Name: in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice
Uploaded: 2014-03-22T14:00:00
Description: Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

وكانت جميع الإجراءات استخدام الحيوانات وفقا للمبادئ التوجيهية الأخلاقية التي وضعتها هيئة الإدارة المحلية (Regierungspräsidium كارلسروه، كارلسروه، ألمانيا). 1. إعداد مجمع سيرنا / جزيرة الأمير إدوارد ...

<ol>
	<li>Hylden, J. L., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrathecal+morphine+in+mice:+a+new+technique.">Intrathecal morphine in mice: a new technique.</a> Eur. J. Pharmacol. 67, 313-316 (1980).</li><li>Stokes, J. A., Corr, M., Yaksh, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+tactile+allodynia+following+intrathecal+puncture+in+mouse:+contributions+of+Toll-like+receptor+signaling.">Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling.</a> Neurosci. Lett. 504, 215-218 (2011).</li><li>Goula, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+intravenous+delivery+of+transgenes+to+mouse+lung.">Polyethylenimine-based intravenous delivery of transgenes to mouse lung.</a> Gene Ther. , 1291-1295 (1998).</li><li>Fairbanks, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+delivery+of+analgesics+in+experimental+models+of+pain+and+analgesia.">Spinal delivery of analgesics in experimental models of pain and analgesia.</a> Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).</li><li>Hohmann, A. G., Tsou, K., Walker, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cannabinoid+modulation+of+wide+dynamic+range+neurons+in+the+lumbar+dorsal+horn+of+the+rat+by+spinally+administered+WIN55,212-2.">Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2.</a> Neurosci. Lett. 257, 119-122 (1998).</li><li>Song, Z. H., Takemori, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+spinal+kappa+opioid+receptors+in+the+antinociception+produced+by+intrathecally+administered+corticotropin-releasing+factor+in+mice.">Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice.</a> J. Pharmacol. Exp. Ther. 254, 363-368 (1990).</li><li>Trang, T., Sutak, M., Jhamandas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+cannabinoid+(CB1)-receptors+in+the+development+and+maintenance+of+opioid+tolerance.">Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance.</a> Neuroscience. , 1275-1288 (2007).</li><li>Yaksh, T. L., Rudy, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chronic+catheterization+of+the+spinal+subarachnoid+space.">Chronic catheterization of the spinal subarachnoid space.</a> Physiol. Behav. 17, 1031-1036 (1976).</li><li>Tappe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+scaffolding+protein+Homer1a+protects+against+chronic+inflammatory+pain.">Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain.</a> Nat. Med. , 677-681 (2006).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+the+Cav3.2+T-type+calcium+channel+gene+in+sensory+neurons+demonstrates+its+major+role+in+nociception.">Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception.</a> EMBO J. 24, 315-324 (2005).</li><li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+to+dorsal+root+ganglia+by+intrathecal+injection:+effects+on+regeneration+of+peripheral+nerves.">Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves.</a> Mol. Ther. 12, 314-320 (2005).</li><li>Wigdor, S., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+and+systemic+morphine-induced+antinociception+in+mice:+contribution+of+descending+serotonergic+and+noradrenergic+pathways.">Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways.</a> J. Pharmacol. Exp. Ther. 242, 90-95 (1987).</li></ol>

وبالتالي، فإن تقنية المبين أعلاه حقن إبرة داخل القراب هو فعال وسريع، مترجمة على وجه التحديد، وغير تدميري. من الناحية الفنية، فإن الجانب الأكثر أهمية من هذا الإجراء هو نقطة الإدراج الإبرة في الأخدود. فمن الأهمية بمكان أن يتم هذا الإجراء مع أيدي هادئة جدا والصبر. مثل ا?...

الحبل الشوكي هو مركز مهم جدا في مجموعة متنوعة من العمليات البيولوجية الأساسية والوظائف الفسيولوجية، بما في ذلك تجهيز ونقل مؤلمة (مسبب للألم) المدخلات 4-7. وقد تم تطوير تقنيات تجريبية مختلفة لتسهيل التشكيل الدوائية من الحبل الشوكي، مثل زرع المزمنة القسطرة داخل القراب 8، حقن مكروي الحبل الشوكي، وحقن إبرة داخل القراب 9. كل تقنية مزاياه وعيوبه، واعتمادا على نموذج التجربة أسلوب واحد قد يكون أكثر ملاءمة من غيرها. في حين زرع المزمنة القسطرة داخل القراب هو ممكن بسهولة في الفئران، وهذه الطريقة من الصعب جدا في الماوس، ونظرا حجم القيود. نسبة نجاح منخفضة جدا والعجز الحركي وغالبا ما تحدث بسبب وجود ضخمة من قسطرة في الفضاء تحت الجافية تقتصر بشدة في الماوس. وعلاوة على ذلك، يتم تقديم التسليم على المدى الطويل من الأدوية بسبب تخثر المتكررةمن مزروع مزمنة القسطرة. أخيرا، وردود الفعل المناعي شائعة. يمكن التحايل هذه المشاكل باستخدام طريقة الحقن داخل القراب الحادة عن طريق إبرة في غياب قسطرة preimplanted، والتي تمكن التطبيق السريع وتشريحيا محدودة من الأدوية والكواشف إلى النخاع الشوكي لدى الفئران. هذا الأسلوب يحتفظ بالكامل فوائد التسليم داخل القراب على طرق أخرى النظامية التسليم (على سبيل المثال عن طريق الفم، في الوريد، داخل الصفاق، الخ) مثل خصوصية التشكيل الشوكي، والذي يسمح تخفيض الجرعات والآثار الجانبية الحد، وكذلك القدرة على تقديم المواد لا عادة لا عبور حاجز الدم في الدماغ منذ خلال حقن داخل القراب، يتم إدخال الإبرة بين الأم الجافية والحبل الشوكي. ولكن الأهم من ذلك، بالمقارنة مع غيرها من أساليب التسليم داخل القراب، وطريقة الحقن داخل القراب إبرة هو أقل الغازية، مما يتيح العديد من التطبيقات فينفس الحيوان دون أن تسبب أي تلف الأنسجة كبيرة أو إثارة رد فعل جهاز المناعة بسبب زرع المواد الأجنبية. ومع ذلك، فإنه يتطلب المهارات الفنية لاستهداف دقيقة جدا من الإبرة للسماح فعالية. هنا، علينا أن نظهر بصريا طريقة لتحقيق المعدل الأمثل لنجاح تستهدف على وجه التحديد الحبل الشوكي القطني. موقع الحقن الذي يتم اختياره في هذه التجربة هو الأخدود بين L5 L6 وعمود فقاري، وبالقرب من حيث ينتهي الحبل الشوكي، للتقليل من إمكانية الإضرار العمود الفقري. علاوة على ذلك، ونحن لشرح استخدام هذه التقنية لنهدم الجينات في النخاع الشوكي باستخدام الرناوات siRNAs.

<table border="0" cellpadding="0" cellspacing="0" width="1012">
	<colgroup>
		<col /> 
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:283px;">in vivo-jetPEI</td>
			<td style="width:255px;">Polyplus</td>
			<td style="width:288px;">201-10G</td>
			<td style="width:188px;"> </td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 siRNA</td>
			<td>Santa Cruz</td>
			<td>sc-36832</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Control siRNA-A</td>
			<td>Santa Cruz</td>
			<td>sc-37007</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-&#223;-Tubulin III antibody</td>
			<td>Sigma</td>
			<td>T2200</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-WAVE1 antibody</td>
			<td>R&#38;D Systems</td>
			<td>AF5514</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Fast green dye</td>
			<td>Sigma</td>
			<td>F-7252</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isoflurane</td>
			<td>Baxter</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isoflurane setup</td>
			<td>Dr&#228;ger L&#252;beck</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Shaver</td>
			<td>Wella</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Hamilton syringe Gastight 1702</td>
			<td>Hamilton</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">30G 1/2, 0,3 * 13mm Needle</td>
			<td>BD Microlance</td>
			<td>304000</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Microscope Leica MS5</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 forward primer for qRT-PCR</td>
			<td>Sigma</td>
			<td></td>
			<td>cacagagcctcaggacagg</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 reversed primer for qRT-PCR</td>
			<td>Sigma</td>
			<td></td>
			<td>cttttcaccaacggcatctt</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">FastStart Essential DNA Green Master</td>
			<td>Roche</td>
			<td>6402712001</td>
			<td></td>
		</tr>
	</tbody>
</table>

in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice

ويصف هذا التقرير دليل خطوة بخطوة لأسلوب الحقن داخل القراب إبرة حادة بطريقة موسع، أي مستقلة عن القسطرة زرع. الحد التقنية لهذه التقنية الجراحية تكمن في براعة من اليدين. حقن سريع، وخاصة بالنسبة للمجرب المدربين، ومنذ تعطل الأنسجة مع هذه التقنية هو الحد الأدنى، تكرار الحقن ممكنة؛ لا يحدث رد فعل وعلاوة على ذلك في مأمن من الأدوات الخارجية (مثل القسطرة.)، وبالتالي إعطاء محددة أفضل وأكثر من قراءة التشكيل الحبل الشوكي. منذ تطبيق هذه المادة يقتصر إلى حد كبير في المنطقة المستهدفة من الحبل الشوكي، والمخدرات، لا تحتاج إلى أن تطبق في جرعات كبيرة، والآثار غير المرغوب فيها الأهم على الأنسجة الأخرى، كما لوحظ مع التسليم النظامية، يمكن التحايل 1، 2. علاوة على ذلك، فإننا نقوم بدمج هذه التقنية في الجسم الحي مع ترنسفكأيشن من الحمض النووي بمساعدة polyethylenimالمعهد الوطني للإحصاء (PEI) كاشف 3، التي تنص على براعة هائلة لدراسة وظائف العمود الفقري عن طريق تسليم كلاء الدوائية وكذلك الجينات، والجيش الملكي النيبالي، وجهري البروتين.

<html> من أجل توضيح حقن ناجحة، أجرينا هذه التقنية باستخدام سريع الخضراء FCF الصبغة في الفئران الكبار C57BL6 (8-10 أسابيع من العمر). سمح للحيوان لاسترداد لبضع دقائق بعد الحقن لتوفير ما يكفي من الوقت للصبغة لنشر ثم قتل مع جرعة زائدة من ثاني أكسيد الكربون 2. في وقت لاحق، تم تش?...

Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

ويصف هذا التقرير تقنية بسيطة وسريعة من داخل القراب ثقب إبرة لترنسفكأيشن المترجمة من سيرنا في النخاع الشوكي القطني في الماوس تحت التخدير قصيرة ضوء دائم.

في فيفو سيرنا ترنسفكأيشن والجينات ضربة قاضية في الحبل الشوكي عن طريق السريع موسع قطني داخل القراب الحقن في الفئران

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter ...

Research

JoVE Journal

Biology

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

Spinal Cord Electrophysiology

الحبل الشوكي الكهربية

The neonatal mouse spinal cord is a model for studying the development of neural circuitries and locomotor movement. We demonstrate the spinal cord ...

Using an Automated Cell Counter to Simplify Gene Expression Studies: siRNA Knockdown of IL-4 Dependent Gene Expression in Namalwa Cells

باستخدام خلية مكافحة الآلي لتبسيط دراسات التعبير الجيني : ضربة قاضية سيرنا من IL - 4 التعبير الجيني في الخلايا التابعة Namalwa

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only ...

RNAi-mediated Gene Knockdown and In Vivo Diuresis Assay in Adult Female Aedes aegypti Mosquitoes

RNAi-mediated Gene Knockdown and In Vivo Diuresis Assay in Adult Female Aedes aegypti Mosquitoes

رني ضربة قاضية بوساطة الجينات و<em&gt; في الجسم الحي</em&gt; فحص إدرار البول في الإناث البالغات<em&gt; الزاعجة المصرية</em&gt; البعوض

This video protocol demonstrates an effective technique to knockdown a particular gene in an insect and conduct a novel bioassay to measure excretion ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

عزلة البروتينية ريبوسوم الوليدة منضم<em&gt; في المختبر</em&gt; لتحديد المواقع وقفة بالحركة على طول مرنا

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

Using SecM Arrest Sequence as a Tool to Isolate Ribosome Bound Polypeptides

باستخدام SecM تسلسل توقيف كأداة لعزل البروتينية منضم ريبوسوم

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway ...

Rapid Genetic Analysis of Epithelial-Mesenchymal Signaling During Hair Regeneration

تحليل سريع لالوراثية طلائي-الوسيطة اشارة خلال تجديد الشعر

Hair follicle morphogenesis, a complex process requiring interaction between epithelia-derived keratinocytes and the underlying mesenchyme, is an ...

Intravenous Injections in Neonatal Mice

الحقن في الوريد في الفئران حديثي الولادة

Intravenous injection is a clinically applicable manner to deliver therapeutics. For adult rodents and larger animals, intravenous injections are ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

عزل الترشيح من الأحماض النووية: وبسيطة وسريعة استخراج الحمض النووي الطريقة

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Cystometric and External Urethral Sphincter Measurements in Awake Rats with Implanted Catheter and Electrodes Allowing for Repeated Measurements

قياسات العضلة العاصرة الاحليل سيستوميتريك والخارجية في الفئران مستيقظا مع القسطرة مزروع واقطاب السماح للقياسات المتكررة

Lower urinary tract function is mainly assessed by means of cystometric bladder function analysis in rodents. Conventional cystometries are usually ...

Microbiota Analysis Using Two-step PCR and Next-generation 16S rRNA Gene Sequencing

تحليل الكائنات المجهرية باستخدام ثنائي الخطوة PCR والجيل التالي من 16S rRNA التسلسل الجيني

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the ...