td>15090046</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:264px;">24-well cell culture plate</td>
			<td style="width:155px;">Nunc</td>
			<td style="width:147px;">142475</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Horse blood agar (HBA) plates</td>
			<td style="width:155px;">Oxoid</td>
			<td style="width:147px;">PP2001</td>
			<td>Sheep blood agar plates also acceptable</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Todd-Hewitt Broth</td>
			<td style="width:155px;">Oxoid</td>
			<td style="width:147px;">CM0189</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Yeast Extract</td>
			<td style="width:155px;">Beckton Dickinson</td>
			<td style="width:147px;">212750</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Digitonin</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:147px;">D141-100MG</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Disposable cuvettes</td>
			<td style="width:155px;">Kartell</td>
			<td>1938</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Heparin</td>
			<td style="width:155px;">Pfizer</td>
			<td style="width:147px;">2112105</td>
			<td>comes in sterile ampules at 5,000IU/5mL </td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">sterile spreader</td>
			<td style="width:155px;">Technoplas</td>
			<td style="width:147px;">S10805050</td>
			<td style="width:377px;">alternatively, a glass spreader can be dipped in 96% ethanol and flame sterilized before each use</td>
			<td style="width:377px;"> </td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Lysozyme</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">L6876</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Mutanolysin</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">M9901</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Proteinase K</td>
			<td>Qiagen</td>
			<td>19133</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">SDS 20% solution</td>
			<td>Ambion </td>
			<td style="width:147px;">AM9820</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">RNase A</td>
			<td>Qiagen</td>
			<td style="width:147px;">19101</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">QIAamp DNA mini-kit (250)</td>
			<td>Qiagen</td>
			<td style="width:147px;">51306</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">LytA F primer</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">Custom made</td>
			<td>5&#39; -&#62; 3&#39; sequence ACGCAATCTAGCAGATGAAGCA</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">LytA R primer</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">Custom made</td>
			<td>5&#39; -&#62; 3&#39; sequence TCGTGCGTTTTAATTCCAGCT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">LytA probe</td>
			<td>Eurogentec</td>
			<td style="width:147px;">Custom made</td>
			<td colspan="2">5&#39; -&#62; 3&#39; sequence Cy5-TGCCGAAAACGCTTGATACAGGGAG-BHQ3, alternative fluorophores can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Nuclease free water</td>
			<td>Ambion</td>
			<td style="width:147px;">AM9906</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Brilliant III Ultra Fast QPCR mastermix</td>
			<td>Agilent Technologies </td>
			<td style="width:147px;">600880</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Thermo-Fast 96 Detection plate </td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td style="width:147px;">AB-1100</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:264px;">Ultra clear qPCR cap strips</td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td style="width:147px;">AB-0866</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Mx3005 QPCR System</td>
			<td style="width:155px;">Agilent Technologies </td>
			<td style="width:147px;">401449</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;"> </td>
			<td style="width:155px;"> </td>
			<td style="width:147px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">* alternative sources are available for most/all products listed</td>
			<td style="width:147px;"> </td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

investigating the effects of probiotics on pneumococcal colonization using an in vitro adherence assay

تمسك العقدية الرئوية (المكورة الرئوية و) لبطانة الظهارية من البلعوم الأنفي يمكن أن يؤدي إلى الاستعمار، ويعتبر شرطا أساسيا للعدوى المكورات الرئوية مثل الالتهاب الرئوي والتهاب الأذن الوسطى. في المختبر فحوصات الالتزام يمكن استخدامها لدراسة المرفق من المكورات الرئوية إلى الخلايا الظهارية الطبقات الوحيدة للتحقيق والتدخلات المحتملة، مثل استخدام البروبيوتيك، لمنع استعمار المكورات الرئوية. يتم استخدام بروتوكول الموصوفة هنا للتحقيق في الآثار المترتبة على اللعابية العقدية بروبيوتيك على التزام المكورات الرئوية إلى خط الخلايا الظهارية البشرية CCL-23 (التي يشار إليها أحيانا التهاب الكبد-2 خلايا). ينطوي على فحص ثلاث خطوات رئيسية: 1) إعداد الخلايا الظهارية والبكتيرية، 2) إضافة إلى البكتيريا الظهارية الطبقات الوحيدة الخلية، و3) الكشف عن المكورات الرئوية تمسكا من قبل التهم قابلة للحياة (التخفيف المتسلسل وتصفيح) أو الكمي في الوقت الحقيقي PCR (QPCR ). هذا تكhnique واضح ومباشر نسبيا ولا تتطلب معدات متخصصة أخرى من الإعداد زراعة الأنسجة. الفحص يمكن استخدامها لاختبار أنواع الكائنات الحية المجهرية الأخرى و / أو مثبطات المحتملة للاستعمار المكورات الرئوية ويمكن تعديلها بسهولة لمعالجة المسائل العلمية الأخرى بشأن الانضمام المكورات الرئوية والغزو.

النتائج من تجربة تمثيلية في المكورات الرئوية التي تمت إضافتها (S. الرئوية PMP843، وهو 19F عزل استعمار) لCCL-23 الخلايا 1 ساعة بعد إضافة S. اللعابية، وكان كميا الالتزام من قبل كل من المكورات الرئوية العد قابلة للحياة وlytA QPCR وترد في الجدول 2. وكانت النتائج ...

Watch this Scientific Journal Video about Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay at JoVE.com

Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay

في فحوصات المختبر التقيد يمكن استخدامها لدراسة إلحاق العقدية الرئوية لالظهارية الطبقات الوحيدة الخلية والتحقيق التدخلات المحتملة مثل استخدام البروبيوتيك لتثبيط استعمار المكورات الرئوية.

التحقيق في آثار البروبيوتيك على المكورات الرئوية الاستعمار باستخدام<em&gt; في المختبر</em&gt; الالتزام الفحص

Adherence of Streptococcus pneumoniae (the pneumococcus) to the epithelial lining of the nasopharynx can result in colonization and is considered a ...

Research

JoVE Journal

Immunology and Infection

Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay

In vitro Biofilm Formation in an 8-well Chamber Slide

In vitro Biofilm Formation in an 8-well Chamber Slide

تشكيل بيوفيلم في المختبر في غرفة الشرائح 8 جيد

The chronic nature of many diseases is attributed to the formation of bacterial biofilms which are recalcitrant to traditional antibiotic therapy. ...

A Microplate Assay to Assess Chemical Effects on RBL-2H3 Mast Cell Degranulation: Effects of Triclosan without Use of an Organic Solvent

والفحص صفيحة ميكروسكوبية لتقييم تأثيرات المواد الكيماوية على RBL-2H3 الصاري تحبب الخلايا: آثار التريكلوسان بدون استخدام مذيب عضوي

Mast cells play important roles in allergic disease and immune defense against parasites. Once activated (e.g. by an allergen), they degranulate, a ...

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

في المختبر الفحص لتقييم أثر مناعة مقررات تمهيدية بشأن فيروس نقص المناعة CD4 T محددة المستجيب خلية وظيفة

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are ...

Following in Real Time the Impact of Pneumococcal Virulence Factors in an Acute Mouse Pneumonia Model Using Bioluminescent Bacteria

التالية في الوقت الحقيقي تأثير العوامل الالتهاب الرئوي الحاد الفوعة في نموذج الفأر الالتهاب الرئوي عن طريق البكتيريا للإضاءة الحيوية

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. ...

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

المحفظة المصلي من<em&gt; العقدية الرئوية</em&gt; باستخدام تفاعل الانتباج

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal ...

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

المحفظة المصلي من<em&gt; العقدية الرئوية</em&gt; من جانب تراص اللاتكس

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major ...

Using the Overlay Assay to Qualitatively Measure Bacterial Production of and Sensitivity to Pneumococcal Bacteriocins

باستخدام تراكب الفحص لقياس نوعيا الإنتاج الجرثومي من والحساسية للالرئوية Bacteriocins

Streptococcus pneumoniae colonizes the highly diverse polymicrobial community of the nasopharynx where it must compete with resident organisms.  We have ...

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

ل<em&gt; في المختبر</em&gt; نموذج من حاجز الدم في الدماغ عن طريق التحليل الطيفي المعاوقة: التركيز على التفاعل خلية تي خلية البطانية

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal ...

Flow Cytometric Analysis of Particle-bound Bet v 1 Allergen in PM10

تدفق تحليل Cytometric من متجهة الجسيمات بيت ت 1 مسببات الحساسية في PM10

Flow cytometry is a method widely used to quantify suspended solids such as cells or bacteria in a size range from 0.5 to several tens of micrometers in ...

Visualizing the Effects of Sputum on Biofilm Development Using a Chambered Coverglass Model

تصور آثار البلغم للتنمية بيوفيلم باستخدام نموذج غرف ساترة

Biofilms consist of groups of bacteria encased in a self-secreted matrix. They play an important role in industrial contamination as well as in the ...