Name: genome-wide snapshot of chromatin regulators and states in xenopus embryos by chip-seq
Uploaded: 2015-02-26T13:00:00
Duration: 10 min 23 s
Description: Watch this Scientific Journal Video about Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq at JoVE.com

We thank Chris Benner for implementing the X. tropicalis genome (xenTro2, xenTro2r) into HOMER and the Gilchrist lab for discussions on post-sequencing analysis. I.P. assisted the GO term analysis. G.E.G and J.C.S. were supported by the Wellcome Trust and are now supported by the Medical Research Council (program number U117597140).

<ol>
	<li>Gilmour, D. S., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detecting+protein-DNA+interactions+in+vivo:+distribution+of+RNA+polymerase+on+specific+bacterial+genes.">Detecting protein-DNA interactions in vivo: distribution of RNA polymerase on specific bacterial genes.</a> Proc Natl Acad Sci U S A. 81 (14), 4275-4279 (1984).</li><li>Gilmour, D. S., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+interactions+of+RNA+polymerase+II+with+genes+of+Drosophila+melanogaster.">In vivo interactions of RNA polymerase II with genes of Drosophila melanogaster.</a> Mol Cell Biol. 5 (8), 2009-2018 (1985).</li><li>Solomon, M. J., Larsen, P. L., Varshavsky, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+protein-DNA+interactions+in+vivo+with+formaldehyde:+evidence+that+histone+H4+is+retained+on+a+highly+transcribed+gene.">Mapping protein-DNA interactions in vivo with formaldehyde: evidence that histone H4 is retained on a highly transcribed gene.</a> Cell. 53 (6), 937-947 (1988).</li><li>Ren, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+location+and+function+of+DNA+binding+proteins.">Genome-wide location and function of DNA binding proteins.</a> Science. 290 (5500), 2306-2309 (2000).</li><li>Johnson, D., Mortazavi, A., Myers, R., Wold, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+mapping+of+in+vivo+protein-DNA+interactions.">Genome-wide mapping of in vivo protein-DNA interactions.</a> Science. 316 (5830), 1497-1502 (2007).</li><li>Hellsten, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genome+of+the+Western+clawed+frog+Xenopus+tropicalis.">The genome of the Western clawed frog Xenopus tropicalis.</a> Science. 328 (5978), 633-636 (2010).</li><li>Lee, T. I., Johnstone, S. E., Young, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+and+microarray-based+analysis+of+protein+location.">Chromatin immunoprecipitation and microarray-based analysis of protein location.</a> Nature Protocols. 1 (2), 729-748 (2006).</li><li>Blythe, S. A., Reid, C. D., Kessler, D. S., Klein, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+in+early+Xenopus+laevis+embryos.">Chromatin immunoprecipitation in early Xenopus laevis embryos.</a> Dev Dyn. 238 (6), 1422-1432 (2009).</li><li>Gentsch, G. E., Smith, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+physical+chromatin+associations+across+the+Xenopus+genome+by+chromatin+immunoprecipitation.">Investigating physical chromatin associations across the Xenopus genome by chromatin immunoprecipitation.</a> Cold Spring Harb Protoc. 2014 (5), (2014).</li><li>Ubbels, G. A., Hara, K., Koster, C. H., Kirschner, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+a+functional+role+of+the+cytoskeleton+in+determination+of+the+dorsoventral+axis+in+Xenopus+laevis+eggs.">Evidence for a functional role of the cytoskeleton in determination of the dorsoventral axis in Xenopus laevis eggs.</a> J Embryol Exp Morphol. 77, 15-37 (1983).</li><li>Langmead, B., Trapnell, C., Pop, M., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrafast+and+memory-efficient+alignment+of+short+DNA+sequences+to+the+human+genome.">Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.</a> Genome Biol. 10 (3), R25 (2009).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Heinz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+combinations+of+lineage-determining+transcription+factors+prime+cis-regulatory+elements+required+for+macrophage+and+B+cell+identities.">Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities.</a> Mol Cell. 38 (4), 576-589 (2010).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+analysis+of+ChIP-Seq+(MACS).">Model-based analysis of ChIP-Seq (MACS).</a> Genome Biol. 9 (9), R137 (2008).</li><li>Robinson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomics+viewer.">Integrative genomics viewer.</a> Nat Biotechnol. 29 (1), 24-26 (2011).</li><li>Thorvaldsdottir, H., Robinson, J. T., Mesirov, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+Genomics+Viewer+(IGV):+high-performance+genomics+data+visualization+and+exploration.">Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration.</a> Brief Bioinform. 14 (2), 178-192 (2013).</li><li>Imoto, S., Nolan, J., Bioinformatics Miyano, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> 20 (9), 1453-1454 (2004).</li><li>Camacho, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BLAST+:+architecture+and+applications.">BLAST+: architecture and applications.</a> BMC Bioinformatics. 10, 421 (2009).</li><li>Conesa, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blast2GO:+a+universal+tool+for+annotation,+visualization+and+analysis+in+functional+genomics+research.">Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research.</a> Bioinformatics. 21 (18), 3674-3676 (2005).</li><li>Sive, H., Grainger, R., Harland, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Early development of Xenopus laevis: A laboratory manual. , (2000).</li><li>Chen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+evaluation+of+factors+influencing+ChIP-seq+fidelity.">Systematic evaluation of factors influencing ChIP-seq fidelity.</a> Nat Methods. 9 (6), 609-614 (2012).</li><li>Sharov, A. A., Ko, M. S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exhaustive+search+for+over-represented+DNA+sequence+motifs+with+CisFinder.">Exhaustive search for over-represented DNA sequence motifs with CisFinder.</a> DNA Res. 16 (5), 261-273 (2009).</li><li>Bailey, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MEME+SUITE:+tools+for+motif+discovery+and+searching.">MEME SUITE: tools for motif discovery and searching.</a> Nucl Acids Res. 37 (2), W202-W208 (2009).</li><li>Livak, K. J., Schmittgen, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+relative+gene+expression+data+using+real-time+quantitative+PCR+and+the+2(-Delta+Delta+C(T))+Method.">Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.</a> Methods. 25 (4), 402-408 (2001).</li><li>Park, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq:+advantages+and+challenges+of+a+maturing+technology.">ChIP-seq: advantages and challenges of a maturing technology.</a> Nat Rev Genet. 10 (10), 669-680 (2009).</li><li>Gentsch, G. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+T-box+transcription+factor+profiling+reveals+joint+regulation+of+embryonic+neuromesodermal+bipotency.">In vivo T-box transcription factor profiling reveals joint regulation of embryonic neuromesodermal bipotency.</a> Cell Rep. 4 (6), 1185-1196 (2013).</li><li>Barabasi, A. L., Oltvai, Z. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Network+biology:+understanding+the+cell's+functional+organization.">Network biology: understanding the cell's functional organization.</a> Nat Rev Genet. 5 (2), 101-113 (2004).</li><li>Biggin, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+transcription+networks+as+highly+connected,+quantitative+continua.">Animal transcription networks as highly connected, quantitative continua.</a> Dev Cell. 21 (4), 611-626 (2011).</li><li>Nieuwkoop, P. D., Faber, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Normal table of Xenopus laevis (Daudin): a systematical and chronological survey of the development from the fertilized egg till the end of metamorphosis. , (1994).</li><li>Akkers, R. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+hierarchy+of+H3K4me3+and+H3K27me3+acquisition+in+spatial+gene+regulation+in+Xenopus+embryos.">A hierarchy of H3K4me3 and H3K27me3 acquisition in spatial gene regulation in Xenopus embryos.</a> Dev Cell. 17 (3), 425-434 (2009).</li><li>Yoon, S. J., Wills, A. E., Chuong, E., Gupta, R., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> HEB and E2A function as SMAD/FOXH1 cofactors. Genes Dev. 25 (15), 1654-1661 (2011).</li><li>Jallow, Z., Jacobi, U. G., Weeks, D. L., Dawid, I. B., Veenstra, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specialized+and+redundant+roles+of+TBP+and+a+vertebrate-specific+TBP+paralog+in+embryonic+gene+regulation+in+Xenopus.">Specialized and redundant roles of TBP and a vertebrate-specific TBP paralog in embryonic gene regulation in Xenopus.</a> Proc Natl Acad Sci U S A. 101 (37), 13525 (2004).</li><li>Buchholz, D. R., Paul, B. D., Shi, Y. -. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene-specific+changes+in+promoter+occupancy+by+thyroid+hormone+receptor+during+frog+metamorphosis.+Implications+for+developmental+gene+regulation.">Gene-specific changes in promoter occupancy by thyroid hormone receptor during frog metamorphosis. Implications for developmental gene regulation.</a> J Biol Chem. 280 (50), 41222-41228 (2005).</li><li>Wills, A. E., Guptaa, R., Chuonga, E., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+and+deep+sequencing+in+Xenopus+tropicalis+and+Xenopus+laevis.">Chromatin immunoprecipitation and deep sequencing in Xenopus tropicalis and Xenopus laevis.</a> Methods. 66 (3), 410-421 (2014).</li><li>Metz, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+formaldehyde-induced+modifications+in+proteins:+reactions+with+model+peptides.">Identification of formaldehyde-induced modifications in proteins: reactions with model peptides.</a> J Biol Chem. 279 (8), 6235-6243 (2004).</li><li>Landt, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+guidelines+and+practices+of+the+ENCODE+and+modENCODE+consortia.">ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.</a> Genome Res. 22 (9), 1813-1831 (2012).</li><li>Mazzoni, E. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell-based+mapping+of+developmental+transcriptional+programs.">Embryonic stem cell-based mapping of developmental transcriptional programs.</a> Nat Methods. 8 (12), 1056-1058 (2011).</li><li>Deal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+method+for+gene+expression+and+chromatin+profiling+of+individual+cell+types+within+a+tissue.">A simple method for gene expression and chromatin profiling of individual cell types within a tissue.</a> Dev Cell. 18 (6), 1030-1040 (2010).</li><li>Bonn, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue-specific+analysis+of+chromatin+state+identifies+temporal+signatures+of+enhancer+activity+during+embryonic+development.">Tissue-specific analysis of chromatin state identifies temporal signatures of enhancer activity during embryonic development.</a> Nat Genet. 44 (2), 148-156 (2012).</li></ol>

The authors declare that they have no competing financial interests.

Unser Protokoll beschreibt, wie zu machen und zu analysieren, genomweite Chromatin Profile Xenopus-Embryonen. Es umfasst alle Schritte von vernetzenden Proteinen an endogenen Loci in vivo auf die Verarbeitung Millionen liest, die angereicherten genomische Websites in silico. Da immer mehr Genom Entwürfe zur Verfügung stehen, sollte dieses Protokoll auf andere Modell und nicht-Modellorganismen sein. Die wichtigsten experimentellen Teil, der dieses Protokoll von bisherigen Arbeit 8,31,33,34 stellt, ist die nach der Fixierung vor, um vernetzte Kerne zu extrahieren. Es ermöglicht die effiziente Chromatin Solubilisierung und Scher und einfach Upscaling. Zusammen mit verbesserten Wirkungsgraden von Bibliothek Vorbereitung dieses Protokoll erlaubt den Aufbau hochkomplexe ChIP-Seq-Bibliotheken von eineinhalb bis zwei Millionen Zellen der Chromatin-assoziierte Epitop von Interesse exprimieren. Für ChIP-qPCR-Experimente, einige zehntausend dieser Zellen sind in der Regel genug,für DNA Bereicherung auf vielleicht sechs verschiedenen genomischen Loci zu überprüfen. Diese Zahlen sind vorsichtige Schätzungen, kann aber je nach Expressionsniveau Protein, Antikörper Qualität abhängig, Vernetzungseffizienz und Epitop Zugänglichkeit. Als Richtwert ca. 4000 Zellen in der Mitte Blastulastadium (8,5 nach Nieuwkoop und Faber 29) enthält eine einzige Xenopus Embryo, 40.000 Zellen in der späten Gastrula-Stadium (12) und 100.000 Zellen in einem frühen Schwanzknospe Bühne (20). Die exakte Fixierung Zeit für eine effiziente Immunfällung muss empirisch durch ChIP-qPCR (§ 10) ermittelt werden. Im allgemeinen werden mehr Fixierungszeiten benötigt, wenn das Experiment beinhaltet X. laevis Embryonen frühen Entwicklungsstadien, und schwach (oder indirekte) DNA-Bindungseigenschaften. Es wird jedoch nicht empfohlen Befestigungs Xenopus Embryonen länger als 40 Minuten, oder Verarbeitung mehr Embryonen als angegeben (Abschnitt 3), Chromatin Scher wird weniger effizient. Es ist wichtig,jede Glycin nach der Fixierung als dieser gemeinsamen Schritt zum Abschrecken Formaldehyd Kernentnahme aus dotterreichen Embryonen sehr schwierig machen zu verwenden. Derzeit ist der Grund hierfür nicht bekannt. Es ist denkbar, dass die Formaldehyd-Glycin-Addukt ferner mit N-terminalen Amino-Gruppen oder Argininresten 35 reagiert. Der Antikörper ist der Schlüssel für ein Chip-Experiment und ausreichende Kontrollen müssen durchgeführt, um ihre Spezifität für das Epitop von Interesse zeigen werden (siehe Richtlinien Landt et al. 36). Wenn kein ChIP Grade Antikörper verfügbar ist, kann die Einführung von entsprechenden Epitop markierte Fusionsproteine ​​eine legitime Alternative sein, da diese Proteine ​​Bindungsstellen besetzen 37 endogen. In diesem Fall sind nicht injizierten Embryonen am besten, als negative Kontrolle eher als ein Chip mit unspezifischen Serum zu verwenden. Diese Strategie kann auch angewendet werden, wenn das Protein von Interesse auf einem niedrigen Niveau, was zu der schlechten Rückgewinnung des enri ausdrückenched DNA. Als zur Herstellung ChIP-Seq Bibliotheken, wegen der geringen Menge an DNA, im Gebrauch, ist es empfehlenswert, für Verfahren, die die Anzahl der Reinigungsschritte zu verringern und um eine Reaktion zu kombinieren, um den Verlust von DNA auf ein Minimum zu entscheiden. Die Adapter und Grundierungen müssen mit Multiplex-Sequenzierung und der NGS-Plattform kompatibel sind (siehe Tabelle der spezifischen Materialien / Geräte). Bei der Verwendung von Y-Adaptern (mit langen Einzelstrang-Arme), ist es wichtig vor, verstärken die Bibliothek drei bis fünf PCR-Runden vor size-Auswahl DNA-Insertionen (z. B. 100 bis 300 bp) durch Gelelektrophorese. Einzelsträngigen Enden verursachen DNA Fragmente heterogen migrieren. Testläufe mit verschiedenen Mengen an Ausgangs-DNA (zB 0,1, 0,5, 1, 2, 5, 10 und 20 ng) werden empfohlen, um die Gesamtzahl der PCR-Zyklen zu bestimmen (weniger als oder gleich 18 Zyklen) erforderlich, um eine Größe zu machen -Ausgewählte Bibliothek von 100 bis 200 ng. Verringerung der Anzahl der PCR-Zyklen macht die Sequenzierung redundant liest weniger wahrscheinlich. Die Festphasen-reversible Immobilisierung Perlen sind gute Reinigung Reagenzien zur effizienten Wiederherstellung der DNA von Interesse und zuverlässig entfernen Sie alle freien Adaptern und Dimere von Ligation und PCR-Reaktionen. In Bezug auf die Anzahl, Art und Länge der liest, um 20 bis 30 Millionen Single-End liest von 36 bp ist genug für die meisten ChIP-Seq-Experimente, die ganze Xenopus Genom mit ausreichender Tiefe zu decken. Die häufigsten NGS Maschinen sind routinemäßig in der Lage, die diese Kriterien erfüllen. Es kann jedoch von Vorteil sein, um die Anzahl zu erhöhen der liest, wenn eine breite Verteilung der liest wird erwartet, da mit Histon-Modifikationen zu beobachten, anstatt scharfe Spitzen. Für viele ChIP-Seq Experimenten 4 bis 5 unterschiedlich indizierten Bibliotheken gepoolt und in einer Durchflusszelle Fahrspur unter Verwendung einer Hochleistungsmaschine NGS sequenziert werden. Manchmal ist auch ratsam, die Lese Länge und Sequenz an beiden Enden der DNA-Vorlage (Paired-End), um Abbildbarkeit w erhöhen verlängernHenne Analyse Chromatin innerhalb repetitiven genomischen Regionen. Dieses Protokoll wurde erfolgreich in einer Vielzahl von Chromatin Funktionen wie Transkriptionsfaktoren, Signalmediatoren und posttranslationale Histonmodifizierungen aufgebracht. Allerdings Embryonen gewinnen einen zunehmenden Grad an zellulärer Heterogenität, wie sie sich entwickeln und Chromatin-Profile schwerer zu interpretieren. Erste Schritte auf in Arabidopsis und Drosophila gewebsspezifisch Profil Chromatin Landschaften durch Extrahieren zelltypspezifische Kerne 38,39 erzielt. Unser Protokoll umfasst eine Kernextraktionsschritt, der den Weg für die gewebespezifische ChIP-Seq anderer Embryonen bahnen könnte.

The first attempts to characterize protein-DNA interactions in vivo were reported about 30 years ago in an effort to understand RNA polymerase-mediated gene transcription in bacteria and in the fruit fly1,2. Since then, the use of immunoprecipitation to enrich distinct chromatin features (ChIP) has been widely adopted to capture binding events and chromatin states with high efficiency3. Subsequently, with the emergence of powerful microarray technologies, this method led to the characterization of genome-wide chromatin landscapes4. More recently, chromatin profiling has become even more comprehensive and high-resolution, because millions of co-immunoprecipitated DNA templates can now be sequenced in parallel and mapped to the genome (ChIP-Seq)5. As increasing numbers of genome assemblies are available, ChIP-Seq is an attractive approach to learn more about the genome regulation that underlies biological processes. 
Here we provide a protocol to perform ChIP-Seq on yolk-rich embryos such as those of the frog Xenopus. Drafts of the genomes of both widely used Xenopus species&#8212;X. tropicalis and X. laevis&#8212;have now been released by the International Xenopus Genome Consortium6. The embryos of Xenopus species share many desirable features that facilitate and allow the interpretation of genome-wide chromatin studies, including the production of large numbers of high-quality embryos, the large size of the embryos themselves, and their external development. In addition, the embryos are amenable to classic and novel manipulations like cell lineage tracing, whole-mount in situ hybridisation, RNA overexpression, and TALEN/CRISPR-mediated knockout technology.
The following protocol builds on the work of Lee et al., Blythe et al. and Gentsch et al.7-9. Briefly, Xenopus embryos are formaldehyde-fixed at the developmental stage of interest to covalently bind (cross-link) proteins to their associated genomic DNA. After nuclear extraction, cross-linked chromatin is fragmented to focus subsequent sequencing on specific genomic binding or modification sites, and to minimize the contributions of flanking DNA sequences. Subsequently, the chromatin fragments are immunoprecipitated with a ChIP-grade antibody to enrich those containing the protein of interest. The co-immunoprecipitated DNA is stripped from the protein and purified before creating an indexed (paired-end) library for next-generation sequencing (NGS). At the end, simple command lines are offered for the post-sequencing analysis of ChIP-Seq data.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>1/16 inch tapered microtip</td>
			<td>Qsonica</td>
			<td>4417</td>
			<td>This microtip is compatible with Sonicator 3000 from Misonix and Q500/700 from Qsonica.</td>
		</tr>
		<tr>
			<td>8 ml glass sample vial with cap</td>
			<td>Wheaton</td>
			<td>224884</td>
			<td>8 ml clear glass sample vials for aqueous samples with 15-425 size phenolic rubber-lined screw caps.</td>
		</tr>
		<tr>
			<td>Adaptor</td>
			<td>IDT or Sigma</td>
			<td>NA</td>
			<td>TruSeq universal adaptor, 
AATGATACGGCGACCACCGAG 
ATCTACACTCTTTCCCTACAC 
GACGCTCTTCCGATC*T. TruSeq indexed adaptor, 
P-GATCGGAAGAGCACACGTC 
TGAACTCCAGTCAC &#8208;NNNNNN&#8208; 
ATCTCGTATGCCGTCT TCTGCTT*G. *, phosphorothioate bondphosphate group at 5&#39; end. NNNNNN, index (see TruSeq ChIP Sample Preparation Guide for DNA sequence). Order adaptors HPLC purified. Adaptors can be prepared by combining equimolar amounts (each 100 &#181;M) of the universal and the indexed adaptor and cooling them down slowly from 95 &#176;C to room temperature. Use 1.5 pmol per ng of input DNA. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>b2g4pipe (software)</td>
			<td>Blast2GO</td>
			<td>non-commercial</td>
			<td>http://www.blast2go.com/data/blast2go/b2g4pipe_v2.5.zip</td>
		</tr>
		<tr>
			<td>BLAST+ (software)</td>
			<td>Camacho et al.</td>
			<td>non-commercial</td>
			<td>http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastDocs&#38;DOC_TYPE=Download</td>
		</tr>
		<tr>
			<td>Bowtie (software)</td>
			<td>Langmead et al.</td>
			<td>non-commercial</td>
			<td>http://bowtie-bio.sourceforge.net/index.shtml</td>
		</tr>
		<tr>
			<td>cisFinder (software)</td>
			<td>Sharov et al.</td>
			<td>non-commercial</td>
			<td>http://lgsun.grc.nia.nih.gov/CisFinder/</td>
		</tr>
		<tr>
			<td>Chip for capillary electrophoresis</td>
			<td>Agilent Technologies</td>
			<td>5067-1504</td>
			<td>Load this chip with 1 &#181;l DNA for library quality control. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Chip-based capillary electrophoresis system</td>
			<td>Agilent Technologies</td>
			<td>G2940CA</td>
			<td>The Agilent 2100 BioAnalyzer is used to check the quality of ChIP-Seq libraries. Keep reagents at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>ChIP-Seq library preparation kit (KAPA Hyper Prep Kit)</td>
			<td>Kapa Biosystems</td>
			<td>KK8504</td>
			<td>Kit contains KAPA end repair and A-tailing enzyme mix, end Repair and A-tailing buffer, DNA ligase, ligation buffer, KAPA HiFi HotStart ReadyMix (2X), and KAPA library amplification primer mix (10X) (see also PCR primers). Adaptors are not included. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>ChIP-Seq library preparation kit (alternative, ThruPLEX-FD Prep Kit)</td>
			<td>Rubicon Genomics</td>
			<td>R40048</td>
			<td>Kit uses their own stem-loop adaptors and primers. This kit eliminates intermediate purification steps and is as sensitive as the KAPA Hyper Prep Kit. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Cluster3 (software)</td>
			<td>de Hoon et al.</td>
			<td>non-commercial</td>
			<td>http://bonsai.hgc.jp/~mdehoon/software/cluster</td>
		</tr>
		<tr>
			<td>FastQC (software)</td>
			<td>Simon Andrews</td>
			<td>non-commercial</td>
			<td>http://www.bioinformatics.babraham.ac.uk/projects/fastqc</td>
		</tr>
		<tr>
			<td>Fluorometer</td>
			<td>life technologies</td>
			<td>Q32866</td>
			<td>Qubit 2.0 Fluorometer</td>
		</tr>
		<tr>
			<td>Fluorometer reagents</td>
			<td>life technologies</td>
			<td>Q32851</td>
			<td>The kit provides concentrated assay reagent, dilution buffer, and pre-diluted DNA standards for the Qubit fluorometer. Store DNA standards at 4 &#176;C, buffer and dye at room temperature.</td>
		</tr>
		<tr>
			<td>Formaldehyde</td>
			<td>Sigma</td>
			<td>F8775-4X25ML</td>
			<td>Formaldehyde solution, for molecular biology, 36.5-38% in H2O, stabilised with 10-15% methanol. Store at room temperature. CAUTION: Formaldehyde is corrosive and highly toxic.</td>
		</tr>
		<tr>
			<td>Gel (E-Gel EX agarose , 2%)</td>
			<td>life technologies</td>
			<td>G4010</td>
			<td>Pre-cast gel with 11 wells, openable format. Leave one lane between ladder and library empty to avoid cross-contamination. Store gels at room temperature.</td>
		</tr>
		<tr>
			<td>Gel electrophoresis system</td>
			<td>life technologies</td>
			<td>G6465</td>
			<td>E-Gel iBase and E-Gel Safe Imager combo kit for size-selecting ChIP-Seq libraries.</td>
		</tr>
		<tr>
			<td>Gel extraction kit</td>
			<td>Qiagen</td>
			<td>28706</td>
			<td>Store all reagents at room temperature. Use 500 &#181;l of QG buffer per 100 mg of 2% agarose gel slice to extract DNA. Use MinElute columns (from MinElute PCR purification kit) to elute DNA twice.</td>
		</tr>
		<tr>
			<td>HOMER (software)</td>
			<td>Chris Benner</td>
			<td>non-commercial</td>
			<td>http://homer.salk.edu/homer/index.html</td>
		</tr>
		<tr>
			<td>Hybridization oven</td>
			<td>Techne</td>
			<td>FHB1D</td>
			<td>Hybridizer HB-1D</td>
		</tr>
		<tr>
			<td>IGV (software)</td>
			<td>Robinson et al.</td>
			<td>non-commercial</td>
			<td>http://www.broadinstitute.org/igv/home</td>
		</tr>
		<tr>
			<td>Illumina CASAVA-1.8 quality filter (software)</td>
			<td>Assaf Gordon</td>
			<td>non-commercial</td>
			<td>http://cancan.cshl.edu/labmembers/gordon/fastq_illumina_filter</td>
		</tr>
		<tr>
			<td>Java TreeView (software)</td>
			<td>Alok Saldanha</td>
			<td>non-commercial</td>
			<td>http://jtreeview.sourceforge.net</td>
		</tr>
		<tr>
			<td>Laboratory jack</td>
			<td>Edu-Lab</td>
			<td>CH0642</td>
			<td>This jack is used to elevate sample in sound enclosure for sonication.</td>
		</tr>
		<tr>
			<td>Ladder, 100 bp</td>
			<td>New England BioLabs</td>
			<td>N3231</td>
			<td>Keep 1x solution at room temperature. Store stock at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Ladder, 1 kb</td>
			<td>New England BioLabs</td>
			<td>N3232</td>
			<td>Keep 1x solution at room temperature. Store stock at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Low-retention 1.5-ml microcentrifuge tubes</td>
			<td>life technologies</td>
			<td>AM12450</td>
			<td>nonstick, RNase-free microfuge tubes, 1.5 ml</td>
		</tr>
		<tr>
			<td>MACS2 (software)</td>
			<td>Tao Liu</td>
			<td>non-commercial</td>
			<td>https://github.com/taoliu/MACS</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>11201D</td>
			<td>These Dynabeads are superparamagnetic beads with affinity purified polyclonal sheep anti-mouse IgG covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>11203D</td>
			<td>These Dynabeads are superparamagnetic beads with affinity purified polyclonal sheep anti-rabbit IgG covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>10001D</td>
			<td>These Dynabeads are superparamagnetic beads with recombinant protein A covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>10003D</td>
			<td>These Dynabeads are superparamagnetic beads with recombinant protein G covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic rack</td>
			<td>life technologies</td>
			<td>12321D</td>
			<td>DynaMag-2 magnet</td>
		</tr>
		<tr>
			<td>MEME</td>
			<td>Bailey et al.</td>
			<td>non-commercial</td>
			<td>http://meme.nbcr.net/meme/</td>
		</tr>
		<tr>
			<td>Na3VO4</td>
			<td>New England BioLabs</td>
			<td>P0758</td>
			<td>Sodium orthovanadate (100 mM) is a commonly used general inhibitor for protein phosphotyrosyl phosphatases. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>NaF</td>
			<td>New England BioLabs</td>
			<td>P0759</td>
			<td>Sodium fluoride (500 mM) is commonly used as general inhibitor of phosphoseryl and phosphothreonyl phosphatases. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>NGS machine</td>
			<td>Illumina</td>
			<td>SY-301-1301</td>
			<td>Genome Analyzer IIx</td>
		</tr>
		<tr>
			<td>NGS machine (high performance)</td>
			<td>Illumina</td>
			<td>SY-401-2501</td>
			<td>HiSeq</td>
		</tr>
		<tr>
			<td>Normal serum (antibody control)</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-2028</td>
			<td>Use as control for goat polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Normal serum (antibody control)</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-2025</td>
			<td>Use as control for mouse polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Normal serum (antibody control)</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-2027</td>
			<td>Use as control for rabbit polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Nucleic acid staining solution</td>
			<td>iNtRON</td>
			<td>21141</td>
			<td>Use RedSafe nucleic acid staining solution at 1:50,000. Store at room temperature.</td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Sigma</td>
			<td>O3756-25G</td>
			<td>1-Phenylazo-2-naphthol-6,8-disulfonic acid disodium salt. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>PCR primers</td>
			<td>e.g., IDT or Sigma</td>
			<td>NA</td>
			<td>Primers to enrich adaptor-ligated DNA fragments by PCR: AATGATACGGCGACCACCGA*G and CAAGCAGAAGACGGCATACGA*G, phosphorothioate bond. Primers designed by Ethan Ford. Combine primers at 5 &#181;M each. Use 5 &#181;l in a 50 &#181;l PCR reaction. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>MinElute PCR purification kit&#160;</td>
			<td>Qiagen</td>
			<td>28006</td>
			<td>for purification of ChIP-qPCR and shearing test samples. Store MinElute spin columns at 4 &#176;C, all other buffers and collection tubes at room temperature.</td>
		</tr>
		<tr>
			<td>Phenol:chloroform:isoamyl alcohol (25:24:1, pH 7.9)</td>
			<td>life technologies</td>
			<td>AM9730</td>
			<td>Phenol:Chloroform:IAA (25:24:1) is premixed and supplied at pH 6.6. Use provided Tris alkaline buffer to raise pH to 7.9. Store at 4 &#176;C. CAUTION: phenol:chloroform:isoamyl alcohol is corrosive, highly toxic and combustible.</td>
		</tr>
		<tr>
			<td>Primer3 (software)</td>
			<td>Steve Rozen &#38; Helen Skaletsky</td>
			<td>non-commercial</td>
			<td>http://biotools.umassmed.edu/bioapps/primer3_www.cgi</td>
		</tr>
		<tr>
			<td>Protease inhibitor tablets</td>
			<td>Roche</td>
			<td>11836170001</td>
			<td>cOmplete, Mini, EDTA-free. Use 1 tablet per 10 ml. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Protease inhibitor tablets</td>
			<td>Roche</td>
			<td>11873580001</td>
			<td>cOmplete, EDTA-free. Use 1 tablet per 50 ml. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>life technologies</td>
			<td>AM2548</td>
			<td>proteinase K solution (20 &#181;g/&#181;l). Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>RNase A</td>
			<td>life technologies</td>
			<td>12091-039</td>
			<td>RNase A (20 &#181;g/&#181;l). Store at room temperature.</td>
		</tr>
		<tr>
			<td>Rotator</td>
			<td>Stuart</td>
			<td>SB3</td>
			<td>Rotator SB3</td>
		</tr>
		<tr>
			<td>SAMtools (software)</td>
			<td>Li et al.</td>
			<td>non-commercial</td>
			<td>http://samtools.sourceforge.neta</td>
		</tr>
		<tr>
			<td>Solid phase reversible immobilisation beads</td>
			<td>Beckman Coulter</td>
			<td>A63882</td>
			<td>The Agencourt AMPure XP beads are used to minimise adaptor dimer contamination in ChIP-Seq libraries. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Sonicator 3000</td>
			<td>Misonix/Qsonica</td>
			<td>NA</td>
			<td>Newer models are now available. Q125, Q500 or Q700 are all suitable for shearing crosslinked chromatin.</td>
		</tr>
		<tr>
			<td>Sound enclosure</td>
			<td>Misonix/Qsonica</td>
			<td>NA</td>
			<td>optional: follow the manufacturer&#39;s recommendation to obtain the correct sound enclosure.</td>
		</tr>
		<tr>
			<td>Thermomixer</td>
			<td>eppendorf</td>
			<td>22670000</td>
			<td>Thermomixer for 24 x 1.5 mL tubes. Precise temperature control from 4 &#176;C above room temperature to 99 &#176;C.</td>
		</tr>
	</tbody>
</table>

genome-wide snapshot of chromatin regulators and states in xenopus embryos by chip-seq

The recruitment of chromatin regulators and the assignment of chromatin states to specific genomic loci are pivotal to cell fate decisions and tissue and organ formation during development. Determining the locations and levels of such chromatin features in vivo will provide valuable information about the spatio-temporal regulation of genomic elements, and will support aspirations to mimic embryonic tissue development in vitro. The most commonly used method for genome-wide and high-resolution profiling is chromatin immunoprecipitation followed by next-generation sequencing (ChIP-Seq). This protocol outlines how yolk-rich embryos such as those of the frog Xenopus can be processed for ChIP-Seq experiments, and it offers simple command lines for post-sequencing analysis. Because of the high efficiency with which the protocol extracts nuclei from formaldehyde-fixed tissue, the method allows easy upscaling to obtain enough ChIP material for genome-wide profiling. Our protocol has been used successfully to map various DNA-binding proteins such as transcription factors, signaling mediators, components of the transcription machinery, chromatin modifiers and post-translational histone modifications, and for this to be done at various stages of embryogenesis. Lastly, this protocol should be widely applicable to other model and non-model organisms as more and more genome assemblies become available.

Gleichwertige Ergebnisse liefern wie die hier vorgestellt werden erwartet, wenn das Protokoll wird gut ausgeführt und der Antikörper verwendet wird von ChIP-Grade-Qualität (siehe Diskussion). Dieses Protokoll ermöglicht die Gewinnung von Zellkernen aus Formaldehyd fixierten Xenopus-Embryonen und die effiziente Scher Chromatin durch Beschallung (1A-C). Geschert Chromatin zeigt eine asymmetrische Verteilung von DNA-Fragmenten vor allem im Bereich von 100 bis 1.000 bp und Peaking zwischen 300 und 500 bp (Abbildung 1C). Eine minimale 50 pg von immunpräzipitierten DNA wird benötigt, um erfolgreich zu machen eine indizierte Paired-End ChIP-Seq-Bibliothek mit ähnlich großen DNA-Inserts (Abbildung 2A). Die Bibliothek sollte weitgehend frei von Dimeren Adapter, die auf dem Elektropherogramm bei etwa 120 bp gesehen werden kann. Nach Sequenzierung-durch-Synthese, vorverarbeitet Lesewerte werden in das Genom (Abbildung 2B, C) ​​abgebildet. In einem erfolgreichen Versuch mit <em&gt; X. tropicalis Embryonen liest von 40 bp in der Regel 50 bis 70% der Einendmaschine eindeutig zum Genom Zusammenbau v7.1 mit maximal zwei Fehlpaarungen zugeordnet werden. Während einliest auszurichten ziemlich gleichmßig über das Genom, die Ausrichtung des Chips liest ergibt strangspezifische Anreicherung, die die Chromatinstruktur Merkmal von Interesse flankieren. Dies ist, da alle Fragmente werden von dem 5&#39;-Ende (2C) 25 sequenziert. Die Ausweitung der Ausrichtung in Leserichtung zu einer durchschnittlichen Fragmentgröße ermöglicht exakte Profile für einzelne Chromatin Funktionen wie Transkriptionsfaktor-Bindungsereignisse. Diese DNA-Belegungen erscheinen als Peaks, wenn in IGV oder einem anderen kompatiblen Genom-Browser visualisiert. Peak Anrufern wie MACs verwendet, um den Ort dieser Peaks (3A) zu bestimmen. Auf diese Weise Zehntausende von Bindungsstellen wurden in der X. bestimmt tropicalis-Genoms für die T-Box-Transkriptionsfaktoren wie VEGT 26. ChIP-qPCR Erfahgen sollte die lokale Anreicherung von ChIP-Seq (3B) gefunden zu bestätigen. ChIP-Seq-Experimente erlauben die Erkundung genomweiten Eigenschaften von Chromatin-Funktionen. Beispielsweise kann die Berechnung der Lese- Verteilung über genomischen Elemente wie Transkriptionsstart und Terminationsstellen keine räumliche Bindungspräferenzen rund Gene (3C) zu markieren. Ebenso ist eine Heatmap der Lese Distributionen zu Stoßstellen wird verwendet, um verschiedene Chromatin Features auf einen genomweiten Skala (3D) zu vergleichen. Bestimmte Transkriptionsfaktoren binden DNA sequenzspezifisch. De novo-Motiv-Analyse der genomischen DNA zugrunde liegenden Peaks können diese Art von Informationen, einschließlich Co-angereicherten Motive potentieller Kofaktoren (3E) abzurufen. Die große Mehrheit der Zielgene zeigen DNA-Belegung zu einem niedrigeren und nicht höhere Ebene (3F). Diese Skala freie Funktion scheint recht häufig bei transcription Faktoren und schlägt vor, daß nur ein kleiner Bruchteil der Zielgene sind direkt mit biologischer Relevanz 27,28 geregelt. Die Analyse der angereicherten GO Begriffe oder andere Eigenschaften wie beispielsweise die differentielle Expression von Zielgenen können ferner offenbaren Einblicke in die biologische Funktion des Chromatins Funktion im Xenopus Embryo (Figur 3G). <img alt="Figur 1" src="/files/ftp_upload/52535/52535fig1highres.jpg" /> Abbildung 1. Chromatin Immunopräzipitation Verfahren für Xenopus-Embryonen. (A) Die Embryonen sind Formaldehyd fixierten in der Entwicklungsphase von Interesse kovalent binden (vernetzen) alle Proteine ​​mit genomischer DNA assoziiert. Bei der Kerngewinnung (B), wird vernetzt Chromatin fragmentiert, um gezieltere genomischen DNA-Bindung oder Chromatinmodifizierung Websites durch Minimierung der flankierenden DNEine Sequenz (C). Anschließend werden die Chromatin-Fragmente mit einem Chip-Grade-Antikörper immunpräzipitiert zu denen, die das Epitop von Interesse (D) anzureichern. Die co-immunpräzipitiert DNA wird das Protein ausgezogen und vor dem Erstellen der ChIP Fragmentbibliothek für NGS (Abbildung 2) gereinigt (E). <a href="https://www.jove.com/files/ftp_upload/52535/52535fig1large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieses Bild anzuzeigen.</a> <img alt="Abbildung 2" src="/files/ftp_upload/52535/52535fig2highres.jpg" /> Abbildung 2. ChIP-Seq Bibliothek Vorbereitung, Sequenzierung-durch-Synthese, die Kartierung und Spitzen Berufung. (A) Das Elektropherogramm zeigt eine gute ChIP-Seq-Bibliothek mit DNA-Matrizen von 250 bis 450 bp. Diese Vorlagen beinhalten die DNA-Insert von Interesse durch die universelle (58 bp) flankiert und die indexierte (63 bp) Adapter. (B) </strong&gt; Millionen von Clustern, wobei jeder Cluster mit identischen Vorlagen sind sequenziert Base für Base in Gegenwart von allen vier Nukleotiden besitzen, reversible, deutliche Fluorophor und identische Kündigungs Eigenschaften. Fluoreszenzbilder werden in Echtzeit verarbeitet werden, um entsprechenden Basen, die letztlich zusammengebaut in liest nennen. (C) nur liest, dass Karte eindeutig dem Xenopus Genom aufbewahrt. Da alle Fragmente werden von dem 5&#39;-Ende sequenziert, zur Kartierung der ChIP liest ergibt strangspezifischen Peaks, die die Chromatinstruktur Merkmal von Interesse flankieren. Dabei Spitzen Anrufer erkennen die Bereicherung durch die Immunpräzipitation stammt und erweitern das heißt zu einer durchschnittlichen Fragmentlänge genau zu lokalisieren Chromatin Funktionen. <a href="https://www.jove.com/files/ftp_upload/52535/52535fig2large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieses Bild anzuzeigen.</a> <img alt = &quot;3&quot; src = &quot;/ files / ftp_upload / 52.535 / 52535fig3highres.jpg&quot; /&gt; Figur 3 Ein Beispiel einer Post Sequenzierung Analyse und Visualisierung von Daten mittels des zygotischen T-Box-Transkriptionsfaktor VEGT (zVegT). Alle Lesezählungen hier dargestellt sind normalisiert auf 10 Millionen eindeutig abgebildet und nichtredundanten liest. (A) Auszug der genomweiten Profil zVegT verbindlich in X. tropicalis Gastrula Embryos (Stadium 11 bis 12,5 nach Nieuwkoop und Faber 29). Jeder Peak, eine Anhäufung von erweiterten liest, stellt eine Bindungsstelle. Diese Spitzen sind durch MACS2 mit einem falschen Discovery Rate (FDR) von weniger als 1% genannt. Jeder MESP-Gens zeigt sehr proximalen und stromauf zVegT Bindung, sondern nur mespa und mespb durch diese Stufe (RNA-Seq-Daten 30) ausgedrückt. (B) DNA Belegungsniveaus zVegT durch ChIP-qPCR an verschiedenen Loci bestimmt (einschließlich eines nicht -gebundenen Region 0,5 kb stromaufwärts von β-Aktin) Konfirm die spezifische Anreicherung von ChIP-Seq gefunden. Ergebnisse für mespa mit Peak genannt (roter Balken) in (A) vergleichen. Die DNA Belegungspegel als Prozentsatz der Eingang für beide, den Chip mit der VEGT Antikörper (polyklonaler Kaninchen-IgG-Isotyp) und dem Chip mit dem Antikörper-Kontrolle (normales Kaninchen IgG) visualisiert. Fehlerbalken geben die Standardabweichung von zwei biologischen Replikaten. (C) METAGENE Analyse zeigt Präferenz zVegT Bindung (Tags über 25 bp klassierten) mit dem Promotor in Bezug auf jede andere Genombereich um und in Gen Körpern. (D) Bewegungsradius zeigt k-Mittelwert Cluster (k = 5) DNA Auslastung der zVegT und Smad2 / Smad3 (ChIP-Seq Daten 31) bezogen auf alle zVegT gebundenen Regionen Gastrulastadium (Tags über 25 bp klassierte). Die Heatmap ist log 2 basiert und bei 5 Tags pro bp zentriert. (E) De-novo-Motiv-Analyse entdeckt die kanonische T-Box-Transkriptionsfaktor-Bindungsmotiv in 38% der zVegT-Regionen gebunden, wenn die zugrunde liegende Motiv Wertung ist auf einer Entdeckungsrate von 5% im Hintergrund Sequenzen. Die Dichte Karte zeigt höchsten Anreicherung für den T-Box-Motiv in der Mitte zVegT Bindungsstellen, wobei die kanonische Smad2 / Smad3 Bindungsmotiv kaum angereichert. (F) Histogramm zeigt DNA Belegungsniveaus zVegT, die für jedes Ziel-Gen berechnet werden von allen Gipfeln (+/- 200 bp) zwischen 5 kb stromaufwärts [-]. und 1 kb stromabwärts [+] der entsprechenden Transkriptionsstartstellen (G) Top 300 Gene, die mit höchsten DNA-Auslastung innerhalb -5 kb und 1 kb sind für biologische Prozesse der frühen Embryonalentwicklung bereichert. Diese GO Begriffe sind im Einklang mit der vermeintlichen Funktion zVegT. Der FDR auf einem zweiseitigen Fisher-Test basiert und für multiples Testen korrigiert. <a href="https://www.jove.com/files/ftp_upload/52535/52535fig3large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieses Bild anzuzeigen.</a>

Watch this Scientific Journal Video about Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq at JoVE.com

Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

Die Frage, wie Chromatin Regulierungsbehörden und Chromatin-Staaten betreffen das Genom in vivo ist der Schlüssel zum Verständnis, wie frühe Zellschicksal Entscheidungen werden in den sich entwickelnden Embryo gemacht. ChIP-Seq-die beliebteste Ansatz zur Chromatin Funktionen auf globaler Ebene, wird hier für Xenopus Embryonen beschrieben untersuchen.

Genomweite Snapshot von Chromatin Regulierungsbehörden und Staaten in<em&gt; Xenopus</em&gt; Embryonen von ChIP-Seq

The recruitment of chromatin regulators and the assignment of chromatin states to specific genomic loci are pivotal to cell fate decisions and tissue and ...

Research

JoVE Journal

Developmental Biology

Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

Manipulation and In Vitro Maturation of Xenopus laevis Oocytes, Followed by Intracytoplasmic Sperm Injection, to Study Embryonic Development

Manipulation and In Vitro Maturation of Xenopus laevis Oocytes, Followed by Intracytoplasmic Sperm Injection, to Study Embryonic Development

Manipulation und<em&gt; In-vitro-</em&gt; Ausbau der<em&gt; Xenopus laevis</em&gt; Eizellen, von Intrazytoplasmatische Spermieninjektion gefolgt, um embryonale Entwicklungsstudie

Amphibian eggs have been widely used to study embryonic development. Early embryonic development is driven by maternally stored factors accumulated during ...

Forschung

Entwicklungsbiologie

Accurate and Phenol Free DNA Sexing of Day 30 Porcine Embryos by PCR

Präzise und Phenol Freie DNA Geschlechtsbestimmung von Tag 30 Schweineembryonen mittels PCR

Research into prenatal programming in the pig has shown that the sex of the developing embryo or fetus can influence the developmental outcome. Therefore, ...

Technique to Target Microinjection to the Developing Xenopus Kidney

Technique to Target Microinjection to the Developing Xenopus Kidney

Technik auf Zielmikroinjektions an die Entwicklungs<em&gt; Xenopus</em&gt; Kidney

The embryonic kidney of Xenopus&#160;laevis (frog), the pronephros, consists of a single nephron, and can be used as a model for kidney disease. Xenopus ...

Generation of Parabiotic Zebrafish Embryos by Surgical Fusion of Developing Blastulae

Die Erzeugung von Parabiotic Zebrabärbling Embryonen, die durch chirurgische Fusion der Entwicklung Blastulae

Surgical parabiosis of two animals of different genetic backgrounds creates a unique scenario to study cell-intrinsic versus cell-extrinsic roles for ...

Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos

Biosensing Motor Neuron Membran Potenzial in Live Zebrafisch Embryos

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the ...

Visualization and Quantitative Analysis of Embryonic Angiogenesis in Xenopus tropicalis

Visualization and Quantitative Analysis of Embryonic Angiogenesis in Xenopus tropicalis

Visualisierung und quantitative Analyse der embryonalen Angiogenese in<em&gt; Xenopus tropicalis</em

Blood vessels supply oxygen and nutrients throughout the body, and the formation of the vascular network is under tight developmental control. The ...

Induction of Hypoxia in Living Frog and Zebrafish Embryos

Induktion von Hypoxie im lebenden Frosch und Zebrafisch Embryonen

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and ...

CARIP-Seq and ChIP-Seq: Methods to Identify Chromatin-Associated RNAs and Protein-DNA Interactions in Embryonic Stem Cells

CARIP-Seq und ChIP-Seq: Methoden zur Ermittlung von Chromatin-assoziierter RNA und Protein-DNA-Wechselwirkungen in embryonale Stammzellen

Embryonic stem (ES) cell self-renewal&#160;and differentiation is governed by extrinsic signals and intrinsic networks of transcription factors, ...

Visualizing the Node and Notochordal Plate In Gastrulating Mouse Embryos Using Scanning Electron Microscopy and Whole Mount Immunofluorescence

Visualisierung der Knoten und Notochordal Platte In Gastrulating Maus-Embryonen mittels Rasterelektronenmikroskopie und ganze Mount Immunfluoreszenz

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is ...

Microinjection of DNA into Eyebuds in Xenopus laevis Embryos and Imaging of GFP Expressing Optic Axonal Arbors in Intact, Living Xenopus Tadpoles

Microinjection of DNA into Eyebuds in Xenopus laevis Embryos and Imaging of GFP Expressing Optic Axonal Arbors in Intact, Living Xenopus Tadpoles

Mikroinjektion von DNA in Augenknospen in Xenopus laevis Embryonen und Bildgebung von GFP Expressing Optic Axonal Arbors in Intact, Living Xenopus Tadpoles

The primary visual projection of tadpoles of the aquatic frog Xenopus laevis serves as an excellent model system for studying mechanisms that regulate the ...