Name: zinc-finger nuclease enhanced gene targeting in human embryonic stem cells
Uploaded: 2014-08-23T14:00:00
Description: Watch this Scientific Journal Video about Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells at JoVE.com

העבודה המתוארת בפרוטוקול זה התאפשרה על ידי מימון מהממשלה ויקטוריאני, כחלק מברית של שיתוף פעולה עם מכון קליפורניה לרפואת רגנרטיבית (CIRM).

כל ההליכים מתבצעים בזרימה למינרית סטרילי. כל כלי התקשורת והפתרונים equilibrated ל37 ° C אלא אם צוינו אחרת. .1 הרחבת PSCs האדם (hESCs וhiPSCs, WA-09 שימוש בפרוטוקול זה) לTransfection הערה: אין צורך להרחיב את hESCs על Matrigel או...

<ol>
	<li>Nefzger, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lmx1a+Allows+Context-Specific+Isolation+of+Progenitors+of+GABAergic+or+Dopaminergic+Neurons+During+Neural+Differentiation+of+Embryonic+Stem+Cells.">Lmx1a Allows Context-Specific Isolation of Progenitors of GABAergic or Dopaminergic Neurons During Neural Differentiation of Embryonic Stem Cells.</a> Stem Cells. 30 (7), 1349-1361 (2012).</li><li>Zeng, W. R., Fabb, S. R. A., Haynes, J. M., Pouton, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extended+periods+of+neural+induction+and+propagation+of+embryonic+stem+cell-derived+neural+progenitors+with+EGF+and+FGF2+enhances+Lmx1a+expression+and+neurogenic+potential.">Extended periods of neural induction and propagation of embryonic stem cell-derived neural progenitors with EGF and FGF2 enhances Lmx1a expression and neurogenic potential.</a> Neurochemistry International. 59 (3), 394-403 (2011).</li><li>Collin, J., Lako, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concise+review:+putting+a+finger+on+stem+cell+biology:+zinc+finger+nuclease-driven+targeted+genetic+editing+in+human+embryonic+stem+cells.">Concise review: putting a finger on stem cell biology: zinc finger nuclease-driven targeted genetic editing in human embryonic stem cells.</a> Stem Cells. 29 (7), 1021-1033 (2011).</li><li>Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+and+prospects:+zinc-finger+nucleases+as+gene+therapy+agents.">Progress and prospects: zinc-finger nucleases as gene therapy agents.</a> Gene Therapy. 15 (22), 1463-1468 (2008).</li><li>Urnov, F. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+endogenous+human+gene+correction+using+designed+zinc-finger+nucleases.">Highly efficient endogenous human gene correction using designed zinc-finger nucleases.</a> Nature. 435 (7042), 646-651 (2005).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+targeting+of+expressed+and+silent+genes+in+human+ESCs+and+iESCs+using+zinc-finger+nucleases.">Efficient targeting of expressed and silent genes in human ESCs and iESCs using zinc-finger nucleases.</a> Nature Biotechnology. 27 (9), 851-857 (2009).</li><li>Lombardo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+editing+in+human+stem+cells+using+zinc+finger+nucleases+and+integrase-defective+lentiviral+vector+delivery.">Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery.</a> Nature Biotechnology. 25 (11), (2007).</li><li>Boch, J., Bonas, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xanthomonas+AvrBs3+family-type+III+effectors:+discovery+and+function.">Xanthomonas AvrBs3 family-type III effectors: discovery and function.</a> Annual Review of Phytopathology. 48, 419-436 (2010).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+engineering+of+human+embryonic+cells+using+TALE+nucleases.">Genetic engineering of human embryonic cells using TALE nucleases.</a> Nature Biotechnology. 29 (8), 731-734 (2011).</li><li>Tucker, K. L., Wang, Y., Dausman, J., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transgenic+mouse+strain+expressing+four+drug-selectable+marker+genes.">A transgenic mouse strain expressing four drug-selectable marker genes.</a> Nucleic Acids Research. 25 (18), 3745-3746 (1997).</li><li>Ram&#237;rez-Solis, R., Rivera-P&#233;rez, J., Wallace, J. D., Wims, M., Zheng, H., Bradley, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+DNA+microextraction:+a+method+to+screen+numerous+samples.">Genomic DNA microextraction: a method to screen numerous samples.</a> Analytical Biochemistry. 201 (2), 331-335 (1992).</li><li>Kawasaki, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+midbrain+dopaminergic+neurons+from+ES+cells+by+stromal+cell-derived+inducing+activity.">Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity.</a> Neuron. 28 (1), 31-40 (2000).</li><li>Denham, M., Thompson, L. H., Leung, J., P&#233;bay, A., Bj&#246;rklund, A., Dottori, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gli1+is+an+inducing+factor+in+generating+floor+plate+progenitor+cells+from+human+embryonic+stem+cells.">Gli1 is an inducing factor in generating floor plate progenitor cells from human embryonic stem cells.</a> Stem Cells. 28 (10), 1805-1815 (2010).</li><li>Smidt, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+homeodomain+gene+Ptx3+has+highly+restricted+brain+expression+in+mesencephalic+dopaminergic+neurons.">A homeodomain gene Ptx3 has highly restricted brain expression in mesencephalic dopaminergic neurons.</a> Proceedings of the National Academy of Sciences U.S.A. 94, 13305-13310 (1997).</li></ol>

הדור של שורות תאי כתב מציע אמצעי רב עוצמה למעקב אחר, לחזות ובודד תאים של ריבית מאוכלוסייה הטרוגנית נגזרת מhESCs. עם זאת, גן המיקוד באמצעות רקומבינציה הומולוגית הקונבנציונלית הוכיח להיות מאוד יעיל לESCs אדם 3. בפרוטוקול זה אנו מתארים טכניקה פשוטה יחסית להכנסת RP לאקסו...

פרוטוקולי התמיינות תאי גזע עובריים (ESC) זרם לגרום לאוכלוסיות תאים הטרוגנית, במיוחד ביחס לגזירה של פנוטיפים עצביים ספציפיים. כך, למרות שתרבויות להכיל את הפנוטיפ הסלולרי הרצוי, עצבי אחרים, סוגים מובחנים בלתי הלא עצבי ותא הם לעתים קרובות הווה 1. מאפיינים אלה מגבילים את היישום של ESC נגזר מקורות תא לשימוש בטיפול בתחליפי תא ובדוגמנות מחלה מבחנה. שורות תאי כתב גנטיות מציעות אמצעים כדי להמחיש, לעקוב ובודד תאים של עניין, ובלבד שהביטוי של חלבון הכתב (RP) מתרבה ביטוי אנדוגני. שימוש במקדמים באופן מיידי במעלה הזרם של אזור קוד גנטי יכול לשמש כדי להפיק כתבים גנטיים גולמיים אך מבנים כגון חסרי אלמנטי רגולציה המדויקים השולטים על ביטוי גני אנדוגני. בניגוד לכך, רקומבינציה הומולוגית מציעההזדמנות להבטיח ביטוי באיכות גבוהה של RP. בעבר, מיקוד וקטורים מיועדים לרקומבינציה הומולוגית בלוקוסים ספציפיים של עניין היה בשימוש למקד RPS בעכבר ESCs (mESCs) באמצעות electroporation כאמצעי למשלוח DNA 1,2. עם זאת הדור של שורות תאי כתב באמצעות רקומבינציה הומולוגית הקונבנציונלית הוא מאוד לא יעיל לESCs האנושי (hESCs), ובכך תועד רק בקומץ של מקרים (שנסקר ב3). על ידי שימוש בחלבון מהונדס chimeric המכיל שילוב של פוק אני nuclease עם מוטיבים אבץ אצבע ספציפי לאתר, ידועים קולקטיבי אבץ האצבע nucleases (ZFNs), יכולות להיות הציגו הפסקות כפולות גדיל DNA בלוקוסים הגנומי שנקבע מראש. כאשר וקטור DNA עם הומולוגיה לשני הצדדים של הפסקת גדיל הדנ&quot;א כפול הוא הוסיף, האתר הגנומי ניתן לתיקון על ידי רקומבינציה הומולוגית, המאפשר שילוב של רצף תורם DNA. טכניקה זו הוכיחה f שימושיתאו עריכה הגנומי בשני תאים ראשוניים אנושיים 4,5 וhESCs 6,7. nucleases עבודה מאוחרת יותר נצלה שעתוק כמו activator-מפעיל (TALENs), גורמי שעתוק המשמשים את מפעל פתוגנים 8, כדי לסייע בעיצוב של nucleases ספציפי לאתר 9. בפרוטוקול הבא אנחנו מדגימים את הדור של שורת תאי כתב hESC ידי electroporation של EGFP המכיל וקטור מיקוד הומולוגי 6 יחד עם ZFNs לhomeobox יותרת המוח האנושי 3 הלוקוס (PITX3). בעקבות בחירתה אנטיביוטיקה ל2-3 שבועות, hESCs עם DNA המשולב בצורה נכונה יכול להיות ידני הרים, הרחיב והוקרן בתחילה באמצעות PCR, ומאומתים בהמשך על ידי סופג דרום.

<table border="0" cellpadding="0" cellspacing="0" width="883">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Mouse Embryonic Fibroblasts (DR4)</td>
			<td style="width:207px;">GlobalStem</td>
			<td style="width:119px;">GSC-6004G</td>
			<td style="width:67px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gelatin</td>
			<td style="width:207px;">Sigma</td>
			<td style="width:119px;">G1393-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">HBSS, no Calcium, no Magnesium, no Phenol Red (HBSS)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">14175-095</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dispase</td>
			<td style="width:207px;">StemCell Technologies</td>
			<td style="width:119px;">7923</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Cell Scraper</td>
			<td style="width:207px;">Corning</td>
			<td style="width:119px;">3008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Accutase</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">A11105-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Y27632</td>
			<td style="width:207px;">Axon Medchem</td>
			<td style="width:119px;">Axon 1683</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer - 40um</td>
			<td>BD Biosciences</td>
			<td>352340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">33mm - 0.22 um filter</td>
			<td style="width:207px;">Millipore</td>
			<td style="width:119px;">SLGP033RS</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">rhFGF2</td>
			<td style="width:207px;">R&#38;D Systems</td>
			<td>233-FB-025/CF</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Electroporator</td>
			<td style="width:207px;">BioRad</td>
			<td style="width:119px;">165-2661</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">0.4cm electroporation cuvette</td>
			<td style="width:207px;">BioRad</td>
			<td style="width:119px;">165-2088</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Human TV-hPITX3-forward targeting construct</td>
			<td style="width:207px;">Addgene</td>
			<td style="width:119px;">31942</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:491px;">ZFN Kit; Human PITX3</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td style="width:119px;">CKOZFN1050-1KT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Puromycin</td>
			<td style="width:207px;">Invivogen</td>
			<td style="width:119px;">ant-pr-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Matrigel</td>
			<td style="width:207px;">BD Biosciences</td>
			<td>354277</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Geltrex</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">A1569601</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">NaCl</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td>S3014</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td style="width:207px;">Life Technologies</td>
			<td>10566-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Fetal Bovine Serum, Qualified, Heat Inactivated, US Origin (FBS)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">16140-071</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Pen/Strep</td>
			<td style="width:207px;">Life Technologies</td>
			<td>15070-063</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dulbecco&#39;s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">11320-033</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">KnockOut Serum Replacement (KSR)</td>
			<td style="width:207px;">Life Technologies</td>
			<td>10828-028</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">MEM Non-Essential Amino Acids&#160; (NEAA)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">11140-050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">GlutaMAX</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">35050-061</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">&#223;-mercaptoethanol</td>
			<td style="width:207px;">Life Technologies</td>
			<td>21985-023</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">N-Lauroylsarcosine sodium salt solution (Sarcosyl) (30%)</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td style="width:119px;">61747</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">EDTA</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td><a href="http://www.sigmaaldrich.com/catalog/product/sial/e9884?lang=en&amp;region=US">E9884</a></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Trizma Hydrochloride</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td>T3253</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Proteinase K solution (20mg/ml)</td>
			<td style="width:207px;">Bioline Australia</td>
			<td>BIO-37084</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Expand Long Template PCR System</td>
			<td style="width:207px;">Roche Australia</td>
			<td style="width:119px;">11681834001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">hPITX3 L arm gen. F (primer): 5&#8217; TGTCCTAAGGAGAATGGGTAACAGACA 3&#8217;</td>
			<td style="width:207px;">GeneWorks, Australia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:491px;">hPITX3 L arm GFP R (primer): 5&#8217; ACACGCTGAACTTGTGGCCGTTTA 3&#8217;</td>
			<td style="width:207px;">GeneWorks, Australia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">HyperLadder 1kb&#160;</td>
			<td style="width:207px;">Bioline Australia</td>
			<td>BIO-33025</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:491px;">GelRed</td>
			<td style="width:207px;">Jomar Bioscience, Australia</td>
			<td style="width:119px;">41003</td>
			<td></td>
		</tr>
	</tbody>
</table>

zinc-finger nuclease enhanced gene targeting in human embryonic stem cells

מגבלה העיקרית אחת עם פרוטוקולי התמיינות תאי גזע עובריים אנושיים (ESC) הנוכחיים היא הדור של אוכלוסיות תאים הטרוגנית. תרבויות אלה מכילות תאים של עניין, אלא גם נגועות בESCs מובחן, נגזרים שאינם עצביים ותת עצביים אחרים. זה מגביל את השימוש שלהם במבחנה וביישומי vivo, כגון דוגמנות במבחנה לגילוי סמים או טיפול בתחליפי תא. כדי לסייע להתגבר על זה, שורות תאי כתב, אשר מציעות אמצעים כדי לחזות, מסלול ובודד תאים של עניין, יכולות להיות מהונדסות. עם זאת, כדי להשיג את זה בתאי גזע עובריים אנושיים באמצעות רקומבינציה הומולוגית הקונבנציונלית היא מאוד לא יעילה. פרוטוקול זה מתאר מיקוד של homeobox יותרת המוח 3 הלוקוס (PITX3) בתאי גזע עובריים אנושיים באמצעות nucleases אבץ אצבע מעוצב בהתאמה אישית, המציג את הפסקות DNA גדיל פעמיים ספציפיות לאתר, יחד עםPITX3 - וקטור תורם DNA -specific EGFP. בעקבות הדור של הקו הסלולרי כתב PITX3, זה יכול לאחר מכן להיות מובחן באמצעות פרוטוקולים שפורסמו לשימוש במחקרים כגון במבחנה דוגמנות מחלה או החלפת תא הטיפול בפרקינסון.

בעקבות שיתוף electroporation של זוג אבץ אצבע PITX3 המותאם אישית תוכנן יחד עם PITX3 - וקטור תורם DNA -specific EGFP, ובחירת puromycin שלאחר מכן, שיבוטים hESC חיוביים בתחילה זוהו באמצעות הקרנה הגנומי PCR (איור 1). הכלאה כתם הדרומית של שיבוטים אלה PCR החיוביים עם 5 &#39;ו 3&#39; בדיקות ...

Watch this Scientific Journal Video about Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells at JoVE.com

Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

שורות תאי כתב להציע אמצעים כדי להמחיש, לעקוב ובודד תאים של ריבית מאוכלוסיות הטרוגניות. עם זאת, באמצעות רקומבינציה הומולוגית קונבנציונלית בתאי גזע עובריים אנושיים מיקוד הגן הוא מאוד לא יעיל. בזאת, אנו מתארים מיקוד מוקד PITX3 CNS המוח התיכון ספציפי גורם שעתוק עם EGFP באמצעות רקומבינציה הומולוגית המשופרת nuclease אבץ האצבע.

ג&#39;ין משופר Nuclease אבץ אצבע מיקוד בתאי גזע עוברי האנושי

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell ...

Research

JoVE Journal

Biology

Propagation of Human Embryonic Stem (ES) Cells

Propagation of Human Embryonic Stem ES Cells

רביה של האדם גזע עובריים (ES) תאים

Derivation of Human Embryonic Stem Cells by Immunosurgery

גזירת בתאי גזע עובריים אנושיים על ידי Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Probing for Mitochondrial Complex Activity in Human Embryonic Stem Cells

גשוש עבור פעילות קומפלקס מיטוכונדריאלי של בתאי גזע עובריים אנושיים

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and ...

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

במבחנה פליטת אור הדמיה vivo ג&#39;ין הכתב של בתאי גזע עובריים אנושיים

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

Chromatin Immunoprecipitation from Human Embryonic Stem Cells

הכרומטין immunoprecipitation מן בתאי גזע עובריים אנושיים

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are ...

In vitro Labeling of Human Embryonic Stem Cells for Magnetic Resonance Imaging

ב סימון במבחנה של בתאי גזע עובריים אנושיים עבור דימות תהודה מגנטית

Human embryonic stem cells (hESC) have demonstrated the ability to restore the injured myocardium. Magnetic resonance imaging (MRI) has emerged as one of ...

Culture and Maintenance of Human Embryonic Stem Cells  

תרבות ותחזוקה של בתאי גזע עובריים אנושיים

Human embryonic stem (hES) cells must be monitored and cared for in order to maintain healthy, undifferentiated cultures. At minimum, the cultures must be ...

Freezing and Thawing Human Embryonic Stem Cells

מקפיא הפשרה בתאי גזע עובריים אנושיים

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells ...

Video Bioinformatics Analysis of Human Embryonic Stem Cell Colony Growth

וידאו ביואינפורמטיקה ניתוח גדילה אנושי בתאי גזע עובריים קולוני

Because video data are complex and are comprised of many images, mining information from video material is difficult to do without the aid of computer ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

התמיינות של תאים עובריים לתוך מבשרי Oligodendrocyte

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...