Name: studying dna looping by single-molecule fret
Uploaded: 2014-06-28T15:00:00
Description: Watch this Scientific Journal Video about Studying DNA Looping by Single-Molecule FRET at JoVE.com

हम समीक्षकों पांडुलिपि पढ़ने के लिए जेम्स वाटर्स, मकान का कोना वाद्स्वोर्थ और बो Broadwater धन्यवाद. हम भी उपयोगी टिप्पणी प्रदान करने के लिए चार अनाम समीक्षक धन्यवाद. हम जॉर्जिया प्रौद्योगिकी संस्थान, वैज्ञानिक इंटरफेस पर Burroughs Wellcome कोष कैरियर पुरस्कार, और जीवन प्रणालियों के NSF भौतिकी से छात्र रिसर्च नेटवर्क अनुदान से वित्तीय सहायता को स्वीकार करते हैं.

1. DsDNA नमूना तैयार <ol><li> एक 10 मेर अनुक्रम दोहरा द्वारा विश्व स्तर पर घुमावदार DNAs डिजाइन. उदाहरण के लिए, 5&#39;-GTGCCAGCAACAGATAGC - (TTTATCATCCTTTATCATCC एक्स) 7 - TTTCATTCGAGCTCGTTGTTG -3 &#39;एक 186-BP घुमावदार एक्स एक यादृच्छिक अतिरिक्त आधार ह?...

<ol>
	<li>Garcia, H. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biological+consequences+of+tightly+bent+DNA:+The+other+life+of+a+macromolecular+celebrity.">Biological consequences of tightly bent DNA: The other life of a macromolecular celebrity.</a> Biopolymers. 85, 115-130 (2007).</li><li>Wiggins, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+flexibility+of+DNA+on+short+length+scales+probed+by+atomic+force+microscopy.">High flexibility of DNA on short length scales probed by atomic force microscopy.</a> Nature Nanotechnology. 1, (2006).</li><li>Lionberger, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cooperative+kinking+at+distant+sites+in+mechanically+stressed+DNA.">Cooperative kinking at distant sites in mechanically stressed DNA.</a> Nucleic Acids Research. 41, 6785-6792 (2011).</li><li>Shore, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+flexibility+studied+by+covalent+closure+of+short+fragments+into+circles.">DNA flexibility studied by covalent closure of short fragments into circles.</a> Proc Natl Acad Sci U S A. 78, 4833-4837 (1981).</li><li>Geggier, S., Vologodskii, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence+dependence+of+DNA+bending+rigidity.">Sequence dependence of DNA bending rigidity.</a> Proc Nat Acad Sci U S A. 107, 15421-15426 (1992).</li><li>Smith, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+mechanical+measurements+of+the+elasticity+of+single+DNA+molecules+by+using+magnetic+beads.">Direct mechanical measurements of the elasticity of single DNA molecules by using magnetic beads.</a> Science. 258, 1122-1126 (1992).</li><li>Peters, J. P., Maher, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+curvature+and+flexibility+in+vitro+and+in+vivo.">DNA curvature and flexibility in vitro and in vivo.</a> Quarterly Reviews of Biophysics. 43, 23-63 (2010).</li><li>Cloutier, T. E., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+sharp+bending+of+double-stranded+DNA.">Spontaneous sharp bending of double-stranded DNA.</a> Molecular Cell. 14, 355-362 (2004).</li><li>Du, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclization+of+short+DNA+fragments+and+bending+fluctuations+of+the+double+helix.">Cyclization of short DNA fragments and bending fluctuations of the double helix.</a> Proc Natl Acad Sci U S A. 102, 5397-5402 (2005).</li><li>Yuan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T4+DNA+ligase+is+more+than+an+effective+trap+of+cyclized+dsDNA.">T4 DNA ligase is more than an effective trap of cyclized dsDNA.</a> Nucl. Acids Res. 35, 5294-5302 (2007).</li><li>Manzo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+nonspecific+binding+of+lambda+repressor+on+DNA+looping+dynamics.">The effect of nonspecific binding of lambda repressor on DNA looping dynamics.</a> Biophysical Journal. 103, 1753-1761 (2012).</li><li>Le, T. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+shape-dependent+looping+probability+of+DNA.">Measuring shape-dependent looping probability of DNA.</a> Biophys. J. 104, 2068-2076 (2013).</li><li>Vafabakhsh, R., Ha, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extreme+bendability+of+DNA+less+than+100+base+pairs+long+revealed+by+single-molecule+cyclization.">Extreme bendability of DNA less than 100 base pairs long revealed by single-molecule cyclization.</a> Science. 337, 1097-1101 (2012).</li><li>Friedman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viewing+dynamic+assembly+of+molecular+complexes+by+multi-wavelength+single-molecule+fluorescence.">Viewing dynamic assembly of molecular complexes by multi-wavelength single-molecule fluorescence.</a> Biophysical Journal. 91, 1023-1031 (2006).</li><li>Kaplan, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA-encoded+nucleosome+organization+of+a+eukaryotic+genome.">The DNA-encoded nucleosome organization of a eukaryotic genome.</a> Nature. 458, 362-366 (2009).</li><li>Koo, H. S., Crothers, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calibration+of+DNA+curvature+and+a+unified+description+of+sequence-directed+bending.">Calibration of DNA curvature and a unified description of sequence-directed bending.</a> Proc Nat Acad Sci U S A. 85, 1763-1767 (1988).</li><li>Prosseda, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+temperature-induced+narrow+DNA+curvature+range+sustains+the+maximum+activity+of+a+bacterial+promoter+in+vitro.">A temperature-induced narrow DNA curvature range sustains the maximum activity of a bacterial promoter in vitro.</a> Biochemistry. 49, 2778-2785 (2010).</li><li>Rasnik, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonblinking+and+long-lasting+single-molecule+fluorescence+imaging.">Nonblinking and long-lasting single-molecule fluorescence imaging.</a> Nature Methods. 3, 891-893 (2006).</li><li>Cordes, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+mechanism+of+Trolox+as+antiblinking+and+antibleaching+reagent.">On the mechanism of Trolox as antiblinking and antibleaching reagent.</a> J. Am. Chem. Soc. 131, 5018-5019 (2009).</li><li>Aitken, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+oxygen+scavenging+system+for+improvement+of+dye+stability+in+single-molecule+fluorescence+experiments.">An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments.</a> Biophys J. 94, 1826-1835 (2008).</li><li>Taylor, W. H., Hagerman, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+the+method+of+phage+T4+DNA+ligase-catalyzed+ring-closure+to+the+study+of+DNA+structure:+II.+NaCl-dependence+of+DNA+flexibility+and+helical+repeat.">Application of the method of phage T4 DNA ligase-catalyzed ring-closure to the study of DNA structure: II. NaCl-dependence of DNA flexibility and helical repeat.</a> Journal of Molecular Biology. 212, 363-376 (1990).</li><li>Bolshoy, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Curved+DNA+without+A-A:+experimental+estimation+of+all+16+DNA+wedge+angles.">Curved DNA without A-A: experimental estimation of all 16 DNA wedge angles.</a> Proc Natl Acad Sci U S A. 88, 2312-2316 (1991).</li><li>Gibson, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+DNA+fragments+in+yeast+by+one-step+assembly+of+overlapping+oligonucleotides.">Synthesis of DNA fragments in yeast by one-step assembly of overlapping oligonucleotides.</a> Nucl. Acids Res. 37, 6984-6990 (2009).</li><li>Vologodskii, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bending+of+short+DNA+helices.">Bending of short DNA helices.</a> Artif DNA PNA XNA. 4, (2013).</li><li>Hoover, D. M., Lubkowski, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNAWorks:+an+automated+method+for+designing+oligonucleotides+for+PCR-based+gene+synthesis.">DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis.</a> Nucl. Acids Res. 30, (2002).</li><li>Waters, J. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Equilibrium+Statistics+of+a+Surface-Pinned+Semiflexible+Polymer.">Equilibrium Statistics of a Surface-Pinned Semiflexible Polymer.</a> Macromolecules. 46, 6659-6666 (2013).</li><li>Mills, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+evidence+that+single-stranded+regions+of+1+or+more+nucleotides+dramatically+increase+the+flexibility+of+DNA.">Electrophoretic evidence that single-stranded regions of 1 or more nucleotides dramatically increase the flexibility of DNA.</a> Biochemistry. 33, 1797-1803 (1994).</li></ol>

झल्लाहट पर आधारित एक सरल एकल अणु परख विभिन्न आंतरिक आकार के DNAs के पाशन कैनेटीक्स अध्ययन करने के लिए इस्तेमाल किया गया था. घुमावदार DNAs 10.5 बीपी के पेचदार अवधि के साथ चरण में 10 पूर्व अनुक्रम दोहरा द्वारा तैय?...

DsDNA के यांत्रिक गुणों को समझना बुनियादी विज्ञान और इंजीनियरिंग अनुप्रयोगों में बुनियादी महत्व की है. लगातार बेस जोड़े के बीच रोल, झुकाव, और मोड़ कोण दृश्य के साथ भिन्न हो सकते हैं क्योंकि dsDNA की संरचना एक सीधे पेचदार सीढ़ी से अधिक जटिल है. थर्मल उतार चढ़ाव dsDNA इस तरह, झुकने घुमा और खींच के रूप में गठनात्मक उतार चढ़ाव के विभिन्न साधनों से गुजरना करने के लिए पैदा कर सकता है. इस तरह के पिघलने और kinking के रूप में संक्रमण भी चरम स्थितियों में हो सकता है. इन प्रस्तावों के अलावा, dsDNA झुकने सबसे महत्त्वपूर्ण जैविक प्रभाव 1 है. dsDNA झुकने एक दूसरे के करीब दो दूर के स्थानों लाकर जीन दमन या सक्रियण के साथ जुड़ा हुआ है. यह भी डीएनए सेल नाभिक के अंदर पैकेजिंग या एक वायरल capsid में एक महत्वपूर्ण भूमिका निभाता है. DsDNA के झुकने विरूपण उच्च संकल्प माइक्रोस्कोपी (AFM 2 और मंदिर 3), और thermodyn प्रयोगात्मक द्वारा देखे जा सकते हैंamics और कैनेटीक्स रासायनिक dsDNA की Juxtaposed साइटों से लिंक जो पाशन assays, द्वारा अध्ययन किया जा सकता है. ऐसा ही एक परख ligase निर्भर चक्रगति 4 है. इस परख में, &#39;चिपचिपा (एकजुट) के साथ समाप्त होता dsDNA अणुओं circularized रहे हैं या डीएनए ligase द्वारा dimerized. चक्र और डिमर गठन की दरों की तुलना करके, एक जम्मू कारक के रूप में जाना जाता है, जो दूसरे छोर के आसपास के क्षेत्र में डीएनए के एक छोर से एक प्रभावी दाढ़ एकाग्रता प्राप्त कर सकते हैं. यह जम्मू कारक दूसरे छोर से कुछ ही दूरी पर डीएनए के एक छोर पाने की संभावना घनत्व के लिए dimensionally बराबर है और इस प्रकार डीएनए के लचीलेपन को दर्शाता है. डीएनए की लंबाई के एक समारोह के रूप में जम्मू कारक मापने हठ लंबाई 4,5 सहित डीएनए यांत्रिकी के बारे में कई विशेषताओं का पता चलता है. कीड़ा की तरह श्रृंखला (WLC) मॉडल व्यापक रूप से expla में अपनी सफलता के आधार पर dsDNA यांत्रिकी के लिए विहित बहुलक मॉडल के रूप में माना गया हैडीएनए प्रयोगों 6 खींच रहा है और सही ढंग से लंबे समय तक 200 बी पी 7 से dsDNAs की जम्मू कारकों की भविष्यवाणी में प्राप्त बल विस्तार से घटता ining. हालांकि, 100 बीपी के रूप में के रूप में कम dsDNA अणुओं पर चक्रगति परख का उपयोग, Cloutier और Widom WLC मॉडल भविष्यवाणी 8 से अधिक परिमाण के कई आदेशों होने के लिए जम्मू कारकों मापा. एक साल बाद, दू एट अल. ligase की कम सांद्रता के साथ चक्रगति परख का उपयोग WLC मॉडल के साथ समझौते में जम्मू कारकों का उत्पादन और Widom समूह से 9 इस्तेमाल किया उच्च ligase सांद्रता के लिए विषम परिणाम जिम्मेदार ठहराया. पारंपरिक परख 9 का उपयोग करते समय यह विवाद चक्रगति कैनेटीक्स पर डीएनए ligase की अपरिहार्य प्रभाव एक मिसाल है. इसके अलावा, डीएनए ligase भी अविशिष्ट बाध्यकारी 10,11 के माध्यम से डीएनए संरचना और कठोरता को प्रभावित कर सकते हैं. प्रोटीन पर निर्भर पाशन assays के तकनीकी चिंताओं को खत्म करने के लिए हमने हाल ही में एक prot का प्रदर्शनप्रतिदीप्ति प्रतिध्वनि ऊर्जा हस्तांतरण (झल्लाहट) 12 के आधार पर Ein मुक्त पाशन परख. इस विधि में, looped रचना एक डीएनए अणु का चिपचिपा सिरों के पास जुड़ी दाता और स्वीकर्ता के बीच झल्लाहट से पता चला रहे हैं. एक उद्देश्य प्रकार कुल आंतरिक प्रतिबिंब प्रतिदीप्ति माइक्रोस्कोप (TIRFM) प्रतिवर्ती पाशन और समय की एक लम्बी अवधि के लिए सतह से स्थिर एकल डीएनए अणु से unlooping घटनाओं के trajectories रिकॉर्ड करने के लिए प्रयोग किया जाता है. इस विधि Vafabakhsh और हा 13 से एक समान विधि पर एक महत्वपूर्ण सुधार है जो बेमेल मुक्त डीएनए अणु, उत्पन्न करने के लिए डीएनए अणु की पीसीआर आधारित विधानसभा सुविधाएँ. इस प्रोटोकॉल के एकल अणु पहलू झल्लाहट पहलू भी ligase गतिविधि क्षीण कर सकते हैं कि स्थितियों में, एक ही अणु से बार बार डीएनए पाशन गतिशीलता को मापने के लिए अनुमति देता है, जबकि इसके अलावा में वितरण के माप मूविंग कलाकारों की टुकड़ी को अनुमति देता है. TIRFM सेटअप चित्र 1 में दिखाया गया है. एक कस्टमसे डिजाइन नमूना चरण एक ओलिंप IX61 माइक्रोस्कोप शरीर पर रखा गया है. 532 एनएम और 640 एनएम लेज़रों ओर से पेश कर रहे हैं और coverslip पानी इंटरफेस में घटना का महत्वपूर्ण कोण को प्राप्त करने के लिए उच्च NA उद्देश्य में छोटे अंडाकार दर्पण 14 से परिलक्षित होते हैं. हम और अधिक व्यापक dichroic दर्पण या चश्मे आधारित TIR setups का उपयोग कर के माध्यम से उद्देश्य TIR भी इस झल्लाहट आवेदन के लिए इस्तेमाल किया जा सकता है कि ध्यान दें. माइक्रोस्कोप द्वारा गठित प्रतिदीप्ति छवि एक dichroic दर्पण से दाता और स्वीकर्ता छवियों में विभाजित है. वे तो एक EMCCD के दो हिस्सों पर फिर से imaged हैं. अतिरिक्त लंबे पास उत्सर्जन फिल्टर पृष्ठभूमि संकेत को कम करने के लिए उपयोग किया जाता है. तापमान नियंत्रण प्रतिलिपि प्रस्तुत करने योग्य गतिज डेटा प्राप्त करने के लिए आवश्यक है. तापमान नियंत्रण के लिए, उद्देश्य एक तापमान नियंत्रित चिलर / हीटर से गर्मी हस्तांतरण, और पानी को कम करने के लिए माइक्रोस्कोप शरीर की nosepiece से अलग है कि कसकर फिट बैठता है एक पीतल कॉलर के माध्यम से वितरित किया जाता हैउद्देश्य जैकेट के नीचे आंतरिक धातु के आसपास. इस सेटअप 15 और 50 डिग्री सेल्सियस के बीच coverslip सतह (चित्रा 2) में मजबूत तापमान नियंत्रण हासिल करने में सक्षम है. इस काम में, नमूना तापमान 24 डिग्री सेल्सियस पर बनाए रखा गया था निम्नलिखित प्रोटोकॉल डीएनए निर्माण, डीएनए आकार के आकलन, एकल अणु प्रयोग, और जम्मू कारक निर्धारण के लिए कदम दर कदम प्रक्रिया प्रस्तुत करता है.

<table border="0" cellpadding="0" cellspacing="0" width="793">
	<tbody>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Small DNA FRAG Extract Kit-100PR</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97060-558</td>
			<td style="width:183px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Acrylamide 40% solution 500 mL</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97064-522</td>
			<td style="width:183px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">Bis-acrylamide 2% (w/v) solution 500 mL</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97063-948</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">GeneRuler 100 bp DNA Ladder, 100-1000 bp</td>
			<td style="width:124px;">Fermentas</td>
			<td>SM0241</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Mini Vertical PAGE System</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">89032-300</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Syringe filter 0.2um CS50</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">A2666</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Trolox</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">238813-1G</td>
			<td>triplet state quencher</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Protocatechuic acid (PCA)</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">08992-50MG</td>
			<td>oxygen scavenging system</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Protocatechuate 3,4-Dioxygenase (PCD)</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">P8279-25UN</td>
			<td>oxygen scavenging system</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">mPEG-silane, MW 2000 1g</td>
			<td style="width:124px;">Laysan Bio</td>
			<td style="width:135px;">MPEG-SIL-2000-1g</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Biotin-PEG-Silane, MW 3400</td>
			<td style="width:124px;">Laysan Bio</td>
			<td style="width:135px;">Biotin-PEG-SIL-3400-1g</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Avidin, NeutrAvidin Biotin-binding Protein</td>
			<td style="width:124px;">Invitrogen</td>
			<td style="width:135px;">A2666</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Phusion Hot Start High-Fidelity DNA Polymerase</td>
			<td style="width:124px;">New England Biolabs</td>
			<td style="width:135px;">F-540L</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">Gel/PCR DNA Fragments Extraction Kit</td>
			<td>IBI Scientific</td>
			<td>IB47020</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Premium plain glass microscope slides</td>
			<td style="width:124px;">Fisher Scientific</td>
			<td style="width:135px;">12-544-1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">VWR micro cover glass, rectangular, no. 1</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">48404-456</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Fisher Scientific Isotemp 1006s Recirculating Chiller/Heater</td>
			<td style="width:124px;">Fisher Scientific</td>
			<td style="width:135px;"></td>
			<td>temperature control</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Objective Cooling Collar</td>
			<td style="width:124px;">Bioptechs</td>
			<td style="width:135px;">150303</td>
			<td>temperature control</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">KMI53 Biological Micrometer Measuring Stage</td>
			<td style="width:124px;">Semprex</td>
			<td style="width:135px;">KMI53</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">High Performance DPSS Laser 532nm 50mW&#160;</td>
			<td style="width:124px;">Edmund optics</td>
			<td style="width:135px;">NT66-968</td>
			<td>Cy3 excitation</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:351px;">CUBE Fiber Pigtailed 640 nm, 30mW, Fiber, FC/APC Connector</td>
			<td style="width:124px;">Coherent</td>
			<td style="width:135px;">1139604</td>
			<td>Cy5 excitation</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">650 nm BrightLine Dichroic Beamsplitter</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">FF650-Di01-25x36</td>
			<td>splitting dichroic</td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:351px;">LaserMUX Beam Combiner, reflects 514.5, 532, &#38; 543.5 nm lasers, 25 mm</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">LM01-552-25</td>
			<td>combining dichroic</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Brightline Fluorescence Filter 593/40</td>
			<td style="width:124px;">Semrock</td>
			<td>FF01-593/40-25</td>
			<td>Cy3 emission filter</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">635 nm EdgeBasic LWP longpass Filter, 25 mm</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">BLP01-635R-25</td>
			<td>Cy5 emission filter</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">EMCCD iXon+</td>
			<td style="width:124px;">Andor Technology</td>
			<td style="width:135px;">DU-897E-CS0-#BV</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">IX51 inverted microscope frame</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;"></td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Objective UApo N 100x/1.49 Oil TIRF</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;"></td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Immersion oil type-F for fluorescence microscopy</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;">IMMOIL-F30CC</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">2mm Diameter 45&#176; Rod Lens Aluminum Coated&#160;</td>
			<td style="width:124px;">Edmund optics</td>
			<td style="width:135px;">54-092</td>
			<td>miniature mirror</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">1/4&#34; Travel Single-Axis Translation Stage</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">MS-1</td>
			<td>translation of miniature mirror</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">&#216;1&#34; Achromatic Doublet, ARC: 400-700 nm, f=200 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">AC254-200-A</td>
			<td>focusing lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Adjustable Mechanical Slit</td>
			<td style="width:124px;">Thorlabs</td>
			<td>VA100</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Dielectric Mirror</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">BB1-E02</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">&#216;1&#34; Achromatic Doublet, f = 100 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">AC254-100-A</td>
			<td>relay lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Lens Mount for &#216;1&#34; Optics</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LMR1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Dichroic Filter Mount</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">FFM1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Fixed Cage Cube Platform</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">B3C</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Kinematic Mount for &#216;1&#34; Optics</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">KM100</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lens, &#216;1&#34;, f = 40 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1422-A</td>
			<td>collimating lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lense, &#216;6.0 mm, f = 15 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1222-A</td>
			<td>telescope lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lense, &#216;6.0 mm, f = 150 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1433-A</td>
			<td>telescope lens</td>
		</tr>
	</tbody>
</table>

studying dna looping by single-molecule fret

डबल असहाय डीएनए (dsDNA) के झुकने ऐसे डीएनए प्रोटीन मान्यता और nucleosomes में डीएनए की पैकेजिंग के रूप में कई महत्वपूर्ण जैविक प्रक्रियाओं के साथ जुड़ा हुआ है. DsDNA झुकने की ऊष्मा covalently एक dsDNA से कम चिपचिपा सिरों में शामिल होने के लिए डीएनए ligase पर निर्भर करता है जो एक विधि कहा जाता चक्रगति द्वारा अध्ययन किया गया है. हालांकि, बंधाव दक्षता डीएनए में शामिल हो गए चिपचिपा सिरों आसपास संरचना, और ligase के रूप में पाशन dsDNA से संबंधित नहीं हैं कि कई कारकों से प्रभावित किया जा सकता है भी ऐसी अविशिष्ट बंधन के रूप में तंत्र के माध्यम से स्पष्ट पाशन दर को प्रभावित कर सकते हैं. यहाँ, हम झल्लाहट (प्रतिदीप्ति प्रतिध्वनि ऊर्जा हस्तांतरण) द्वारा क्षणिक डीएनए पाश गठन पता लगाने के द्वारा ligase बिना dsDNA पाशन कैनेटीक्स को मापने के लिए कैसे दिखा. dsDNA अणुओं एक झल्लाहट जोड़ी और एक बायोटिन linker के साथ एक सरल पीसीआर आधारित प्रोटोकॉल का उपयोग कर निर्माण कर रहे हैं. जम्मू कारक के रूप में जाना जाता पाशन प्रायिकता घनत्व दो disconnec के बीच पाशन दर और annealing दर से निकाला जाता हैटेड चिपचिपा समाप्त होता है. विभिन्न आंतरिक curvatures के साथ दो dsDNAs परीक्षण करके, हम जम्मू कारक dsDNA की आंतरिक आकृति के प्रति संवेदनशील है कि दिखा.

पाशन अध्ययन के लिए इस्तेमाल किया डीएनए अणु चर अनुक्रम और लंबाई और एक दूसरे के पूरक हैं कि एकल असहाय overhangs के एक डुप्लेक्स क्षेत्र से मिलकर. 7 आधार लंबे होते हैं जो overhangs, looped राज्य पर कब्जा करने के लिए एक दूसरे ?...

Watch this Scientific Journal Video about Studying DNA Looping by Single-Molecule FRET at JoVE.com

Studying DNA Looping by Single-Molecule FRET

इस अध्ययन के एकल अणु प्रतिदीप्ति प्रतिध्वनि ऊर्जा हस्तांतरण (झल्लाहट) का उपयोग डबल असहाय डीएनए के पाशन गतिशीलता को मापने के लिए एक विस्तृत प्रायोगिक प्रक्रिया को प्रस्तुत करता है. प्रोटोकॉल भी जम्मू कारक बुलाया पाशन प्रायिकता घनत्व निकालने के लिए कैसे करें.

एकल अणु झल्लाहट द्वारा डीएनए पाशन पढ़ रही है

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into ...

Research

JoVE Journal

Biology

Single Molecule Methods for Monitoring Changes in Bilayer Elastic Properties

Bilayer लचीला गुण में निगरानी परिवर्तन के लिए एकल अणु तरीके

Membrane protein function is regulated by the cell membrane lipid composition.  This regulation is due to a combination of specific lipid-protein ...

Combining QD-FRET and Microfluidics to Monitor DNA Nanocomplex Self-Assembly in Real-Time

मेल QD झल्लाहट और Microfluidics वास्तविक समय में डीएनए स्व विधानसभा Nanocomplex मॉनिटर करने के लिए

Advances in genomics continue to fuel the development of therapeutics that can target pathogenesis at the cellular and molecular level. Typically ...

Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

Visualizing एकल अणु प्रतिदीप्ति माइक्रोस्कोपी के साथ डीएनए प्रतिकृति

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA ...

Automated System for Single Molecule Fluorescence Measurements of Surface-immobilized Biomolecules

भूतल immobilized biomolecules के एकल अणु प्रतिदीप्ति माप के लिए स्वचालित प्रणाली

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, ...

Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay

डीएनए नकल एंजाइमों का प्रत्यक्ष प्रेक्षण एक एकल अणु डीएनए परख टूटती का उपयोग

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. ...

Single-Molecule Imaging of Nuclear Transport

परमाणु परिवहन के एकल अणु इमेजिंग

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the ...

Monitoring Kinase and Phosphatase Activities Through the Cell Cycle by Ratiometric FRET

निगरानी सेल चक्र के माध्यम से ratiometric झल्लाहट kinase और फॉस्फेट क्रियाएँ

F&ouml;rster resonance energy transfer (FRET)-based reporters1 allow the assessment of endogenous kinase and phosphatase activities in living cells. Such ...

Single-molecule Imaging of Gene Regulation In vivo Using Cotranslational Activation by Cleavage (CoTrAC)

Single-molecule Imaging of Gene Regulation In vivo Using Cotranslational Activation by Cleavage CoTrAC

जीन विनियमन के एकल अणु इमेजिंग<em&gt; Vivo में</em&gt; विखंडन द्वारा Cotranslational सक्रियकरण (CoTrAC) का उपयोग

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC) to image the production of protein molecules in live cells ...

Combining Single-molecule Manipulation and Imaging for the Study of Protein-DNA Interactions

प्रोटीन डीएनए सहभागिता के अध्ययन के लिए एकल अणु हेरफेर और इमेजिंग का मेल

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method ...

Visualizing the Interaction Between the Qdot-labeled Protein and Site-specifically Modified &#955; DNA at the Single Molecule Level

Qdot-लेबल प्रोटीन और साइट के बीच बातचीत visualizing-विशेष रूप से संशोधित λ डीएनए एकल अणु स्तर पर

The fluorescence microscopy&#160;has made great contributions in dissecting the mechanisms of complex biological processes at the single molecule level. ...