Name: in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice
Uploaded: 2014-03-22T14:00:00
Description: Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

सभी पशु उपयोग प्रक्रियाओं स्थानीय शासी निकाय (Regierungspräsidium कार्लज़ूए, कार्लज़ूए, जर्मनी) द्वारा निर्धारित नैतिक दिशा निर्देशों के अनुसार किया गया. 1. SiRNA / पी परिसर की तैयारी siRNA / पी जटिल स...

<ol>
	<li>Hylden, J. L., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrathecal+morphine+in+mice:+a+new+technique.">Intrathecal morphine in mice: a new technique.</a> Eur. J. Pharmacol. 67, 313-316 (1980).</li><li>Stokes, J. A., Corr, M., Yaksh, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+tactile+allodynia+following+intrathecal+puncture+in+mouse:+contributions+of+Toll-like+receptor+signaling.">Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling.</a> Neurosci. Lett. 504, 215-218 (2011).</li><li>Goula, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+intravenous+delivery+of+transgenes+to+mouse+lung.">Polyethylenimine-based intravenous delivery of transgenes to mouse lung.</a> Gene Ther. , 1291-1295 (1998).</li><li>Fairbanks, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+delivery+of+analgesics+in+experimental+models+of+pain+and+analgesia.">Spinal delivery of analgesics in experimental models of pain and analgesia.</a> Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).</li><li>Hohmann, A. G., Tsou, K., Walker, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cannabinoid+modulation+of+wide+dynamic+range+neurons+in+the+lumbar+dorsal+horn+of+the+rat+by+spinally+administered+WIN55,212-2.">Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2.</a> Neurosci. Lett. 257, 119-122 (1998).</li><li>Song, Z. H., Takemori, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+spinal+kappa+opioid+receptors+in+the+antinociception+produced+by+intrathecally+administered+corticotropin-releasing+factor+in+mice.">Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice.</a> J. Pharmacol. Exp. Ther. 254, 363-368 (1990).</li><li>Trang, T., Sutak, M., Jhamandas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+cannabinoid+(CB1)-receptors+in+the+development+and+maintenance+of+opioid+tolerance.">Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance.</a> Neuroscience. , 1275-1288 (2007).</li><li>Yaksh, T. L., Rudy, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chronic+catheterization+of+the+spinal+subarachnoid+space.">Chronic catheterization of the spinal subarachnoid space.</a> Physiol. Behav. 17, 1031-1036 (1976).</li><li>Tappe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+scaffolding+protein+Homer1a+protects+against+chronic+inflammatory+pain.">Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain.</a> Nat. Med. , 677-681 (2006).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+the+Cav3.2+T-type+calcium+channel+gene+in+sensory+neurons+demonstrates+its+major+role+in+nociception.">Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception.</a> EMBO J. 24, 315-324 (2005).</li><li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+to+dorsal+root+ganglia+by+intrathecal+injection:+effects+on+regeneration+of+peripheral+nerves.">Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves.</a> Mol. Ther. 12, 314-320 (2005).</li><li>Wigdor, S., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+and+systemic+morphine-induced+antinociception+in+mice:+contribution+of+descending+serotonergic+and+noradrenergic+pathways.">Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways.</a> J. Pharmacol. Exp. Ther. 242, 90-95 (1987).</li></ol>

इस प्रकार, intrathecal सुई इंजेक्शन के ऊपर वर्णित तकनीक, प्रभावोत्पादक तेजी, विशेष रूप से स्थानीय, और nondestructive है. तकनीकी तौर पर, इस प्रक्रिया का सबसे महत्वपूर्ण पहलू नाली में सुई चुभाने की बात है. यह इस प्रक्रिया ब...

रीढ़ की हड्डी प्रसंस्करण और दर्दनाक (nociceptive) आदानों 4-7 की ट्रांसमिशन सहित प्रमुख जैविक प्रक्रियाओं और शारीरिक कार्यों की एक किस्म में एक बहुत महत्वपूर्ण केंद्र है. विभिन्न प्रयोगात्मक तकनीक ऐसी intrathecal कैथेटर 8 की पुरानी आरोपण, रीढ़ की हड्डी microinjection, और intrathecal सुई इंजेक्शन 9 के रूप में रीढ़ की हड्डी, के औषधीय मॉडुलन की सुविधा के लिए विकसित किया गया है. प्रत्येक तकनीक के अपने फायदे और कमियां है, और प्रयोग प्रतिमान के आधार पर एक तकनीक दूसरों की तुलना में अधिक उपयुक्त हो सकता है. Intrathecal कैथेटर की पुरानी आरोपण चूहे में आसानी से संभव है जबकि, इस विधि का आकार प्रतिबंध दी, माउस में बहुत मुश्किल है. सफलता की दर बहुत कम है और मोटर घाटे के कारण अक्सर माउस में गंभीर रूप से सीमित अवदृढ़तानिकी अंतरिक्ष में एक कैथेटर की भारी उपस्थिति के लिए होते हैं. इसके अलावा, दवाओं की लंबी अवधि के वितरण के कारण लगातार थक्के को प्रदान की गई हैकी चिरकाल कैथेटर प्रत्यारोपित किया. अंत में, प्रतिरक्षा प्रतिक्रियाओं आम हैं. इन समस्याओं के लिए चूहों में रीढ़ की हड्डी डोरियों के लिए दवाओं और अभिकर्मकों की एक तेजी से और anatomically सीमित आवेदन सक्षम बनाता है एक preimplanted कैथेटर, के अभाव में एक सुई के माध्यम से तीव्र intrathecal इंजेक्शन की पद्धति का उपयोग करके उन्हें धोखा दिया जा सकता है. यह विधि पूरी तरह से रीढ़ की हड्डी में कम dosages और सीमा दुष्प्रभाव जो परमिट मॉडुलन,, साथ ही पदार्थ नहीं कर देने की क्षमता की विशिष्टता के रूप में अन्य प्रणालीगत प्रसव मार्गों (जैसे मौखिक, नसों, intraperitoneal, आदि) पर intrathecal प्रसव के लाभ को बरकरार रखे intrathecal इंजेक्शन के दौरान, सुई ड्यूरा मेटर और रीढ़ की हड्डी के बीच डाला जाता है के बाद से सामान्य रूप से रक्त मस्तिष्क बाधा पार नहीं है. महत्वपूर्ण बात हालांकि, intrathecal वितरण के अन्य तरीकों की तुलना में, intrathecal सुई इंजेक्शन पद्धति में कई आवेदन की अनुमति, कम से कम आक्रामक हैकिसी भी काफी ऊतकों को नुकसान के कारण या कारण विदेशी सामग्री के आरोपण के लिए प्रतिरक्षा प्रतिक्रिया evoking बिना ही जानवर. हालांकि, यह प्रभावकारिता की अनुमति के लिए सुई की एक बहुत ही सटीक लक्ष्यीकरण के लिए तकनीकी कौशल की आवश्यकता है. यहाँ, हम नेत्रहीन विशेष रूप से काठ का रीढ़ की हड्डी को निशाना बनाने के लिए सफलता का एक इष्टतम दर को प्राप्त करने के लिए विधि का प्रदर्शन. इस प्रयोग में चुना जाता है कि इंजेक्शन के स्थल L5 और रीढ़ की हड्डी को नुकसान पहुँचाए की संभावना को कम करने के लिए रीढ़ की हड्डी समाप्त होता है, जहां के पास L6 के कशेरुकी स्तंभ, के बीच नाली है. इसके अलावा, हम siRNAs का उपयोग रीढ़ की हड्डी में जीन नीचे दस्तक करने के लिए इस तकनीक के उपयोग के प्रदर्शन.

<table border="0" cellpadding="0" cellspacing="0" width="1012">
	<colgroup>
		<col /> 
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:283px;">in vivo-jetPEI</td>
			<td style="width:255px;">Polyplus</td>
			<td style="width:288px;">201-10G</td>
			<td style="width:188px;"> </td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 siRNA</td>
			<td>Santa Cruz</td>
			<td>sc-36832</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Control siRNA-A</td>
			<td>Santa Cruz</td>
			<td>sc-37007</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-&#223;-Tubulin III antibody</td>
			<td>Sigma</td>
			<td>T2200</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-WAVE1 antibody</td>
			<td>R&#38;D Systems</td>
			<td>AF5514</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Fast green dye</td>
			<td>Sigma</td>
			<td>F-7252</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isoflurane</td>
			<td>Baxter</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isoflurane setup</td>
			<td>Dr&#228;ger L&#252;beck</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Shaver</td>
			<td>Wella</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Hamilton syringe Gastight 1702</td>
			<td>Hamilton</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">30G 1/2, 0,3 * 13mm Needle</td>
			<td>BD Microlance</td>
			<td>304000</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Microscope Leica MS5</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 forward primer for qRT-PCR</td>
			<td>Sigma</td>
			<td></td>
			<td>cacagagcctcaggacagg</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 reversed primer for qRT-PCR</td>
			<td>Sigma</td>
			<td></td>
			<td>cttttcaccaacggcatctt</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">FastStart Essential DNA Green Master</td>
			<td>Roche</td>
			<td>6402712001</td>
			<td></td>
		</tr>
	</tbody>
</table>

in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice

यह रिपोर्ट एक noninvasive ढंग से तीव्र intrathecal सुई इंजेक्शन की तकनीक, कैथेटर आरोपण का यानी स्वतंत्र करने के लिए एक कदम दर कदम गाइड का वर्णन करता है. इस शल्य चिकित्सा तकनीक के तकनीकी सीमा हाथों की चालाकी में निहित है. इंजेक्शन विशेष रूप से एक प्रशिक्षित प्रयोगकर्ता के लिए, तेजी से है, और इस तकनीक के साथ ऊतक व्यवधान कम है, के बाद से दोहराया इंजेक्शन संभव हो रहे हैं, विदेशी उपकरणों के लिए इसके अलावा प्रतिरक्षा प्रतिक्रिया (. जैसे कैथेटर) उत्पन्न नहीं होती है, जिससे एक बेहतर और अधिक विशिष्ट बाहर पढ़ने दे रीढ़ की हड्डी मॉडुलन की. पदार्थ के आवेदन काफी हद तक रीढ़ की हड्डी का लक्ष्य क्षेत्र तक ही सीमित है, अत:, दवाओं बड़े dosages में लागू करने की आवश्यकता नहीं है, और अन्य ऊतकों पर अधिक महत्वपूर्ण बात यह अवांछित प्रभाव, एक प्रणालीगत प्रसव के साथ मनाया के रूप में, 1 उन्हें धोखा दिया जा सकता है 2. इसके अलावा, हम polyethylenim की मदद से न्यूक्लिक एसिड के vivo अभिकर्मक के साथ इस तकनीक गठबंधनine (पी) औषधीय एजेंटों के वितरण के साथ ही जीन, शाही सेना, और प्रोटीन modulators के माध्यम से रीढ़ की हड्डी कार्यों के अध्ययन के लिए भारी चंचलता प्रदान करता है जो अभिकर्मक 3,.

एक सफल इंजेक्शन देकर स्पष्ट करने के लिए, हम वयस्क C57BL6 चूहों में फास्ट ग्रीन FCF डाई (उम्र के 8-10 सप्ताह) का उपयोग कर इस तकनीक का प्रदर्शन किया. पशु डाई फैला है और फिर सीओ 2 की अधिक मात्रा के साथ मार डाला करने ?...

Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

इस रिपोर्ट में कम समय तक चलने प्रकाश संज्ञाहरण के तहत माउस में काठ का रीढ़ की हड्डी में siRNA के एक स्थानीय अभिकर्मक के लिए intrathecal सुई पंचर का एक सरल और तेजी से तकनीक का वर्णन है.

चूहे में रैपिड अवेध्य काठ intrathecal इंजेक्शन के माध्यम से विवो siRNA अभिकर्मक और रीढ़ की हड्डी में जीन पछाड़ना में

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter ...

Research

JoVE Journal

Biology

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

Spinal Cord Electrophysiology

स्पाइनल कॉर्ड इलैक्ट्रोफिजियोलॉजी

The neonatal mouse spinal cord is a model for studying the development of neural circuitries and locomotor movement. We demonstrate the spinal cord ...

Using an Automated Cell Counter to Simplify Gene Expression Studies: siRNA Knockdown of IL-4 Dependent Gene Expression in Namalwa Cells

एक स्वचालित सेल काउंटर का उपयोग करने के लिए जीन एक्सप्रेशन अध्ययन सरल: आईएल-4 निर्भर जीन एक्सप्रेशन के Namalwa कक्ष में siRNA नॉकडाउन

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only ...

RNAi-mediated Gene Knockdown and In Vivo Diuresis Assay in Adult Female Aedes aegypti Mosquitoes

RNAi-mediated Gene Knockdown and In Vivo Diuresis Assay in Adult Female Aedes aegypti Mosquitoes

आरएनएआई की मध्यस्थता जीन मारकर गिरा दिया और<em&gt; Vivo में</emवयस्क महिला में diuresis परख<em&gt; एडीज aegypti</em&gt; मच्छरों

This video protocol demonstrates an effective technique to knockdown a particular gene in an insect and conduct a novel bioassay to measure excretion ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Ribosome बाध्य नवजात polypeptides का अलगाव<em&gt; इन विट्रो में</em&gt; MRNA के साथ translational रोकें ब्लॉग की पहचान के लिए

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

Using SecM Arrest Sequence as a Tool to Isolate Ribosome Bound Polypeptides

SECM गिरफ्तार अनुक्रम एक ribosome बाध्य polypeptides पृथक उपकरण के रूप में का उपयोग

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway ...

Rapid Genetic Analysis of Epithelial-Mesenchymal Signaling During Hair Regeneration

बाल उत्थान के दौरान तेजी से उपकला-mesenchymal संकेतन की आनुवांशिक विश्लेषण

Hair follicle morphogenesis, a complex process requiring interaction between epithelia-derived keratinocytes and the underlying mesenchyme, is an ...

Intravenous Injections in Neonatal Mice

नवजात चूहों में नसों में इंजेक्शन

Intravenous injection is a clinically applicable manner to deliver therapeutics. For adult rodents and larger animals, intravenous injections are ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

न्यूक्लिक एसिड की छानने का अलगाव: एक सरल और तेजी डीएनए निष्कर्षण विधि

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Cystometric and External Urethral Sphincter Measurements in Awake Rats with Implanted Catheter and Electrodes Allowing for Repeated Measurements

Cystometric और बाह्य मूत्रमार्ग प्रत्यारोपित कैथेटर और दोहराया माप के लिए अनुमति इलेक्ट्रोड के साथ जाग चूहों में दबानेवाला माप

Lower urinary tract function is mainly assessed by means of cystometric bladder function analysis in rodents. Conventional cystometries are usually ...

Microbiota Analysis Using Two-step PCR and Next-generation 16S rRNA Gene Sequencing

Microbiota विश्लेषण दो कदम पीसीआर और अगली पीढ़ी के 16S rRNA जीन अनुक्रमण का उपयोग

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the ...