Name: zinc-finger nuclease enhanced gene targeting in human embryonic stem cells
Uploaded: 2014-08-23T14:00:00
Description: Watch this Scientific Journal Video about Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells at JoVE.com

Bu protokol açıklanan Çalışma Rejeneratif Tıp Kaliforniya Enstitüsü (CIRM) ile bir işbirliği ittifak parçası olarak Victoria Hükümeti tarafından finanse edilerek mümkün olmuştur.

Tüm işlemler steril bir laminer akış başlığı içinde yapılır. Aksi belirtilmediği sürece tüm ortam ve solüsyonlar 37 ° C&#39;de dengelenir. Transfaksiyon için (bu Protokolde kullanılan HESC ve hiPSCs, WA-09) İnsan ÖGŞ 1. Genişleme Not: Matrigel veya Geltrex üzerinde HESC genişletmek için gerekli değildir. fare embriyonik fibroblastlar (MEF&#39;ler) genişletilmiş HESC MEF giderme aşaması aşağıdaki elektroporasyon veya nucleofection i?...

<ol>
	<li>Nefzger, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lmx1a+Allows+Context-Specific+Isolation+of+Progenitors+of+GABAergic+or+Dopaminergic+Neurons+During+Neural+Differentiation+of+Embryonic+Stem+Cells.">Lmx1a Allows Context-Specific Isolation of Progenitors of GABAergic or Dopaminergic Neurons During Neural Differentiation of Embryonic Stem Cells.</a> Stem Cells. 30 (7), 1349-1361 (2012).</li><li>Zeng, W. R., Fabb, S. R. A., Haynes, J. M., Pouton, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extended+periods+of+neural+induction+and+propagation+of+embryonic+stem+cell-derived+neural+progenitors+with+EGF+and+FGF2+enhances+Lmx1a+expression+and+neurogenic+potential.">Extended periods of neural induction and propagation of embryonic stem cell-derived neural progenitors with EGF and FGF2 enhances Lmx1a expression and neurogenic potential.</a> Neurochemistry International. 59 (3), 394-403 (2011).</li><li>Collin, J., Lako, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concise+review:+putting+a+finger+on+stem+cell+biology:+zinc+finger+nuclease-driven+targeted+genetic+editing+in+human+embryonic+stem+cells.">Concise review: putting a finger on stem cell biology: zinc finger nuclease-driven targeted genetic editing in human embryonic stem cells.</a> Stem Cells. 29 (7), 1021-1033 (2011).</li><li>Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+and+prospects:+zinc-finger+nucleases+as+gene+therapy+agents.">Progress and prospects: zinc-finger nucleases as gene therapy agents.</a> Gene Therapy. 15 (22), 1463-1468 (2008).</li><li>Urnov, F. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+endogenous+human+gene+correction+using+designed+zinc-finger+nucleases.">Highly efficient endogenous human gene correction using designed zinc-finger nucleases.</a> Nature. 435 (7042), 646-651 (2005).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+targeting+of+expressed+and+silent+genes+in+human+ESCs+and+iESCs+using+zinc-finger+nucleases.">Efficient targeting of expressed and silent genes in human ESCs and iESCs using zinc-finger nucleases.</a> Nature Biotechnology. 27 (9), 851-857 (2009).</li><li>Lombardo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+editing+in+human+stem+cells+using+zinc+finger+nucleases+and+integrase-defective+lentiviral+vector+delivery.">Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery.</a> Nature Biotechnology. 25 (11), (2007).</li><li>Boch, J., Bonas, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xanthomonas+AvrBs3+family-type+III+effectors:+discovery+and+function.">Xanthomonas AvrBs3 family-type III effectors: discovery and function.</a> Annual Review of Phytopathology. 48, 419-436 (2010).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+engineering+of+human+embryonic+cells+using+TALE+nucleases.">Genetic engineering of human embryonic cells using TALE nucleases.</a> Nature Biotechnology. 29 (8), 731-734 (2011).</li><li>Tucker, K. L., Wang, Y., Dausman, J., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transgenic+mouse+strain+expressing+four+drug-selectable+marker+genes.">A transgenic mouse strain expressing four drug-selectable marker genes.</a> Nucleic Acids Research. 25 (18), 3745-3746 (1997).</li><li>Ram&#237;rez-Solis, R., Rivera-P&#233;rez, J., Wallace, J. D., Wims, M., Zheng, H., Bradley, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+DNA+microextraction:+a+method+to+screen+numerous+samples.">Genomic DNA microextraction: a method to screen numerous samples.</a> Analytical Biochemistry. 201 (2), 331-335 (1992).</li><li>Kawasaki, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+midbrain+dopaminergic+neurons+from+ES+cells+by+stromal+cell-derived+inducing+activity.">Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity.</a> Neuron. 28 (1), 31-40 (2000).</li><li>Denham, M., Thompson, L. H., Leung, J., P&#233;bay, A., Bj&#246;rklund, A., Dottori, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gli1+is+an+inducing+factor+in+generating+floor+plate+progenitor+cells+from+human+embryonic+stem+cells.">Gli1 is an inducing factor in generating floor plate progenitor cells from human embryonic stem cells.</a> Stem Cells. 28 (10), 1805-1815 (2010).</li><li>Smidt, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+homeodomain+gene+Ptx3+has+highly+restricted+brain+expression+in+mesencephalic+dopaminergic+neurons.">A homeodomain gene Ptx3 has highly restricted brain expression in mesencephalic dopaminergic neurons.</a> Proceedings of the National Academy of Sciences U.S.A. 94, 13305-13310 (1997).</li></ol>

Raportör hücre çizgilerinin üretimi, etiket görselleştirmek ve hESC türetilmiş bir heterojen popülasyonda ilgi konusu hücrelerin izole edilmesi için güçlü bir araç sunar. Bununla birlikte, geleneksel homolog rekombinasyon yoluyla hedef geni insan EKH 3 için son derece randımansız olduğu kanıtlanmıştır. Bu protokolde ZFNs ile birlikte yaygın olarak kullanılan hedefleme vektörü kullanılarak hESC, ekson PITX3 lokusunun bir RP içine verilmesi için nispeten basit bir tekniği...

Mevcut embriyonik kök hücre (ESC) diferansiyasyon protokolleri, özellikle spesifik sinir hücresi fenotipleri türetme ile ilgili olarak, heterojen hücre popülasyonlarının neden olur. Kültürler, arzu edilen hücresel fenotipi, diğer nöronal içeren rağmen bunlar, nöronal olmayan ve BM-farklılaşmış hücre türleri genellikle 1 bulunmaktadır. Bu özellikler ESC uygulama hücre replasman tedavisinde kullanım için ve in vitro hastalık modelleme hücre kaynaklardan elde edilen sınırlar. Genetik raportör hücre çizgileri, görselleştirmek izlemek ve ilgili hücreleri izole etmek için bir araç sunar, raportör protein (RP) ifadesi, endojen ekspresyonu üretir şartıyla. Bir gen kodlama bölgesinin hemen üst promoterlerin kullanımı ham genetik muhabir elde etmek için kullanılabilir, ancak bu gibi yapılar, endojen gen ekspresyonunu kontrol hassas düzenleyici elemanları yoksundur. Bunun aksine, homolog rekombinasyon sunarfırsat RP yüksek sadakat ifade sağlamak. Geçmişte, ilgi konusu özel konumlara homolog yeniden birleştirme için tasarlanmış hedefleme vektörleri DNA aktarımından 1,2 için bir araç olarak, elektroporasyon kullanılarak fare ESCs (mESCs) olarak RPs hedeflemek üzere kullanılmıştır. Bununla birlikte, homolog rekombinasyon yoluyla, geleneksel raportör hücre çizgilerinin nesil insan EKH (HESC) son derece yetersiz olduğu ve bu nedenle (3 gözden geçirilmiştir) durumlarda bir avuç belgelenmiştir. Çinko-parmak nükleazlar (ZFNs) gibi yaygın olarak bilinen siteye spesifik çinko-parmak motifleri, bir Fok I nükleaz füzyonunu ihtiva eden bir yapılandırılmış, kimerik proteini kullanarak, DNA çift iplikli sonları önceden belirlenmiş genomik lokusları sokulabilir. DNA çift iplik arası her iki taraf için homolojisi olan bir DNA vektörü eklendiğinde, genomik DNA sitesi, donör sekansının bir girişe izin verir, homolog rekombinasyon ile tamir edilebilir. Bu teknik kullanışlı f kanıtlanmıştırveya insan primer hücre 4,5 ve 6,7 HESC hem de genomik düzenleme. Son çalışmalar kullanmıştır transkripsiyon faaliyete geçirme gibi efektör nükleazlar (TALENS), bitki kopyalama faktörleri ile ikinci site-spesifik nükleazlara 9 tasarımında yardımcı olmak için, 8 patojenleri. Aşağıdaki protokolde, insan hipofiz homeoboks 3 (PITX3) lokusu için ZFNs birlikte homolog hedefleme vektörü ihtiva eden bir 6 EGFP elektroporasyon ile HESC raportör hücre hattının üretilmesini göstermektedir. 2-3 hafta boyunca antibiyotik seçimi takiben, doğru entegre DNA ile HESC elle aldı genişletilmiş ve PCR ile başlangıçta ekranlı ve daha sonra Southern lekeleme tarafından onaylanmış olabilir.

<table border="0" cellpadding="0" cellspacing="0" width="883">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Mouse Embryonic Fibroblasts (DR4)</td>
			<td style="width:207px;">GlobalStem</td>
			<td style="width:119px;">GSC-6004G</td>
			<td style="width:67px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gelatin</td>
			<td style="width:207px;">Sigma</td>
			<td style="width:119px;">G1393-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">HBSS, no Calcium, no Magnesium, no Phenol Red (HBSS)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">14175-095</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dispase</td>
			<td style="width:207px;">StemCell Technologies</td>
			<td style="width:119px;">7923</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Cell Scraper</td>
			<td style="width:207px;">Corning</td>
			<td style="width:119px;">3008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Accutase</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">A11105-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Y27632</td>
			<td style="width:207px;">Axon Medchem</td>
			<td style="width:119px;">Axon 1683</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer - 40um</td>
			<td>BD Biosciences</td>
			<td>352340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">33mm - 0.22 um filter</td>
			<td style="width:207px;">Millipore</td>
			<td style="width:119px;">SLGP033RS</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">rhFGF2</td>
			<td style="width:207px;">R&#38;D Systems</td>
			<td>233-FB-025/CF</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Electroporator</td>
			<td style="width:207px;">BioRad</td>
			<td style="width:119px;">165-2661</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">0.4cm electroporation cuvette</td>
			<td style="width:207px;">BioRad</td>
			<td style="width:119px;">165-2088</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Human TV-hPITX3-forward targeting construct</td>
			<td style="width:207px;">Addgene</td>
			<td style="width:119px;">31942</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:491px;">ZFN Kit; Human PITX3</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td style="width:119px;">CKOZFN1050-1KT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Puromycin</td>
			<td style="width:207px;">Invivogen</td>
			<td style="width:119px;">ant-pr-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Matrigel</td>
			<td style="width:207px;">BD Biosciences</td>
			<td>354277</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Geltrex</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">A1569601</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">NaCl</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td>S3014</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td style="width:207px;">Life Technologies</td>
			<td>10566-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Fetal Bovine Serum, Qualified, Heat Inactivated, US Origin (FBS)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">16140-071</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Pen/Strep</td>
			<td style="width:207px;">Life Technologies</td>
			<td>15070-063</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dulbecco&#39;s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">11320-033</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">KnockOut Serum Replacement (KSR)</td>
			<td style="width:207px;">Life Technologies</td>
			<td>10828-028</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">MEM Non-Essential Amino Acids&#160; (NEAA)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">11140-050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">GlutaMAX</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">35050-061</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">&#223;-mercaptoethanol</td>
			<td style="width:207px;">Life Technologies</td>
			<td>21985-023</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">N-Lauroylsarcosine sodium salt solution (Sarcosyl) (30%)</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td style="width:119px;">61747</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">EDTA</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td><a href="http://www.sigmaaldrich.com/catalog/product/sial/e9884?lang=en&amp;region=US">E9884</a></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Trizma Hydrochloride</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td>T3253</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Proteinase K solution (20mg/ml)</td>
			<td style="width:207px;">Bioline Australia</td>
			<td>BIO-37084</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Expand Long Template PCR System</td>
			<td style="width:207px;">Roche Australia</td>
			<td style="width:119px;">11681834001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">hPITX3 L arm gen. F (primer): 5&#8217; TGTCCTAAGGAGAATGGGTAACAGACA 3&#8217;</td>
			<td style="width:207px;">GeneWorks, Australia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:491px;">hPITX3 L arm GFP R (primer): 5&#8217; ACACGCTGAACTTGTGGCCGTTTA 3&#8217;</td>
			<td style="width:207px;">GeneWorks, Australia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">HyperLadder 1kb&#160;</td>
			<td style="width:207px;">Bioline Australia</td>
			<td>BIO-33025</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:491px;">GelRed</td>
			<td style="width:207px;">Jomar Bioscience, Australia</td>
			<td style="width:119px;">41003</td>
			<td></td>
		</tr>
	</tbody>
</table>

zinc-finger nuclease enhanced gene targeting in human embryonic stem cells

Mevcut insan embriyonik kök hücre (ESC) farklılaşma protokolleri ile bir büyük sınırlama heterojen hücre popülasyonlarının nesil. Bu kültürler, ilgi hücreleri içerir, fakat aynı zamanda farklılaşmamış EKH, nöral olmayan türevleri ve diğer alt-tipler ile nöronal kirlenir. Bu, in vitro olarak ve bu ilaç keşfi ya da hücre replasman tedavisi için, in vitro modelleme gibi in vivo uygulamalarda, kullanımlarını kısıtlar. Bu aşabilmesi için, görselleştirmek parça ve ilgi hücreleri izole etmek için bir araç sunuyoruz muhabiri hücre hatları, mühendislik olabilir. Geleneksel homolog rekombinasyon son derece verimsiz cihaz aracılığıyla Ancak, insan embriyonik kök hücreleri bunu başarmak için. Bu protokol ile birlikte, Hipofiz homeobox insan embriyonik kök hücreleri 3 (PITX3) lokus site-spesifik çift iplikli DNA kopmalarını tanıtmak özel olarak tasarlanmış, çinko-parmak nükleazlar kullanılarak hedeflenmesi tarifPITX3 - EGFP -spesifik DNA donör vektörü. PITX3 raportör hücre çizgisinin üretilmesi sonrasında, daha sonra, in vitro olarak, Parkinson hastalığı, modelleme ya da hücre tedavisi gibi değiştirme çalışmalarında kullanılmak için yayınlanmış protokoller kullanılarak ayırt edilebilir.

PITX3 birlikte özel olarak tasarlanmış PITX3 çinko-parmak çiftinin eş elektroporasyon izlenerek - EGFP özgü bir DNA vektörü verici ve sonraki puromisin seçimi, pozitif HESC genomik klonları başlangıçta PCR taraması (Şekil 1) ile tespit edilmiştir. Bu PCR ile pozitif klonların 5 &#39;ve 3&#39; özgü problar Güney benek hibridizasyonu,% 19 oranında bir verim ile, PITX3 konumunda (Şekil 2) 1. ekson doğru hedeflemeyi doğruladı. <...

Watch this Scientific Journal Video about Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells at JoVE.com

Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

Muhabir hücre çizgileri, görselleştirmek etiket ve heterojen popülasyonlar ilgi hücreleri izole etmek için bir araç sunmaktadır. Bununla birlikte, hedef gen, insan embriyonik kök hücreleri alışılmış homolog rekombinasyon kullanılarak son derece verimsizdir. Bu yazıda, çinko-parmak nukleaz gelişmiş homolog rekombinasyon kullanarak EGFP ile CNS Ortabeyin özel transkripsiyon faktörü PITX3 odağı hedefleme açıklar.

İnsan Embriyonik Kök Hücreleri Hedefleme Çinko parmak Nükleazlar Geliştirilmiş Gen

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell ...

Research

JoVE Journal

Biology

Propagation of Human Embryonic Stem (ES) Cells

Propagation of Human Embryonic Stem ES Cells

İnsan Embriyonik Kök Hücre (ES) yayılması

Derivation of Human Embryonic Stem Cells by Immunosurgery

Immunosurgery İnsan Embriyonik Kök Hücreleri türetilmesi

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Probing for Mitochondrial Complex Activity in Human Embryonic Stem Cells

İnsan Embriyonik Kök Hücreleri Mitokondrial Kompleksi Aktivite araştırmayı

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and ...

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

In vitro ve in vivo Biyoparlaklık Reporter Gen Görüntüleme İnsan Embriyonik Kök Hücreleri

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

Chromatin Immunoprecipitation from Human Embryonic Stem Cells

İnsan Embriyonik Kök Hücre Kromatin Immunoprecipitation

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are ...

In vitro Labeling of Human Embryonic Stem Cells for Magnetic Resonance Imaging

İnsan Embriyonik Kök Hücreleri Manyetik Rezonans Görüntüleme için in vitro Etiketleme

Human embryonic stem cells (hESC) have demonstrated the ability to restore the injured myocardium. Magnetic resonance imaging (MRI) has emerged as one of ...

Culture and Maintenance of Human Embryonic Stem Cells  

İnsan Embriyonik Kök Hücre Kültürü ve Bakım

Human embryonic stem (hES) cells must be monitored and cared for in order to maintain healthy, undifferentiated cultures. At minimum, the cultures must be ...

Freezing and Thawing Human Embryonic Stem Cells

İnsan Embriyonik Kök Hücreler Donma ve Çözülme

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells ...

Video Bioinformatics Analysis of Human Embryonic Stem Cell Colony Growth

Video Biyoinformatik İnsan Embriyonik Kök Hücre Colony Büyüme Analizi

Because video data are complex and are comprised of many images, mining information from video material is difficult to do without the aid of computer ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

Embriyonik Kök Hücreler farklılaşma oligodendrosit Öncüleri

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...