Name: in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice
Uploaded: 2014-03-22T14:00:00
Description: Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

כל נהלי השימוש בבעלי החיים היו בהתאם לקווים מנחים אתיים שנקבעו על ידי גוף שלטוני המקומי (Regierungspräsidium קרלסרוהה, קרלסרוהה, גרמניה). 1. הכנת מורכבת siRNA / PEI הפתרון המורכב siRNA / PEI מוכן באמצעות הוראות ?...

<ol>
	<li>Hylden, J. L., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrathecal+morphine+in+mice:+a+new+technique.">Intrathecal morphine in mice: a new technique.</a> Eur. J. Pharmacol. 67, 313-316 (1980).</li><li>Stokes, J. A., Corr, M., Yaksh, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+tactile+allodynia+following+intrathecal+puncture+in+mouse:+contributions+of+Toll-like+receptor+signaling.">Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling.</a> Neurosci. Lett. 504, 215-218 (2011).</li><li>Goula, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+intravenous+delivery+of+transgenes+to+mouse+lung.">Polyethylenimine-based intravenous delivery of transgenes to mouse lung.</a> Gene Ther. , 1291-1295 (1998).</li><li>Fairbanks, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+delivery+of+analgesics+in+experimental+models+of+pain+and+analgesia.">Spinal delivery of analgesics in experimental models of pain and analgesia.</a> Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).</li><li>Hohmann, A. G., Tsou, K., Walker, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cannabinoid+modulation+of+wide+dynamic+range+neurons+in+the+lumbar+dorsal+horn+of+the+rat+by+spinally+administered+WIN55,212-2.">Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2.</a> Neurosci. Lett. 257, 119-122 (1998).</li><li>Song, Z. H., Takemori, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+spinal+kappa+opioid+receptors+in+the+antinociception+produced+by+intrathecally+administered+corticotropin-releasing+factor+in+mice.">Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice.</a> J. Pharmacol. Exp. Ther. 254, 363-368 (1990).</li><li>Trang, T., Sutak, M., Jhamandas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+cannabinoid+(CB1)-receptors+in+the+development+and+maintenance+of+opioid+tolerance.">Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance.</a> Neuroscience. , 1275-1288 (2007).</li><li>Yaksh, T. L., Rudy, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chronic+catheterization+of+the+spinal+subarachnoid+space.">Chronic catheterization of the spinal subarachnoid space.</a> Physiol. Behav. 17, 1031-1036 (1976).</li><li>Tappe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+scaffolding+protein+Homer1a+protects+against+chronic+inflammatory+pain.">Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain.</a> Nat. Med. , 677-681 (2006).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+the+Cav3.2+T-type+calcium+channel+gene+in+sensory+neurons+demonstrates+its+major+role+in+nociception.">Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception.</a> EMBO J. 24, 315-324 (2005).</li><li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+to+dorsal+root+ganglia+by+intrathecal+injection:+effects+on+regeneration+of+peripheral+nerves.">Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves.</a> Mol. Ther. 12, 314-320 (2005).</li><li>Wigdor, S., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+and+systemic+morphine-induced+antinociception+in+mice:+contribution+of+descending+serotonergic+and+noradrenergic+pathways.">Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways.</a> J. Pharmacol. Exp. Ther. 242, 90-95 (1987).</li></ol>

לכן, השיטה שתואר לעיל של זריקות מחט intrathecal היא יעילה, מהירה, במיוחד-מקומי, ולא הורסות. מבחינה טכנית, ההיבט הקריטי ביותר של הליך זה הוא נקודת החדרת מחט לתוך החריץ. זה חיוני כי הליך זה נעשה עם ידיים וסבלנות מאוד רגועות. כמו רבים הליכים כירורגיים, אימון משפר את קצב הזריקה מו...

חוט השדרה הוא מרכז חשוב מאוד במגוון רחב של תהליכים ביולוגיים מרכזיים ופונקציות פיסיולוגיות, לרבות עיבוד והעברה של תשומות כואבות (nociceptive) 4-7. ניסיוני בטכניקות שונות פותחו כדי להקל על אפנון תרופתי של חוט השדרה, כגון השתלה כרונית של צנתרים intrathecal 8, microinjection חוט השדרה, והזרקת מחט intrathecal 9. לכל אחד יש טכניקת יתרונות משלה וחסרונות, ובהתאם לפרדיגמה ניסוי טכניקה אחת יכולה להיות מתאימה יותר מאשר לאחרים. ואילו השתלה כרונית של צנתרים intrathecal אינה ריאלי בקלות בחולדה, בשיטה זו קשה מאוד בעכבר, בהתחשב במגבלות גודל. שיעור הצלחה הוא נמוך מאוד וליקויים מוטוריים מתרחשים לעתים קרובות בשל נוכחותם מגושמת של קטטר בחלל subdural מוגבל קשות בעכבר. יתר על כן, מסירה ארוכת טווח של תרופות שניתנו עקב קרישה תכופהשל כרוני מושתל צנתרים. לבסוף, תגובות חיסוניים נפוצות. ניתן לעקוף בעיות אלה תוך שימוש בשיטה של הזרקת intrathecal האקוטית באמצעות מחט בהעדר קטטר preimplanted, המאפשר יישום מהיר ואנטומית מוגבל של תרופות וחומרים כימיים למייתרי השדרה בעכברים. שיטה זו שומרת באופן מלא את היתרונות של משלוח intrathecal על פני מסלולים אחרים מערכתיים משלוח (לדוגמא: דרך הפה, דרך הווריד, החדרה לקרום בטן, וכו &#39;) כגון הספציפיות של אפנון בעמוד השדרה, המאפשר מינונים מופחתים ותופעות לוואי גבול, כמו גם יכולת לספק חומרים לא בדרך כלל לא חוצה את מחסום דם במוח מאז במהלך הזרקת intrathecal, המחט מוחדרת בין מאטר הדורה וחוט השדרה. חשוב לציין עם זאת, בהשוואה לשיטות אחרות של משלוח intrathecal, שיטת הזרקת מחט intrathecal היא פחות פולשנית, המאפשר יישומים רביםאותו בעל חיים מבלי לגרום כל נזק לרקמות משמעותיות או לעורר תגובה חיסונית עקב השתלה של חומר זר. עם זאת, זה דורש מיומנות טכנית למיקוד מדויק מאוד של המחט על מנת לאפשר יעילות. הנה, אנחנו מבחינה ויזואלית להדגים את השיטה להשגת שיעור אופטימלי של הצלחה עבור במיוחד מיקוד בעמוד השדרה המותני. אתר הזרקה שנבחרה בניסוי הזה הוא החריץ בין L5 והעמודה L6 חוליות, סמוך למקום שבי חוט השדרה מסתיים, כדי למזער את האפשרות של פגיעה בעמוד השדרה. יתר על כן, אנחנו מדגימים את השימוש בטכניקה זו כדי להפיל גנים בחוט השדרה באמצעות siRNAs.

<table border="0" cellpadding="0" cellspacing="0" width="1012">
	<colgroup>
		<col /> 
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:283px;">in vivo-jetPEI</td>
			<td style="width:255px;">Polyplus</td>
			<td style="width:288px;">201-10G</td>
			<td style="width:188px;"> </td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 siRNA</td>
			<td>Santa Cruz</td>
			<td>sc-36832</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Control siRNA-A</td>
			<td>Santa Cruz</td>
			<td>sc-37007</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-&#223;-Tubulin III antibody</td>
			<td>Sigma</td>
			<td>T2200</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-WAVE1 antibody</td>
			<td>R&#38;D Systems</td>
			<td>AF5514</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Fast green dye</td>
			<td>Sigma</td>
			<td>F-7252</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isoflurane</td>
			<td>Baxter</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isoflurane setup</td>
			<td>Dr&#228;ger L&#252;beck</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Shaver</td>
			<td>Wella</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Hamilton syringe Gastight 1702</td>
			<td>Hamilton</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">30G 1/2, 0,3 * 13mm Needle</td>
			<td>BD Microlance</td>
			<td>304000</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Microscope Leica MS5</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 forward primer for qRT-PCR</td>
			<td>Sigma</td>
			<td></td>
			<td>cacagagcctcaggacagg</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 reversed primer for qRT-PCR</td>
			<td>Sigma</td>
			<td></td>
			<td>cttttcaccaacggcatctt</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">FastStart Essential DNA Green Master</td>
			<td>Roche</td>
			<td>6402712001</td>
			<td></td>
		</tr>
	</tbody>
</table>

in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice

דו&quot;ח זה מתאר את מדריך צעד אחר צעד לטכניקה של הזרקות מחט intrathecal חריפות בצורה לא פולשנית, כלומר העצמאית של השתלת קטטר. המגבלה הטכנית של טכניקה ניתוחית זו נעוצה בעידון של הידיים. הזריקה היא מהירה, במיוחד עבור הנסיין מיומן, וכן שיבוש רקמות עם טכניקה זו הוא מינימאלי, זריקות חוזרות ונשנות אפשריות; תגובת יתר על כן חיסון לכלים זרים (. למשל קטטר) אינה מתרחשת, ובכך נותנת ספציפי טוב יותר ויותר לקרוא את של אפנון חוט השדרה. מאז היישום של החומר מוגבל במידה רבה לאזור היעד של חוט השדרה, תרופות לא צריכה להיות מיושמות במינונים גדולים, ואת השפעות חשוב יותר לא רצויות ברקמות אחרות, כפי שנצפתה עם משלוח מערכתי, יכולה לעקוף 1, 2. יתר על כן, אנו משלבים בטכניקה זו עם transfection vivo של חומצות גרעין בעזרת polyethylenimine (PEI) מגיב 3, המספק גמישות עצומה ללימוד פונקציות השדרה באמצעות משלוח של סוכנים תרופתיים כמו גם גנים, RNA, ומאפנני חלבון.

<html> כדי להמחיש זריקה מוצלחת, ביצענו בטכניקה זו משתמשת בצבע מהיר גרין FCF בעכברי C57BL6 מבוגר (8-10 שבועות של גיל). בעלי החיים הורשו להתאושש במשך כמה דקות לאחר ההזרקה על מנת לספק מספיק זמן לצבע להתפשט ולאחר מכן נהרג עם מנת יתר של CO 2. בהמשך לכך, בעמודת החוליות הייתה גזור וא...

Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

דו&quot;ח זה מתאר טכניקה פשוטה ומהירה של נקב מחט intrathecal עבור transfection מקומי של siRNA בחוט השדרה המותני בעכבר תחת הרדמה קצרה אור בר קיימא.

בVivo siRNA Transfection וג&#39;ין מציאה בחוט השדרה באמצעות ראפיד פולשנית מותני intrathecal זריקות בעכברים

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter ...

Research

JoVE Journal

Biology

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

Spinal Cord Electrophysiology

חוט השדרה Electrophysiology

The neonatal mouse spinal cord is a model for studying the development of neural circuitries and locomotor movement. We demonstrate the spinal cord ...

Using an Automated Cell Counter to Simplify Gene Expression Studies: siRNA Knockdown of IL-4 Dependent Gene Expression in Namalwa Cells

שימוש מונה תא אוטומטי כדי לפשט את הביטוי מחקרים ג&#39;ין: siRNA מציאה הביטוי IL 4-Gene תלויים תאים Namalwa

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only ...

RNAi-mediated Gene Knockdown and In Vivo Diuresis Assay in Adult Female Aedes aegypti Mosquitoes

RNAi-mediated Gene Knockdown and In Vivo Diuresis Assay in Adult Female Aedes aegypti Mosquitoes

RNAi בתיווך ג&#39;ין מציאה ו<em&gt; In vivo</em&gt; Diuresis Assay ב נקבה בוגרת<em&gt; Aedes aegypti</em&gt; יתושים

This video protocol demonstrates an effective technique to knockdown a particular gene in an insect and conduct a novel bioassay to measure excretion ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

הבידוד של הריבוזום פוליפפטידים המתהווה כרוכים<em&gt; במבחנה</em&gt; כדי לזהות אתרים השהה של תרגום לאורך ה-mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

Using SecM Arrest Sequence as a Tool to Isolate Ribosome Bound Polypeptides

באמצעות רצף מעצר SecM ככלי לבודד פוליפפטידים כרוכים הריבוזום

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway ...

Rapid Genetic Analysis of Epithelial-Mesenchymal Signaling During Hair Regeneration

ניתוח גנטי מהיר של איתות אפיתל-mesenchymal במהלך התחדשות שיער

Hair follicle morphogenesis, a complex process requiring interaction between epithelia-derived keratinocytes and the underlying mesenchyme, is an ...

Intravenous Injections in Neonatal Mice

זריקות תוך ורידים בעכברים בילוד

Intravenous injection is a clinically applicable manner to deliver therapeutics. For adult rodents and larger animals, intravenous injections are ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

בידוד סינון של חומצות גרעין: שיטת הפקת DNA פשוטה ומהירה

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Cystometric and External Urethral Sphincter Measurements in Awake Rats with Implanted Catheter and Electrodes Allowing for Repeated Measurements

מדידות סוגר השופכה Cystometric או חיצוני בחולדות ער עם קטטר מושתל ואלקטרודות ומאפשר למדידות חוזרות

Lower urinary tract function is mainly assessed by means of cystometric bladder function analysis in rodents. Conventional cystometries are usually ...

Microbiota Analysis Using Two-step PCR and Next-generation 16S rRNA Gene Sequencing

אנליזה microbiota באמצעות שני שלבים PCR ו-הדור הבא של 16 rRNA גן רצף

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the ...