Name: in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice
Uploaded: 2014-03-22T14:00:00
Description: Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

Toutes les procédures d&#39;utilisation des animaux soient conformes aux lignes directrices éthiques fixées par l&#39;organe local (Regierungspräsidium de Karlsruhe, Karlsruhe, Allemagne). Une. Préparation de siRNA / PEI complexe La solution complexe siRNA / PEI est préparé en utilisant les instructions du fabricant comme suit: <ol><li> Solution A: Diluer la quantité souhaitée de siRNA avec de l&#39;eau stérile (si nécessaire) jusqu&#39;à un quar...

<ol>
	<li>Hylden, J. L., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrathecal+morphine+in+mice:+a+new+technique.">Intrathecal morphine in mice: a new technique.</a> Eur. J. Pharmacol. 67, 313-316 (1980).</li><li>Stokes, J. A., Corr, M., Yaksh, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+tactile+allodynia+following+intrathecal+puncture+in+mouse:+contributions+of+Toll-like+receptor+signaling.">Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling.</a> Neurosci. Lett. 504, 215-218 (2011).</li><li>Goula, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+intravenous+delivery+of+transgenes+to+mouse+lung.">Polyethylenimine-based intravenous delivery of transgenes to mouse lung.</a> Gene Ther. , 1291-1295 (1998).</li><li>Fairbanks, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+delivery+of+analgesics+in+experimental+models+of+pain+and+analgesia.">Spinal delivery of analgesics in experimental models of pain and analgesia.</a> Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).</li><li>Hohmann, A. G., Tsou, K., Walker, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cannabinoid+modulation+of+wide+dynamic+range+neurons+in+the+lumbar+dorsal+horn+of+the+rat+by+spinally+administered+WIN55,212-2.">Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2.</a> Neurosci. Lett. 257, 119-122 (1998).</li><li>Song, Z. H., Takemori, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+spinal+kappa+opioid+receptors+in+the+antinociception+produced+by+intrathecally+administered+corticotropin-releasing+factor+in+mice.">Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice.</a> J. Pharmacol. Exp. Ther. 254, 363-368 (1990).</li><li>Trang, T., Sutak, M., Jhamandas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+cannabinoid+(CB1)-receptors+in+the+development+and+maintenance+of+opioid+tolerance.">Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance.</a> Neuroscience. , 1275-1288 (2007).</li><li>Yaksh, T. L., Rudy, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chronic+catheterization+of+the+spinal+subarachnoid+space.">Chronic catheterization of the spinal subarachnoid space.</a> Physiol. Behav. 17, 1031-1036 (1976).</li><li>Tappe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+scaffolding+protein+Homer1a+protects+against+chronic+inflammatory+pain.">Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain.</a> Nat. Med. , 677-681 (2006).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+the+Cav3.2+T-type+calcium+channel+gene+in+sensory+neurons+demonstrates+its+major+role+in+nociception.">Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception.</a> EMBO J. 24, 315-324 (2005).</li><li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+to+dorsal+root+ganglia+by+intrathecal+injection:+effects+on+regeneration+of+peripheral+nerves.">Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves.</a> Mol. Ther. 12, 314-320 (2005).</li><li>Wigdor, S., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+and+systemic+morphine-induced+antinociception+in+mice:+contribution+of+descending+serotonergic+and+noradrenergic+pathways.">Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways.</a> J. Pharmacol. Exp. Ther. 242, 90-95 (1987).</li></ol>

Ainsi, la technique décrite ci-dessus des injections intrathécales de seringues est efficace, rapide, précisément localisée, et non destructif. Techniquement, l&#39;aspect le plus critique de cette procédure est le point d&#39;insertion de l&#39;aiguille dans la gorge. Il est essentiel que cette procédure se fait avec les mains et la patience très calme. Comme de nombreuses procédures chirurgicales, la formation améliore la vitesse d&#39;injection réussie. Cela est également important, car lors d&#39;une exp...

La moelle épinière est un centre très important dans une variété de processus biologiques clés et les fonctions physiologiques, y compris le traitement et la transmission des entrées douloureuses (nociceptives) 4-7. Diverses techniques expérimentales ont été développées pour faciliter la modulation pharmacologique de la moelle épinière, par exemple une implantation chronique de cathéter intrathécal 8, la moelle épinière de la micro-injection et l&#39;injection intrathécale de l&#39;aiguille 9. Chaque technique a ses avantages et ses inconvénients, et selon le paradigme d&#39;une expérience technique pourrait être plus appropriés que les autres. Considérant que l&#39;implantation chronique de cathéter intrathécal est facilement réalisable chez le rat, ce procédé est très difficile dans la souris, étant donné les restrictions de taille. Le taux de réussite est très faible et des déficits moteurs se produit souvent en raison de la présence encombrante d&#39;un cathéter dans l&#39;espace sous-dural sévèrement limitée dans la souris. Par ailleurs, la livraison à long terme de médicaments est rendu en raison de la coagulation fréquentesdes cathéters implantés de façon chronique. Enfin, les réactions immunitaires sont fréquentes. Ces problèmes peuvent être contournés en utilisant le procédé de l&#39;injection intrathécale aiguë par une aiguille en l&#39;absence d&#39;un cathéter preimplanted, ce qui permet une application rapide et anatomiquement limité de médicaments et de réactifs de la moelle épinière chez les souris. Cette méthode conserve tous les avantages de intrathécale sur d&#39;autres voies d&#39;administration systémiques (par exemple, orale, intraveineuse, intrapéritonéale, etc), tels que la spécificité de la modulation de la moelle, ce qui permet des doses réduites et les effets secondaires de fin de course, ainsi que la capacité à délivrer des substances ne normalement ne pas traverser la barrière hémato-encéphalique depuis lors de l&#39;injection intrathécale, l&#39;aiguille est insérée entre la dure-mère et la moelle épinière. Fait important, toutefois, par rapport à d&#39;autres méthodes d&#39;administration intrathécale, le procédé d&#39;injection de l&#39;aiguille par voie intrathécale est la moins invasive, ce qui permet de nombreuses applications dans l&#39;même animal sans causer de dommages aux tissus considérable ou évoquant la réaction immunitaire en raison de l&#39;implantation de matériel étranger. Cependant, il nécessite des compétences techniques pour un ciblage très précis de l&#39;aiguille pour permettre l&#39;efficacité. Ici, nous démontrons visuellement la méthode pour atteindre un taux optimal de réussite pour cibler spécifiquement la moelle épinière lombaire. Le site d&#39;injection qui est choisie dans cette expérience est de la rainure entre L5 et L6 colonne vertébré, à proximité de l&#39;endroit où se termine la moelle épinière, de réduire au minimum le risque d&#39;endommager la colonne vertébrale. En outre, nous démontrons l&#39;utilisation de cette technique pour abattre des gènes dans la moelle épinière en utilisant des siRNA.

<table border="0" cellpadding="0" cellspacing="0" width="1012">
	<colgroup>
		<col /> 
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:283px;">in vivo-jetPEI</td>
			<td style="width:255px;">Polyplus</td>
			<td style="width:288px;">201-10G</td>
			<td style="width:188px;"> </td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 siRNA</td>
			<td>Santa Cruz</td>
			<td>sc-36832</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Control siRNA-A</td>
			<td>Santa Cruz</td>
			<td>sc-37007</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-&#223;-Tubulin III antibody</td>
			<td>Sigma</td>
			<td>T2200</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-WAVE1 antibody</td>
			<td>R&#38;D Systems</td>
			<td>AF5514</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Fast green dye</td>
			<td>Sigma</td>
			<td>F-7252</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isoflurane</td>
			<td>Baxter</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isoflurane setup</td>
			<td>Dr&#228;ger L&#252;beck</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Shaver</td>
			<td>Wella</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Hamilton syringe Gastight 1702</td>
			<td>Hamilton</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">30G 1/2, 0,3 * 13mm Needle</td>
			<td>BD Microlance</td>
			<td>304000</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Microscope Leica MS5</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 forward primer for qRT-PCR</td>
			<td>Sigma</td>
			<td></td>
			<td>cacagagcctcaggacagg</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 reversed primer for qRT-PCR</td>
			<td>Sigma</td>
			<td></td>
			<td>cttttcaccaacggcatctt</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">FastStart Essential DNA Green Master</td>
			<td>Roche</td>
			<td>6402712001</td>
			<td></td>
		</tr>
	</tbody>
</table>

in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice

Ce rapport décrit un guide étape par étape pour la technique des injections de seringues intrathécales aigus de manière non invasive, c&#39;est à dire indépendant du cathéter implantation. La limitation de cette technique réside dans la technique chirurgicale de la finesse des aiguilles. L&#39;injection est rapide, en particulier pour un expérimentateur formé, et étant donné que la perturbation de tissu avec cette technique est minime, des injections répétées sont possibles; réaction en outre à l&#39;abri des outils étrangers (. Par exemple de cathéter) ne se produit pas, ce qui donne une meilleure et plus précise read out de modulation de la moelle épinière. Etant donné que l&#39;application de la substance est largement limitée à la région cible de la moelle épinière, les médicaments n&#39;ont pas besoin d&#39;être appliqué à des doses importantes, et des effets plus important non désirés sur d&#39;autres tissus, comme observé avec une administration systémique, peuvent être contournées 1, 2. Par ailleurs, on combine cette technique avec la transfection in vivo d&#39;acides nucléiques à l&#39;aide d&#39;polyethylenimine (PEI) réactif 3, qui fournit grande polyvalence pour l&#39;étude des fonctions de la colonne vertébrale par l&#39;intermédiaire de l&#39;administration d&#39;agents pharmacologiques, ainsi que le gène, l&#39;ARN, et des modulateurs de protéine.

Afin d&#39;illustrer une injection réussie, nous avons réalisé cette technique en utilisant rapide colorant vert FCF chez les souris C57BL6 adultes (8-10 semaines d&#39;âge). L&#39;animal a été autorisée à récupérer pendant quelques minutes après l&#39;injection de fournir assez de temps pour le colorant de se propager et ensuite tué par une overdose de CO 2. Par la suite, la colonne de vertébré a été disséqué et la moelle épinière a été exposée. Le puncta bleu correspondant au colorant...

Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

Ce rapport décrit une technique simple et rapide de intrathécale ponction à l&#39;aiguille pour une transfection de siRNA localisée dans la moelle épinière lombaire chez la souris sous anesthésie de courte durée de lumière durable.

In Vivo transfection de siRNA et Gene Knockdown dans la moelle épinière via rapide non invasive lombaire intrathécale injections chez des souris

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter ...

Research

JoVE Journal

Biology

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

Spinal Cord Electrophysiology

Spinal Cord électrophysiologie

The neonatal mouse spinal cord is a model for studying the development of neural circuitries and locomotor movement. We demonstrate the spinal cord ...

Recherche

Biologie

Using an Automated Cell Counter to Simplify Gene Expression Studies: siRNA Knockdown of IL-4 Dependent Gene Expression in Namalwa Cells

Aide d&#39;un compteur de cellules automatisé pour simplifier les études d&#39;expression génique: Knockdown siRNA de l&#39;IL-4 dans l&#39;expression des gènes dépendant cellules Namalwa

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only ...

RNAi-mediated Gene Knockdown and In Vivo Diuresis Assay in Adult Female Aedes aegypti Mosquitoes

RNAi-mediated Gene Knockdown and In Vivo Diuresis Assay in Adult Female Aedes aegypti Mosquitoes

Inactivation génique médiée par ARNi et<em&gt; In Vivo</emEssai diurèse&gt; Femmes adultes<em&gt; Aedes aegypti</em&gt; Les moustiques

This video protocol demonstrates an effective technique to knockdown a particular gene in an insect and conduct a novel bioassay to measure excretion ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Isolement du ribosome Bound polypeptides naissants<em&gt; In vitro</em&gt; Pour identifier les sites de pause de translation le long d&#39;ARNm

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

Using SecM Arrest Sequence as a Tool to Isolate Ribosome Bound Polypeptides

Utilisation de la séquence d&#39;arrêt SecM comme un outil pour isoler les polypeptides Ribosome Bound

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway ...

Rapid Genetic Analysis of Epithelial-Mesenchymal Signaling During Hair Regeneration

Analyse rapide de la génétique des épithélio-mésenchymateuse signalisation lors de la régénération des cheveux

Hair follicle morphogenesis, a complex process requiring interaction between epithelia-derived keratinocytes and the underlying mesenchyme, is an ...

Intravenous Injections in Neonatal Mice

Les injections intraveineuses de souriceaux nouveau-nés

Intravenous injection is a clinically applicable manner to deliver therapeutics. For adult rodents and larger animals, intravenous injections are ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

Filtration Isolement des acides nucléiques: Une méthode d&#39;extraction de l&#39;ADN simple et rapide

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Cystometric and External Urethral Sphincter Measurements in Awake Rats with Implanted Catheter and Electrodes Allowing for Repeated Measurements

Mesures de Sphincter urétral cystométriques et externe chez le rat éveillé avec cathéter implanté et électrodes permettant des mesures répétées

Lower urinary tract function is mainly assessed by means of cystometric bladder function analysis in rodents. Conventional cystometries are usually ...

Microbiota Analysis Using Two-step PCR and Next-generation 16S rRNA Gene Sequencing

Analyse du microbiote à l'aide de PCR en deux étapes et de la prochaine génération 16S rRNA Gene Sequencing

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the ...