Name: genome-wide snapshot of chromatin regulators and states in xenopus embryos by chip-seq
Uploaded: 2015-02-26T13:00:00
Duration: 10 min 23 s
Description: Watch this Scientific Journal Video about Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq at JoVE.com

We thank Chris Benner for implementing the X. tropicalis genome (xenTro2, xenTro2r) into HOMER and the Gilchrist lab for discussions on post-sequencing analysis. I.P. assisted the GO term analysis. G.E.G and J.C.S. were supported by the Wellcome Trust and are now supported by the Medical Research Council (program number U117597140).

<ol>
	<li>Gilmour, D. S., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detecting+protein-DNA+interactions+in+vivo:+distribution+of+RNA+polymerase+on+specific+bacterial+genes.">Detecting protein-DNA interactions in vivo: distribution of RNA polymerase on specific bacterial genes.</a> Proc Natl Acad Sci U S A. 81 (14), 4275-4279 (1984).</li><li>Gilmour, D. S., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+interactions+of+RNA+polymerase+II+with+genes+of+Drosophila+melanogaster.">In vivo interactions of RNA polymerase II with genes of Drosophila melanogaster.</a> Mol Cell Biol. 5 (8), 2009-2018 (1985).</li><li>Solomon, M. J., Larsen, P. L., Varshavsky, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+protein-DNA+interactions+in+vivo+with+formaldehyde:+evidence+that+histone+H4+is+retained+on+a+highly+transcribed+gene.">Mapping protein-DNA interactions in vivo with formaldehyde: evidence that histone H4 is retained on a highly transcribed gene.</a> Cell. 53 (6), 937-947 (1988).</li><li>Ren, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+location+and+function+of+DNA+binding+proteins.">Genome-wide location and function of DNA binding proteins.</a> Science. 290 (5500), 2306-2309 (2000).</li><li>Johnson, D., Mortazavi, A., Myers, R., Wold, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+mapping+of+in+vivo+protein-DNA+interactions.">Genome-wide mapping of in vivo protein-DNA interactions.</a> Science. 316 (5830), 1497-1502 (2007).</li><li>Hellsten, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genome+of+the+Western+clawed+frog+Xenopus+tropicalis.">The genome of the Western clawed frog Xenopus tropicalis.</a> Science. 328 (5978), 633-636 (2010).</li><li>Lee, T. I., Johnstone, S. E., Young, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+and+microarray-based+analysis+of+protein+location.">Chromatin immunoprecipitation and microarray-based analysis of protein location.</a> Nature Protocols. 1 (2), 729-748 (2006).</li><li>Blythe, S. A., Reid, C. D., Kessler, D. S., Klein, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+in+early+Xenopus+laevis+embryos.">Chromatin immunoprecipitation in early Xenopus laevis embryos.</a> Dev Dyn. 238 (6), 1422-1432 (2009).</li><li>Gentsch, G. E., Smith, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+physical+chromatin+associations+across+the+Xenopus+genome+by+chromatin+immunoprecipitation.">Investigating physical chromatin associations across the Xenopus genome by chromatin immunoprecipitation.</a> Cold Spring Harb Protoc. 2014 (5), (2014).</li><li>Ubbels, G. A., Hara, K., Koster, C. H., Kirschner, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+a+functional+role+of+the+cytoskeleton+in+determination+of+the+dorsoventral+axis+in+Xenopus+laevis+eggs.">Evidence for a functional role of the cytoskeleton in determination of the dorsoventral axis in Xenopus laevis eggs.</a> J Embryol Exp Morphol. 77, 15-37 (1983).</li><li>Langmead, B., Trapnell, C., Pop, M., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrafast+and+memory-efficient+alignment+of+short+DNA+sequences+to+the+human+genome.">Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.</a> Genome Biol. 10 (3), R25 (2009).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Heinz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+combinations+of+lineage-determining+transcription+factors+prime+cis-regulatory+elements+required+for+macrophage+and+B+cell+identities.">Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities.</a> Mol Cell. 38 (4), 576-589 (2010).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+analysis+of+ChIP-Seq+(MACS).">Model-based analysis of ChIP-Seq (MACS).</a> Genome Biol. 9 (9), R137 (2008).</li><li>Robinson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomics+viewer.">Integrative genomics viewer.</a> Nat Biotechnol. 29 (1), 24-26 (2011).</li><li>Thorvaldsdottir, H., Robinson, J. T., Mesirov, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+Genomics+Viewer+(IGV):+high-performance+genomics+data+visualization+and+exploration.">Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration.</a> Brief Bioinform. 14 (2), 178-192 (2013).</li><li>Imoto, S., Nolan, J., Bioinformatics Miyano, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> 20 (9), 1453-1454 (2004).</li><li>Camacho, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BLAST+:+architecture+and+applications.">BLAST+: architecture and applications.</a> BMC Bioinformatics. 10, 421 (2009).</li><li>Conesa, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blast2GO:+a+universal+tool+for+annotation,+visualization+and+analysis+in+functional+genomics+research.">Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research.</a> Bioinformatics. 21 (18), 3674-3676 (2005).</li><li>Sive, H., Grainger, R., Harland, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Early development of Xenopus laevis: A laboratory manual. , (2000).</li><li>Chen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+evaluation+of+factors+influencing+ChIP-seq+fidelity.">Systematic evaluation of factors influencing ChIP-seq fidelity.</a> Nat Methods. 9 (6), 609-614 (2012).</li><li>Sharov, A. A., Ko, M. S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exhaustive+search+for+over-represented+DNA+sequence+motifs+with+CisFinder.">Exhaustive search for over-represented DNA sequence motifs with CisFinder.</a> DNA Res. 16 (5), 261-273 (2009).</li><li>Bailey, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MEME+SUITE:+tools+for+motif+discovery+and+searching.">MEME SUITE: tools for motif discovery and searching.</a> Nucl Acids Res. 37 (2), W202-W208 (2009).</li><li>Livak, K. J., Schmittgen, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+relative+gene+expression+data+using+real-time+quantitative+PCR+and+the+2(-Delta+Delta+C(T))+Method.">Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.</a> Methods. 25 (4), 402-408 (2001).</li><li>Park, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq:+advantages+and+challenges+of+a+maturing+technology.">ChIP-seq: advantages and challenges of a maturing technology.</a> Nat Rev Genet. 10 (10), 669-680 (2009).</li><li>Gentsch, G. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+T-box+transcription+factor+profiling+reveals+joint+regulation+of+embryonic+neuromesodermal+bipotency.">In vivo T-box transcription factor profiling reveals joint regulation of embryonic neuromesodermal bipotency.</a> Cell Rep. 4 (6), 1185-1196 (2013).</li><li>Barabasi, A. L., Oltvai, Z. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Network+biology:+understanding+the+cell's+functional+organization.">Network biology: understanding the cell's functional organization.</a> Nat Rev Genet. 5 (2), 101-113 (2004).</li><li>Biggin, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+transcription+networks+as+highly+connected,+quantitative+continua.">Animal transcription networks as highly connected, quantitative continua.</a> Dev Cell. 21 (4), 611-626 (2011).</li><li>Nieuwkoop, P. D., Faber, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Normal table of Xenopus laevis (Daudin): a systematical and chronological survey of the development from the fertilized egg till the end of metamorphosis. , (1994).</li><li>Akkers, R. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+hierarchy+of+H3K4me3+and+H3K27me3+acquisition+in+spatial+gene+regulation+in+Xenopus+embryos.">A hierarchy of H3K4me3 and H3K27me3 acquisition in spatial gene regulation in Xenopus embryos.</a> Dev Cell. 17 (3), 425-434 (2009).</li><li>Yoon, S. J., Wills, A. E., Chuong, E., Gupta, R., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> HEB and E2A function as SMAD/FOXH1 cofactors. Genes Dev. 25 (15), 1654-1661 (2011).</li><li>Jallow, Z., Jacobi, U. G., Weeks, D. L., Dawid, I. B., Veenstra, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specialized+and+redundant+roles+of+TBP+and+a+vertebrate-specific+TBP+paralog+in+embryonic+gene+regulation+in+Xenopus.">Specialized and redundant roles of TBP and a vertebrate-specific TBP paralog in embryonic gene regulation in Xenopus.</a> Proc Natl Acad Sci U S A. 101 (37), 13525 (2004).</li><li>Buchholz, D. R., Paul, B. D., Shi, Y. -. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene-specific+changes+in+promoter+occupancy+by+thyroid+hormone+receptor+during+frog+metamorphosis.+Implications+for+developmental+gene+regulation.">Gene-specific changes in promoter occupancy by thyroid hormone receptor during frog metamorphosis. Implications for developmental gene regulation.</a> J Biol Chem. 280 (50), 41222-41228 (2005).</li><li>Wills, A. E., Guptaa, R., Chuonga, E., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+and+deep+sequencing+in+Xenopus+tropicalis+and+Xenopus+laevis.">Chromatin immunoprecipitation and deep sequencing in Xenopus tropicalis and Xenopus laevis.</a> Methods. 66 (3), 410-421 (2014).</li><li>Metz, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+formaldehyde-induced+modifications+in+proteins:+reactions+with+model+peptides.">Identification of formaldehyde-induced modifications in proteins: reactions with model peptides.</a> J Biol Chem. 279 (8), 6235-6243 (2004).</li><li>Landt, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+guidelines+and+practices+of+the+ENCODE+and+modENCODE+consortia.">ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.</a> Genome Res. 22 (9), 1813-1831 (2012).</li><li>Mazzoni, E. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell-based+mapping+of+developmental+transcriptional+programs.">Embryonic stem cell-based mapping of developmental transcriptional programs.</a> Nat Methods. 8 (12), 1056-1058 (2011).</li><li>Deal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+method+for+gene+expression+and+chromatin+profiling+of+individual+cell+types+within+a+tissue.">A simple method for gene expression and chromatin profiling of individual cell types within a tissue.</a> Dev Cell. 18 (6), 1030-1040 (2010).</li><li>Bonn, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue-specific+analysis+of+chromatin+state+identifies+temporal+signatures+of+enhancer+activity+during+embryonic+development.">Tissue-specific analysis of chromatin state identifies temporal signatures of enhancer activity during embryonic development.</a> Nat Genet. 44 (2), 148-156 (2012).</li></ol>

The authors declare that they have no competing financial interests.

ويحدد بروتوكول لدينا كيفية جعل وتحليل الجينوم على نطاق ملامح لونين من أجنة القيطم. وهو يغطي كل خطوة من البروتينات عبر ربط مواضع الذاتية في الجسم الحي لمعالجة الملايين من يقرأ تمثل مواقع الجينومية المخصب في سيليكون. منذ أعدادا متزايدة من مسودات الجينوم متوفرة، وينبغي أن يكون هذا البروتوكول ينطبق على الكائنات الحية وغير نموذج نموذج الأخرى. قسم تجريبي أهم، والذي يحدد هذا البروتوكول بصرف النظر عن الأعمال السابقة 8،31،33،34، هو الإجراء بعد تثبيت لاستخراج النوى عبر ربط. فإنه يسهل كفاءة solubilisation لونين والقص وسهلة الارتقاء. جنبا إلى جنب مع كفاءة محسنة لإعداد مكتبة هذا البروتوكول يسمح بناء عالية التعقيد، المكتبات رقاقة وما يليها من نصف إلى مليوني الخلايا معربا عن حاتمة المصاحب لونين من الفائدة. للتجارب الشذرة-QPCR، وعدد قليل عشرة آلاف من هذه الخلايا تكون عادة كافيةللتحقق من تخصيب DNA في ستة مواضع ربما الجينومية متميزة. هذه الأرقام هي تقديرات متحفظة، ولكن قد تختلف اعتمادا على البروتين مستوى التعبير، وجودة الأجسام المضادة، عبر ربط الكفاءة، وحاتمة للمعاقين. كدليل، والقيطم جنين واحد يحتوي على حوالي 4،000 خلايا في مرحلة منتصف الأريمة (8.5 بعد Nieuwkoop وفابر 29)، 40،000 الخلايا في مرحلة متأخرة المعيدة (12) و 100،000 الخلايا في مرحلة tailbud في وقت مبكر (20). الوقت المحدد لتثبيت مناعي فعال يحتاج إلى أن تحدد تجريبيا عن طريق رقاقة-QPCR (المادة 10). بشكل عام، يطلب من الأوقات تثبيت أطول إذا كانت التجربة تتضمن X. المورق الأجنة، مراحل النمو المبكرة، وDNA خصائص ملزمة ضعيفة (أو غير المباشرة). ومع ذلك، فمن غير المستحسن تحديد القيطم الأجنة أطول من 40 دقيقة، أو تجهيز المزيد من الأجنة مما هو مذكور (القسم 3)، ويصبح لونين القص أقل كفاءة. ومن المهم عدملاستخدام أي الجلايسين بعد تثبيت وهذه الخطوة مشتركة لتبريد الفورمالديهايد يمكن أن تجعل استخراج النووي من أجنة صفار الغنية صعبة للغاية. حاليا، والسبب في ذلك غير معروف. فمن المتصور أن ناتج إضافة الفورمالديهايد جليكاين يتفاعل أكثر مع الأمينية مجموعات أو بقايا أرجينين 35 N-المحطة. الجسم المضاد هو مفتاح أي تجربة الشذرة وتحتاج إلى ضوابط كافية لتنفيذها لإظهار خصوصيته لحاتمة ذات الاهتمام (انظر المبادئ التوجيهية التي كتبها Landt وآخرون 36). إذا لم يكن هناك الأجسام المضادة الشذرة الصف هو متاح، وإدخال الموسومة حاتمة البروتينات الانصهار المقابلة قد يكون بديلا مشروعا وهذه البروتينات يمكن أن تشغل endogeneous مواقع الربط 37. في هذه الحالة، الأجنة uninjected هي الأفضل لاستخدامه كقاعدة سيطرة سلبية بدلا من رقاقة مع المصل غير محددة. ويمكن أيضا أن تطبق هذه الاستراتيجية إذا يتم التعبير عن بروتين من الفائدة عند مستويات منخفضة مما أدى إلى انتعاش الفقراء من ENRIDNA جنة التعليم العالي. كما لصنع المكتبات رقاقة وما يليها، وذلك بسبب انخفاض كمية من الحمض النووي في الاستخدام، فمن المستحسن أن تختار لإجراءات التي تقلل من عدد من الخطوات التنظيف والجمع بين ردود الفعل للحفاظ على أي فقدان DNA كحد أدنى. محولات والاشعال يجب أن تكون متوافقة مع تسلسل متعدد ومنصة NGS (انظر الجدول مواد معينة / المعدات). إذا باستخدام Y-محولات (التي كانت تحمل أسلحة واحدة الذين تقطعت بهم السبل طويلة)، فمن الأهمية بمكان ما قبل تضخيم المكتبة مع 3-5 جولات من PCR قبل إدراج DNA-اختيار حجم (على سبيل المثال، من 100 إلى 300 بي بي) من قبل الكهربائي للهلام. الغايات واحدة الذين تقطعت بهم السبل تسبب شظايا الحمض النووي للهجرة بتباين. محاكمة يدير مع كميات مختلفة من الحمض النووي المدخلات (على سبيل المثال، 0.1، 0.5، 1، 2، 5، 10 و 20 نانوغرام) ينصح لتحديد العدد الإجمالي للدورات PCR (أقل من أو يساوي 18 دورات) المطلوبة لجعل حجم مكتبة -selected 100 إلى 200 نانوغرام. تقليل عدد دورات PCR يجعل تسلسل reduيقرأ أقل احتمالا ndant. المرحلة الصلبة الخرز تجميد عكسها جيدة تنظيف الكواشف لاسترداد بكفاءة DNA من الاهتمام وموثوق إزالة أي محولات حرة وdimers من ربط وردود الفعل PCR. من حيث عدد ونوع وطول يقرأ، حول 20-30000000 نهاية واحدة يقرأ من 36 سنة مضت يكفي بالنسبة لمعظم التجارب رقاقة يليها لتغطية الجينوم القيطم كله مع عمق كاف. الآلات NGS الأكثر انتشارا هي قادرة بشكل روتيني لتلبية هذه المعايير. ومع ذلك، قد يكون من المفيد لزيادة عدد من يقرأ إذا كان من المتوقع لتوزيعات واسعة من يقرأ، كما لوحظ مع بعض التعديلات هيستون، بدلا من قمم حادة. بالنسبة للعديد من التجارب رقاقة وما يليها، من 4 إلى 5 مكتبات المفهرسة مختلفة يمكن تجميعها والتسلسل في تدفق واحد حارات خلية باستخدام آلة NGS عالية الأداء. أحيانا المستحسن أيضا لتمديد طول القراءة وتسلسل طرفي القالب الحمض النووي (إقران النهاية) لزيادة mappability ثالدجاجة تحليل لونين داخل المناطق الجينومية المتكررة. وقد تم تطبيق هذا البروتوكول بنجاح إلى مجموعة واسعة من الميزات لونين مثل عوامل النسخ، وسطاء الإشارات والتعديلات هيستون ما بعد متعدية. ومع ذلك، الأجنة تكتسب درجة متزايدة من عدم التجانس الخلوية لأنها تطوير وتصبح ملامح لونين من الصعب تفسير. وقد بذلت خطوات واعدة في نبات الأرابيدوبسيس وذبابة الفاكهة إلى المناظر الطبيعية لونين الأنسجة تحديدا لمحة عن طريق استخراج نوع محدد خلية نوى 38،39. ويتضمن بروتوكول لدينا خطوة استخراج النووية، التي يمكن أن تمهد الطريق لأنسجة محددة الشذرة تسلسل في الأجنة الأخرى.

The first attempts to characterize protein-DNA interactions in vivo were reported about 30 years ago in an effort to understand RNA polymerase-mediated gene transcription in bacteria and in the fruit fly1,2. Since then, the use of immunoprecipitation to enrich distinct chromatin features (ChIP) has been widely adopted to capture binding events and chromatin states with high efficiency3. Subsequently, with the emergence of powerful microarray technologies, this method led to the characterization of genome-wide chromatin landscapes4. More recently, chromatin profiling has become even more comprehensive and high-resolution, because millions of co-immunoprecipitated DNA templates can now be sequenced in parallel and mapped to the genome (ChIP-Seq)5. As increasing numbers of genome assemblies are available, ChIP-Seq is an attractive approach to learn more about the genome regulation that underlies biological processes. 
Here we provide a protocol to perform ChIP-Seq on yolk-rich embryos such as those of the frog Xenopus. Drafts of the genomes of both widely used Xenopus species&#8212;X. tropicalis and X. laevis&#8212;have now been released by the International Xenopus Genome Consortium6. The embryos of Xenopus species share many desirable features that facilitate and allow the interpretation of genome-wide chromatin studies, including the production of large numbers of high-quality embryos, the large size of the embryos themselves, and their external development. In addition, the embryos are amenable to classic and novel manipulations like cell lineage tracing, whole-mount in situ hybridisation, RNA overexpression, and TALEN/CRISPR-mediated knockout technology.
The following protocol builds on the work of Lee et al., Blythe et al. and Gentsch et al.7-9. Briefly, Xenopus embryos are formaldehyde-fixed at the developmental stage of interest to covalently bind (cross-link) proteins to their associated genomic DNA. After nuclear extraction, cross-linked chromatin is fragmented to focus subsequent sequencing on specific genomic binding or modification sites, and to minimize the contributions of flanking DNA sequences. Subsequently, the chromatin fragments are immunoprecipitated with a ChIP-grade antibody to enrich those containing the protein of interest. The co-immunoprecipitated DNA is stripped from the protein and purified before creating an indexed (paired-end) library for next-generation sequencing (NGS). At the end, simple command lines are offered for the post-sequencing analysis of ChIP-Seq data.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>1/16 inch tapered microtip</td>
			<td>Qsonica</td>
			<td>4417</td>
			<td>This microtip is compatible with Sonicator 3000 from Misonix and Q500/700 from Qsonica.</td>
		</tr>
		<tr>
			<td>8 ml glass sample vial with cap</td>
			<td>Wheaton</td>
			<td>224884</td>
			<td>8 ml clear glass sample vials for aqueous samples with 15-425 size phenolic rubber-lined screw caps.</td>
		</tr>
		<tr>
			<td>Adaptor</td>
			<td>IDT or Sigma</td>
			<td>NA</td>
			<td>TruSeq universal adaptor, 
AATGATACGGCGACCACCGAG 
ATCTACACTCTTTCCCTACAC 
GACGCTCTTCCGATC*T. TruSeq indexed adaptor, 
P-GATCGGAAGAGCACACGTC 
TGAACTCCAGTCAC &#8208;NNNNNN&#8208; 
ATCTCGTATGCCGTCT TCTGCTT*G. *, phosphorothioate bondphosphate group at 5&#39; end. NNNNNN, index (see TruSeq ChIP Sample Preparation Guide for DNA sequence). Order adaptors HPLC purified. Adaptors can be prepared by combining equimolar amounts (each 100 &#181;M) of the universal and the indexed adaptor and cooling them down slowly from 95 &#176;C to room temperature. Use 1.5 pmol per ng of input DNA. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>b2g4pipe (software)</td>
			<td>Blast2GO</td>
			<td>non-commercial</td>
			<td>http://www.blast2go.com/data/blast2go/b2g4pipe_v2.5.zip</td>
		</tr>
		<tr>
			<td>BLAST+ (software)</td>
			<td>Camacho et al.</td>
			<td>non-commercial</td>
			<td>http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastDocs&#38;DOC_TYPE=Download</td>
		</tr>
		<tr>
			<td>Bowtie (software)</td>
			<td>Langmead et al.</td>
			<td>non-commercial</td>
			<td>http://bowtie-bio.sourceforge.net/index.shtml</td>
		</tr>
		<tr>
			<td>cisFinder (software)</td>
			<td>Sharov et al.</td>
			<td>non-commercial</td>
			<td>http://lgsun.grc.nia.nih.gov/CisFinder/</td>
		</tr>
		<tr>
			<td>Chip for capillary electrophoresis</td>
			<td>Agilent Technologies</td>
			<td>5067-1504</td>
			<td>Load this chip with 1 &#181;l DNA for library quality control. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Chip-based capillary electrophoresis system</td>
			<td>Agilent Technologies</td>
			<td>G2940CA</td>
			<td>The Agilent 2100 BioAnalyzer is used to check the quality of ChIP-Seq libraries. Keep reagents at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>ChIP-Seq library preparation kit (KAPA Hyper Prep Kit)</td>
			<td>Kapa Biosystems</td>
			<td>KK8504</td>
			<td>Kit contains KAPA end repair and A-tailing enzyme mix, end Repair and A-tailing buffer, DNA ligase, ligation buffer, KAPA HiFi HotStart ReadyMix (2X), and KAPA library amplification primer mix (10X) (see also PCR primers). Adaptors are not included. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>ChIP-Seq library preparation kit (alternative, ThruPLEX-FD Prep Kit)</td>
			<td>Rubicon Genomics</td>
			<td>R40048</td>
			<td>Kit uses their own stem-loop adaptors and primers. This kit eliminates intermediate purification steps and is as sensitive as the KAPA Hyper Prep Kit. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Cluster3 (software)</td>
			<td>de Hoon et al.</td>
			<td>non-commercial</td>
			<td>http://bonsai.hgc.jp/~mdehoon/software/cluster</td>
		</tr>
		<tr>
			<td>FastQC (software)</td>
			<td>Simon Andrews</td>
			<td>non-commercial</td>
			<td>http://www.bioinformatics.babraham.ac.uk/projects/fastqc</td>
		</tr>
		<tr>
			<td>Fluorometer</td>
			<td>life technologies</td>
			<td>Q32866</td>
			<td>Qubit 2.0 Fluorometer</td>
		</tr>
		<tr>
			<td>Fluorometer reagents</td>
			<td>life technologies</td>
			<td>Q32851</td>
			<td>The kit provides concentrated assay reagent, dilution buffer, and pre-diluted DNA standards for the Qubit fluorometer. Store DNA standards at 4 &#176;C, buffer and dye at room temperature.</td>
		</tr>
		<tr>
			<td>Formaldehyde</td>
			<td>Sigma</td>
			<td>F8775-4X25ML</td>
			<td>Formaldehyde solution, for molecular biology, 36.5-38% in H2O, stabilised with 10-15% methanol. Store at room temperature. CAUTION: Formaldehyde is corrosive and highly toxic.</td>
		</tr>
		<tr>
			<td>Gel (E-Gel EX agarose , 2%)</td>
			<td>life technologies</td>
			<td>G4010</td>
			<td>Pre-cast gel with 11 wells, openable format. Leave one lane between ladder and library empty to avoid cross-contamination. Store gels at room temperature.</td>
		</tr>
		<tr>
			<td>Gel electrophoresis system</td>
			<td>life technologies</td>
			<td>G6465</td>
			<td>E-Gel iBase and E-Gel Safe Imager combo kit for size-selecting ChIP-Seq libraries.</td>
		</tr>
		<tr>
			<td>Gel extraction kit</td>
			<td>Qiagen</td>
			<td>28706</td>
			<td>Store all reagents at room temperature. Use 500 &#181;l of QG buffer per 100 mg of 2% agarose gel slice to extract DNA. Use MinElute columns (from MinElute PCR purification kit) to elute DNA twice.</td>
		</tr>
		<tr>
			<td>HOMER (software)</td>
			<td>Chris Benner</td>
			<td>non-commercial</td>
			<td>http://homer.salk.edu/homer/index.html</td>
		</tr>
		<tr>
			<td>Hybridization oven</td>
			<td>Techne</td>
			<td>FHB1D</td>
			<td>Hybridizer HB-1D</td>
		</tr>
		<tr>
			<td>IGV (software)</td>
			<td>Robinson et al.</td>
			<td>non-commercial</td>
			<td>http://www.broadinstitute.org/igv/home</td>
		</tr>
		<tr>
			<td>Illumina CASAVA-1.8 quality filter (software)</td>
			<td>Assaf Gordon</td>
			<td>non-commercial</td>
			<td>http://cancan.cshl.edu/labmembers/gordon/fastq_illumina_filter</td>
		</tr>
		<tr>
			<td>Java TreeView (software)</td>
			<td>Alok Saldanha</td>
			<td>non-commercial</td>
			<td>http://jtreeview.sourceforge.net</td>
		</tr>
		<tr>
			<td>Laboratory jack</td>
			<td>Edu-Lab</td>
			<td>CH0642</td>
			<td>This jack is used to elevate sample in sound enclosure for sonication.</td>
		</tr>
		<tr>
			<td>Ladder, 100 bp</td>
			<td>New England BioLabs</td>
			<td>N3231</td>
			<td>Keep 1x solution at room temperature. Store stock at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Ladder, 1 kb</td>
			<td>New England BioLabs</td>
			<td>N3232</td>
			<td>Keep 1x solution at room temperature. Store stock at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Low-retention 1.5-ml microcentrifuge tubes</td>
			<td>life technologies</td>
			<td>AM12450</td>
			<td>nonstick, RNase-free microfuge tubes, 1.5 ml</td>
		</tr>
		<tr>
			<td>MACS2 (software)</td>
			<td>Tao Liu</td>
			<td>non-commercial</td>
			<td>https://github.com/taoliu/MACS</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>11201D</td>
			<td>These Dynabeads are superparamagnetic beads with affinity purified polyclonal sheep anti-mouse IgG covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>11203D</td>
			<td>These Dynabeads are superparamagnetic beads with affinity purified polyclonal sheep anti-rabbit IgG covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>10001D</td>
			<td>These Dynabeads are superparamagnetic beads with recombinant protein A covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>10003D</td>
			<td>These Dynabeads are superparamagnetic beads with recombinant protein G covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic rack</td>
			<td>life technologies</td>
			<td>12321D</td>
			<td>DynaMag-2 magnet</td>
		</tr>
		<tr>
			<td>MEME</td>
			<td>Bailey et al.</td>
			<td>non-commercial</td>
			<td>http://meme.nbcr.net/meme/</td>
		</tr>
		<tr>
			<td>Na3VO4</td>
			<td>New England BioLabs</td>
			<td>P0758</td>
			<td>Sodium orthovanadate (100 mM) is a commonly used general inhibitor for protein phosphotyrosyl phosphatases. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>NaF</td>
			<td>New England BioLabs</td>
			<td>P0759</td>
			<td>Sodium fluoride (500 mM) is commonly used as general inhibitor of phosphoseryl and phosphothreonyl phosphatases. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>NGS machine</td>
			<td>Illumina</td>
			<td>SY-301-1301</td>
			<td>Genome Analyzer IIx</td>
		</tr>
		<tr>
			<td>NGS machine (high performance)</td>
			<td>Illumina</td>
			<td>SY-401-2501</td>
			<td>HiSeq</td>
		</tr>
		<tr>
			<td>Normal serum (antibody control)</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-2028</td>
			<td>Use as control for goat polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Normal serum (antibody control)</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-2025</td>
			<td>Use as control for mouse polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Normal serum (antibody control)</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-2027</td>
			<td>Use as control for rabbit polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Nucleic acid staining solution</td>
			<td>iNtRON</td>
			<td>21141</td>
			<td>Use RedSafe nucleic acid staining solution at 1:50,000. Store at room temperature.</td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Sigma</td>
			<td>O3756-25G</td>
			<td>1-Phenylazo-2-naphthol-6,8-disulfonic acid disodium salt. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>PCR primers</td>
			<td>e.g., IDT or Sigma</td>
			<td>NA</td>
			<td>Primers to enrich adaptor-ligated DNA fragments by PCR: AATGATACGGCGACCACCGA*G and CAAGCAGAAGACGGCATACGA*G, phosphorothioate bond. Primers designed by Ethan Ford. Combine primers at 5 &#181;M each. Use 5 &#181;l in a 50 &#181;l PCR reaction. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>MinElute PCR purification kit&#160;</td>
			<td>Qiagen</td>
			<td>28006</td>
			<td>for purification of ChIP-qPCR and shearing test samples. Store MinElute spin columns at 4 &#176;C, all other buffers and collection tubes at room temperature.</td>
		</tr>
		<tr>
			<td>Phenol:chloroform:isoamyl alcohol (25:24:1, pH 7.9)</td>
			<td>life technologies</td>
			<td>AM9730</td>
			<td>Phenol:Chloroform:IAA (25:24:1) is premixed and supplied at pH 6.6. Use provided Tris alkaline buffer to raise pH to 7.9. Store at 4 &#176;C. CAUTION: phenol:chloroform:isoamyl alcohol is corrosive, highly toxic and combustible.</td>
		</tr>
		<tr>
			<td>Primer3 (software)</td>
			<td>Steve Rozen &#38; Helen Skaletsky</td>
			<td>non-commercial</td>
			<td>http://biotools.umassmed.edu/bioapps/primer3_www.cgi</td>
		</tr>
		<tr>
			<td>Protease inhibitor tablets</td>
			<td>Roche</td>
			<td>11836170001</td>
			<td>cOmplete, Mini, EDTA-free. Use 1 tablet per 10 ml. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Protease inhibitor tablets</td>
			<td>Roche</td>
			<td>11873580001</td>
			<td>cOmplete, EDTA-free. Use 1 tablet per 50 ml. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>life technologies</td>
			<td>AM2548</td>
			<td>proteinase K solution (20 &#181;g/&#181;l). Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>RNase A</td>
			<td>life technologies</td>
			<td>12091-039</td>
			<td>RNase A (20 &#181;g/&#181;l). Store at room temperature.</td>
		</tr>
		<tr>
			<td>Rotator</td>
			<td>Stuart</td>
			<td>SB3</td>
			<td>Rotator SB3</td>
		</tr>
		<tr>
			<td>SAMtools (software)</td>
			<td>Li et al.</td>
			<td>non-commercial</td>
			<td>http://samtools.sourceforge.neta</td>
		</tr>
		<tr>
			<td>Solid phase reversible immobilisation beads</td>
			<td>Beckman Coulter</td>
			<td>A63882</td>
			<td>The Agencourt AMPure XP beads are used to minimise adaptor dimer contamination in ChIP-Seq libraries. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Sonicator 3000</td>
			<td>Misonix/Qsonica</td>
			<td>NA</td>
			<td>Newer models are now available. Q125, Q500 or Q700 are all suitable for shearing crosslinked chromatin.</td>
		</tr>
		<tr>
			<td>Sound enclosure</td>
			<td>Misonix/Qsonica</td>
			<td>NA</td>
			<td>optional: follow the manufacturer&#39;s recommendation to obtain the correct sound enclosure.</td>
		</tr>
		<tr>
			<td>Thermomixer</td>
			<td>eppendorf</td>
			<td>22670000</td>
			<td>Thermomixer for 24 x 1.5 mL tubes. Precise temperature control from 4 &#176;C above room temperature to 99 &#176;C.</td>
		</tr>
	</tbody>
</table>

genome-wide snapshot of chromatin regulators and states in xenopus embryos by chip-seq

The recruitment of chromatin regulators and the assignment of chromatin states to specific genomic loci are pivotal to cell fate decisions and tissue and organ formation during development. Determining the locations and levels of such chromatin features in vivo will provide valuable information about the spatio-temporal regulation of genomic elements, and will support aspirations to mimic embryonic tissue development in vitro. The most commonly used method for genome-wide and high-resolution profiling is chromatin immunoprecipitation followed by next-generation sequencing (ChIP-Seq). This protocol outlines how yolk-rich embryos such as those of the frog Xenopus can be processed for ChIP-Seq experiments, and it offers simple command lines for post-sequencing analysis. Because of the high efficiency with which the protocol extracts nuclei from formaldehyde-fixed tissue, the method allows easy upscaling to obtain enough ChIP material for genome-wide profiling. Our protocol has been used successfully to map various DNA-binding proteins such as transcription factors, signaling mediators, components of the transcription machinery, chromatin modifiers and post-translational histone modifications, and for this to be done at various stages of embryogenesis. Lastly, this protocol should be widely applicable to other model and non-model organisms as more and more genome assemblies become available.

ومن المتوقع إذا تم تنفيذ بروتوكول جيدا النتائج مساوية لتلك المقدمة هنا والأجسام المضادة في استخدام هو من نوعية الشذرة الصف (انظر المناقشة). هذا البروتوكول يسمح استخراج النوى من الثابتة الفورمالديهايد الأجنة القيطم والقص الفعال لونين من قبل صوتنة (الشكل 1A-C). يظهر الكروماتين المنفصمة التوزيع غير متماثل من شظايا الحمض النووي التي تتراوح أساسا من 100 إلى 1،000 سنة مضت، وتبلغ ذروتها ما بين 300 و 500 سنة مضت (الشكل 1C). مطلوب الحد الأدنى من 50 خريج من الحمض النووي immunoprecipitated لجعل بنجاح تقرن نهاية مكتبة رقاقة يليها فهرستها مع تدرج DNA ذات الحجم المماثل (الشكل 2A). وينبغي أن تكون المكتبة خالية إلى حد كبير من dimers محول، والتي يمكن أن ينظر إليه على رحلاني في حوالي 120 سنة مضت. على التسلسل-عن طريق التخليق، ومعالجتها قبل يقرأ تم تعيينها إلى الجينوم (الشكل 2B، C). في تجربة ناجحة مع <eم&gt; X. الأجنة مداري، عادة 50 إلى 70٪ من نهاية واحدة يقرأ من 40 سنة مضت يمكن تعيين فريد إلى الجمعية جينوم V7.1 مع الحد الأقصى اثنين عدم التطابق. في حين المدخلات يقرأ محاذاة بشكل موحد تماما في جميع أنحاء الجينوم، محاذاة رقاقة يقرأ النتائج في التخصيب حبلا الخاصة التي تكتنف ميزة لونين من الفائدة. وذلك لأن التسلسل جميع أجزاء من &#39;نهاية 5 (الشكل 2C) 25. تمتد في محاذاة في قراءة الاتجاه إلى متوسط ​​حجم جزء تنتج ملامح دقيقة لملامح الكروماتين واحدة مثل الأحداث عامل النسخ ملزمة. ويبدو أن هذه إشغال DNA كما تبلغ ذروتها عندما تصور في IGV أو أي متصفح الجينوم متوافق الآخرين. وتستخدم المتصلين الذروة مثل MACS لتحديد موقع هذه القمم (الشكل 3A). وقد تم تحديد هذه الطريقة عشرات الآلاف من مواقع الربط في X. مداري الجينوم لعوامل النسخ T-مربع مثل VegT 26. الشذرة-QPCR جتربةيجب الإدلاء بالبيانات تأكيد تخصيب المحليين وجدت من قبل الشذرة تسلسل (الشكل 3B). تجارب رقاقة يليها تسمح استكشاف خصائص الجينوم على نطاق من الميزات لونين. على سبيل المثال، وحساب توزيع قراءة على عناصر الجينومية مثل النسخ بداية والمواقع إنهاء يمكنها إبراز أية تفضيلات ملزمة المكانية حول الجينات (الشكل 3C). وبالمثل، يتم استخدام heatmap التوزيعات قراءة في مواقع الذروة إلى مقارنة ميزات لونين مختلفة على نطاق الجينوم على نطاق الشكل (3D). عوامل النسخ معينة ربط تسلسل الحمض النووي على وجه التحديد. دي نوفو تحليل عزر من قمم الكامنة الحمض النووي الجيني يمكن استرداد هذا النوع من المعلومات بما في ذلك الزخارف التخصيب المشترك للالعوامل المشتركة المحتملة (الشكل 3E). الغالبية العظمى من الجينات المستهدفة تظهر الإشغال DNA في أقل بدلا من مستوى أعلى (الشكل 3F). ويبدو أن هذه الميزة خالية من نطاق أن يكون شائع جدا بين TRالعوامل anscription وتقترح أنه ليس هناك سوى جزء صغير من الجينات المستهدفة وينظم مباشرة مع أهميتها البيولوجية 27،28. تحليل حيث GO المخصب أو سمات أخرى مثل التعبير التفاضلية من الجينات المستهدفة قد يزيد تكشف نظرة ثاقبة وظيفة بيولوجية من ميزة الكروماتين في الجنين القيطم (الشكل 3G). <img alt="الشكل (1)" src="/files/ftp_upload/52535/52535fig1highres.jpg" /> الشكل 1. الكروماتين الإجراء مناعي للأجنة القيطم. (A) هي الأجنة في هذه المرحلة التنموية التي تهم ربط تساهمي (عبر الارتباط) أي البروتينات المرتبطة الحمض النووي الجيني الثابتة الفورمالديهايد. على استخراج النووي (B)، تم تجزئة لونين عبر ربط لتضييق الحمض النووي الجيني ملزمة أو مواقع تعديل لونين عن طريق التقليل من DN المرافقةتسلسل (C). وفي وقت لاحق، وimmunoprecipitated شظايا لونين مع الأجسام المضادة الشذرة الصف لإثراء تلك التي تحتوي على حاتمة الفائدة (D). يتم تجريد DNA-immunoprecipitated شارك قبالة البروتين وتنقيته (E) قبل إنشاء مكتبة الشذرة جزء لNGS (الشكل 2). <a href="https://www.jove.com/files/ftp_upload/52535/52535fig1large.jpg" target="_blank">الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.</a> <img alt="الشكل 2" src="/files/ftp_upload/52535/52535fig2highres.jpg" /> الشكل 2. رقاقة يليها إعداد مكتبة، والتسلسل عن طريق التوليف ورسم الخرائط والدعوة الذروة. (A) يعرض رحلاني مكتبة رقاقة يليها جيدة مع قوالب DNA من 250-450 نقطة أساس. هذه القوالب يترتب على إدراج DNA من الفائدة يحيط بها عالميا (58 بي بي) وفهرستها (63 بي بي) محول. (B) </قوية&gt; الملايين من مجموعات، كل مجموعة تحتوي على مع قوالب متماثلة، من قاعدة متسلسلة من قاعدة في حضور جميع النيوكليوتيدات الأربعة التي تمتلك عكسها، fluorophore متميزة وخصائص إنهاء متطابقة. تتم معالجة الصور الفلورسنت في الوقت الحقيقي لاستدعاء قواعد المناظرة، التي يتم تجميعها في نهاية المطاف إلى يقرأ. (C) يقرأ تلك الخريطة فريد لالجينوم القيطم يتم الاحتفاظ فقط. كما يتم التسلسل جميع شظايا من نهاية 5 &#39;، ورسم خرائط لالشذرة يقرأ النتائج في قمم حبلا الخاصة التي تكتنف ميزة لونين من الفائدة. وبالتالي، المتصلين ذروة كشف عن تخصيب اليورانيوم التي تنبع من مناعي وتمديد يقرأ إلى متوسط ​​طول القطعة في توطين بدقة ملامح لونين. <a href="https://www.jove.com/files/ftp_upload/52535/52535fig2large.jpg" target="_blank">الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.</a> <img aLT = &quot;الشكل 3&quot; SRC = &quot;/ الملفات / ftp_upload / 52535 / 52535fig3highres.jpg&quot; /&gt; الشكل 3. مثال على تحليل ما بعد تسلسل والتصور البيانات عن طريق عامل اقحي T-مربع النسخ VegT (zVegT). جميع قراءة التهم المعروضة هنا هي تطبيع إلى 10 ملايين تعيين فريد ويقرأ غير زائدة عن الحاجة. (A) مقتطفات ملف التعريف على نطاق الجينوم من zVegT ملزمة في X. الأجنة مداري المعيدة (المرحلة 11-12،5 بعد Nieuwkoop وفابر 29). كل الذروة، كومة المتابعة للبمد يقرأ، تمثل موقع واحد ملزم. وتسمى هذه القمم التي كتبها MACS2 مع معدل اكتشاف كاذبة (FDR) أقل من 1٪. يظهر كل جين mesp القريبة جدا والمنبع zVegT ملزمة، ولكن يتم التعبير عن mespa وmespb فقط من قبل تلك المرحلة (البيانات RNA يليها 30). (ب) مستويات الإشغال DNA من zVegT على النحو الذي يحدده الشذرة-QPCR في عدة مواضع (بما في ذلك غير المنطقة -bound 0.5 كيلوبايت المنبع من β -actin) confiRM إثراء محددة وجدت من قبل الشذرة تسلسل. مقارنة النتائج لmespa مع ذروة يسمى (شريط أحمر) في (A). هو تصور مستوى الإشغال DNA كنسبة مئوية من الدخل على حد سواء، ورقاقة مع الأجسام المضادة VegT (بولكلونل الأرنب من مفتش نمط إسوي) ورقاقة مع سيطرة الأجسام المضادة (مفتش أرنب عادي). أشرطة الخطأ تعكس الانحراف المعياري اثنين من مكررات البيولوجية. ويبين (C) Metagene تحليل zVegT تفضيلية ملزمة (العلامات اهمال أكثر من 25 بي بي) إلى المروج نسبة إلى أي منطقة الجينومية أخرى حول وداخل الهيئات الجينات. (D) يظهر Heatmap ك-المتوسط تتجمع مستويات (ك = 5) الإشغال DNA (العلامات اهمال أكثر من 25 بي بي) من zVegT وSmad2 / Smad3 (بيانات رقاقة يليها 31) نسبة إلى جميع المناطق متجهة الى zVegT في مرحلة المعيدة. وheatmap هو تسجيل 2 شهادة وتركزت في 5 علامات في بي بي. (E) دي نوفو تحليل عزر يكتشف الكنسي T-مربع النسخ عامل عزر ملزم في 38٪ من zVegT-المناطق ملزمة إذا كانت النتيجة عزر الأساسية هي تطبيع إلى معدل اكتشاف 5٪ في تسلسل الخلفية. وتظهر خريطة كثافة أعلى تخصيب لعزر T-مربع في وسط مواقع الربط zVegT، بينما بالكاد المخصب عزر Smad2 / Smad3 ملزمة الكنسي. (F) الرسم البياني يبين مستويات الإشغال DNA من zVegT، التي تحسب لكل الجين المستهدف من كل القمم (+/- 200 نقطة أساس) ما بين 5 كيلو بايت المنبع [-]. و1 كيلوبايت المصب [+] مواقع بداية النسخ المطابق (G) أعلى 300 الجينات مع أعلى مستويات الإشغال DNA داخل -5 كيلو بايت و +1 كيلو بايت هي المخصب لالعمليات البيولوجية من التطور الجنيني المبكر. هذه GO حيث تتماشى مع وظيفة المفترضة من zVegT. ويستند روزفلت في اختبار دقيق ثنائي الطرف فيشر وتصحيح لاختبار متعددة. <a href="https://www.jove.com/files/ftp_upload/52535/52535fig3large.jpg" target="_blank">الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.</a>

Watch this Scientific Journal Video about Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq at JoVE.com

Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

مسألة كيفية المنظمين والدول لونين لونين تؤثر على الجينوم في الجسم الحي هو المفتاح لفهمنا لكيفية اتخاذ القرارات في وقت مبكر مصير الخلايا في الجنين النامية. رقاقة تسلسل-النهج الأكثر شعبية للتحقيق ميزات الكروماتين في-والمستوى العالمي المبينة هنا للأجنة القيطم.

لقطة على نطاق الجينوم من المنظمين لونين والدول في<em&gt; القيطم</em&gt; الأجنة عن طريق رقاقة تسلسل

The recruitment of chromatin regulators and the assignment of chromatin states to specific genomic loci are pivotal to cell fate decisions and tissue and ...

Research

JoVE Journal

Developmental Biology

Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

Manipulation and In Vitro Maturation of Xenopus laevis Oocytes, Followed by Intracytoplasmic Sperm Injection, to Study Embryonic Development

Manipulation and In Vitro Maturation of Xenopus laevis Oocytes, Followed by Intracytoplasmic Sperm Injection, to Study Embryonic Development

التلاعب و<em&gt; في المختبر</em&gt; نضوج<em&gt; القيطم المورق</em&gt; البويضات، تلاه سهم داخل الهيولى حقن الحيوانات المنوية، لدراسة التطور الجنيني

Amphibian eggs have been widely used to study embryonic development. Early embryonic development is driven by maternally stored factors accumulated during ...

Accurate and Phenol Free DNA Sexing of Day 30 Porcine Embryos by PCR

دقيقة والفينول الحرة الحمض النووي مبالغات من يوم 30 خنزيري الأجنة بواسطة PCR

Research into prenatal programming in the pig has shown that the sex of the developing embryo or fetus can influence the developmental outcome. Therefore, ...

Technique to Target Microinjection to the Developing Xenopus Kidney

Technique to Target Microinjection to the Developing Xenopus Kidney

تقنية لاستهداف حقن مكروي إلى البلدان النامية<em&gt; القيطم</em&gt; الكلى

The embryonic kidney of Xenopus&#160;laevis (frog), the pronephros, consists of a single nephron, and can be used as a model for kidney disease. Xenopus ...

Generation of Parabiotic Zebrafish Embryos by Surgical Fusion of Developing Blastulae

جيل من التعايش الالتصاقي الزرد الأجنة التي كتبها فيوجن الجراحي لتطوير الأريمات

Surgical parabiosis of two animals of different genetic backgrounds creates a unique scenario to study cell-intrinsic versus cell-extrinsic roles for ...

Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos

بيوسنسينغ موتور الخلايا العصبية الغشاء المحتملة في الأجنة الزرد الحية

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the ...

Visualization and Quantitative Analysis of Embryonic Angiogenesis in Xenopus tropicalis

Visualization and Quantitative Analysis of Embryonic Angiogenesis in Xenopus tropicalis

التصور والتحليل الكمي من الأوعية الدموية الجنينية في<em&gt; زينوبوس تروبيكاليس</em

Blood vessels supply oxygen and nutrients throughout the body, and the formation of the vascular network is under tight developmental control. The ...

Induction of Hypoxia in Living Frog and Zebrafish Embryos

تحريض نقص الأكسجة في الضفدع الحي والأجنة الزرد

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and ...

CARIP-Seq and ChIP-Seq: Methods to Identify Chromatin-Associated RNAs and Protein-DNA Interactions in Embryonic Stem Cells

Seq كاريب ورقاقة Seq: أساليب لتحديد الكشف المرتبطة الكروماتين وتفاعلات البروتين-الحمض النووي في الخلايا الجذعية الجنينية

Embryonic stem (ES) cell self-renewal&#160;and differentiation is governed by extrinsic signals and intrinsic networks of transcription factors, ...

Visualizing the Node and Notochordal Plate In Gastrulating Mouse Embryos Using Scanning Electron Microscopy and Whole Mount Immunofluorescence

تصور بالعقدة ولوحة نوتوتشوردال في جاسترولاتينج الأجنة الماوس باستخدام الميكروسكوب الإلكتروني المسح وكله جبل الفلورة

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is ...

Microinjection of DNA into Eyebuds in Xenopus laevis Embryos and Imaging of GFP Expressing Optic Axonal Arbors in Intact, Living Xenopus Tadpoles

Microinjection of DNA into Eyebuds in Xenopus laevis Embryos and Imaging of GFP Expressing Optic Axonal Arbors in Intact, Living Xenopus Tadpoles

الحقن المجهري للحمض النووي في براعم العيون في أجنة Xenopus laevis والتصوير من GFP التعبير عن الأشجار Axonal البصرية في سليمة، وحيا Xenopus Tadpoles

The primary visual projection of tadpoles of the aquatic frog Xenopus laevis serves as an excellent model system for studying mechanisms that regulate the ...