Name: genome-wide snapshot of chromatin regulators and states in xenopus embryos by chip-seq
Uploaded: 2015-02-26T13:00:00
Duration: 10 min 23 s
Description: Watch this Scientific Journal Video about Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq at JoVE.com

We thank Chris Benner for implementing the X. tropicalis genome (xenTro2, xenTro2r) into HOMER and the Gilchrist lab for discussions on post-sequencing analysis. I.P. assisted the GO term analysis. G.E.G and J.C.S. were supported by the Wellcome Trust and are now supported by the Medical Research Council (program number U117597140).

<ol>
	<li>Gilmour, D. S., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detecting+protein-DNA+interactions+in+vivo:+distribution+of+RNA+polymerase+on+specific+bacterial+genes.">Detecting protein-DNA interactions in vivo: distribution of RNA polymerase on specific bacterial genes.</a> Proc Natl Acad Sci U S A. 81 (14), 4275-4279 (1984).</li><li>Gilmour, D. S., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+interactions+of+RNA+polymerase+II+with+genes+of+Drosophila+melanogaster.">In vivo interactions of RNA polymerase II with genes of Drosophila melanogaster.</a> Mol Cell Biol. 5 (8), 2009-2018 (1985).</li><li>Solomon, M. J., Larsen, P. L., Varshavsky, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+protein-DNA+interactions+in+vivo+with+formaldehyde:+evidence+that+histone+H4+is+retained+on+a+highly+transcribed+gene.">Mapping protein-DNA interactions in vivo with formaldehyde: evidence that histone H4 is retained on a highly transcribed gene.</a> Cell. 53 (6), 937-947 (1988).</li><li>Ren, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+location+and+function+of+DNA+binding+proteins.">Genome-wide location and function of DNA binding proteins.</a> Science. 290 (5500), 2306-2309 (2000).</li><li>Johnson, D., Mortazavi, A., Myers, R., Wold, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+mapping+of+in+vivo+protein-DNA+interactions.">Genome-wide mapping of in vivo protein-DNA interactions.</a> Science. 316 (5830), 1497-1502 (2007).</li><li>Hellsten, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genome+of+the+Western+clawed+frog+Xenopus+tropicalis.">The genome of the Western clawed frog Xenopus tropicalis.</a> Science. 328 (5978), 633-636 (2010).</li><li>Lee, T. I., Johnstone, S. E., Young, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+and+microarray-based+analysis+of+protein+location.">Chromatin immunoprecipitation and microarray-based analysis of protein location.</a> Nature Protocols. 1 (2), 729-748 (2006).</li><li>Blythe, S. A., Reid, C. D., Kessler, D. S., Klein, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+in+early+Xenopus+laevis+embryos.">Chromatin immunoprecipitation in early Xenopus laevis embryos.</a> Dev Dyn. 238 (6), 1422-1432 (2009).</li><li>Gentsch, G. E., Smith, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+physical+chromatin+associations+across+the+Xenopus+genome+by+chromatin+immunoprecipitation.">Investigating physical chromatin associations across the Xenopus genome by chromatin immunoprecipitation.</a> Cold Spring Harb Protoc. 2014 (5), (2014).</li><li>Ubbels, G. A., Hara, K., Koster, C. H., Kirschner, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+a+functional+role+of+the+cytoskeleton+in+determination+of+the+dorsoventral+axis+in+Xenopus+laevis+eggs.">Evidence for a functional role of the cytoskeleton in determination of the dorsoventral axis in Xenopus laevis eggs.</a> J Embryol Exp Morphol. 77, 15-37 (1983).</li><li>Langmead, B., Trapnell, C., Pop, M., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrafast+and+memory-efficient+alignment+of+short+DNA+sequences+to+the+human+genome.">Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.</a> Genome Biol. 10 (3), R25 (2009).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Heinz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+combinations+of+lineage-determining+transcription+factors+prime+cis-regulatory+elements+required+for+macrophage+and+B+cell+identities.">Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities.</a> Mol Cell. 38 (4), 576-589 (2010).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+analysis+of+ChIP-Seq+(MACS).">Model-based analysis of ChIP-Seq (MACS).</a> Genome Biol. 9 (9), R137 (2008).</li><li>Robinson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomics+viewer.">Integrative genomics viewer.</a> Nat Biotechnol. 29 (1), 24-26 (2011).</li><li>Thorvaldsdottir, H., Robinson, J. T., Mesirov, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+Genomics+Viewer+(IGV):+high-performance+genomics+data+visualization+and+exploration.">Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration.</a> Brief Bioinform. 14 (2), 178-192 (2013).</li><li>Imoto, S., Nolan, J., Bioinformatics Miyano, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> 20 (9), 1453-1454 (2004).</li><li>Camacho, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BLAST+:+architecture+and+applications.">BLAST+: architecture and applications.</a> BMC Bioinformatics. 10, 421 (2009).</li><li>Conesa, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blast2GO:+a+universal+tool+for+annotation,+visualization+and+analysis+in+functional+genomics+research.">Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research.</a> Bioinformatics. 21 (18), 3674-3676 (2005).</li><li>Sive, H., Grainger, R., Harland, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Early development of Xenopus laevis: A laboratory manual. , (2000).</li><li>Chen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+evaluation+of+factors+influencing+ChIP-seq+fidelity.">Systematic evaluation of factors influencing ChIP-seq fidelity.</a> Nat Methods. 9 (6), 609-614 (2012).</li><li>Sharov, A. A., Ko, M. S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exhaustive+search+for+over-represented+DNA+sequence+motifs+with+CisFinder.">Exhaustive search for over-represented DNA sequence motifs with CisFinder.</a> DNA Res. 16 (5), 261-273 (2009).</li><li>Bailey, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MEME+SUITE:+tools+for+motif+discovery+and+searching.">MEME SUITE: tools for motif discovery and searching.</a> Nucl Acids Res. 37 (2), W202-W208 (2009).</li><li>Livak, K. J., Schmittgen, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+relative+gene+expression+data+using+real-time+quantitative+PCR+and+the+2(-Delta+Delta+C(T))+Method.">Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.</a> Methods. 25 (4), 402-408 (2001).</li><li>Park, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq:+advantages+and+challenges+of+a+maturing+technology.">ChIP-seq: advantages and challenges of a maturing technology.</a> Nat Rev Genet. 10 (10), 669-680 (2009).</li><li>Gentsch, G. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+T-box+transcription+factor+profiling+reveals+joint+regulation+of+embryonic+neuromesodermal+bipotency.">In vivo T-box transcription factor profiling reveals joint regulation of embryonic neuromesodermal bipotency.</a> Cell Rep. 4 (6), 1185-1196 (2013).</li><li>Barabasi, A. L., Oltvai, Z. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Network+biology:+understanding+the+cell's+functional+organization.">Network biology: understanding the cell's functional organization.</a> Nat Rev Genet. 5 (2), 101-113 (2004).</li><li>Biggin, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+transcription+networks+as+highly+connected,+quantitative+continua.">Animal transcription networks as highly connected, quantitative continua.</a> Dev Cell. 21 (4), 611-626 (2011).</li><li>Nieuwkoop, P. D., Faber, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Normal table of Xenopus laevis (Daudin): a systematical and chronological survey of the development from the fertilized egg till the end of metamorphosis. , (1994).</li><li>Akkers, R. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+hierarchy+of+H3K4me3+and+H3K27me3+acquisition+in+spatial+gene+regulation+in+Xenopus+embryos.">A hierarchy of H3K4me3 and H3K27me3 acquisition in spatial gene regulation in Xenopus embryos.</a> Dev Cell. 17 (3), 425-434 (2009).</li><li>Yoon, S. J., Wills, A. E., Chuong, E., Gupta, R., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> HEB and E2A function as SMAD/FOXH1 cofactors. Genes Dev. 25 (15), 1654-1661 (2011).</li><li>Jallow, Z., Jacobi, U. G., Weeks, D. L., Dawid, I. B., Veenstra, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specialized+and+redundant+roles+of+TBP+and+a+vertebrate-specific+TBP+paralog+in+embryonic+gene+regulation+in+Xenopus.">Specialized and redundant roles of TBP and a vertebrate-specific TBP paralog in embryonic gene regulation in Xenopus.</a> Proc Natl Acad Sci U S A. 101 (37), 13525 (2004).</li><li>Buchholz, D. R., Paul, B. D., Shi, Y. -. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene-specific+changes+in+promoter+occupancy+by+thyroid+hormone+receptor+during+frog+metamorphosis.+Implications+for+developmental+gene+regulation.">Gene-specific changes in promoter occupancy by thyroid hormone receptor during frog metamorphosis. Implications for developmental gene regulation.</a> J Biol Chem. 280 (50), 41222-41228 (2005).</li><li>Wills, A. E., Guptaa, R., Chuonga, E., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+and+deep+sequencing+in+Xenopus+tropicalis+and+Xenopus+laevis.">Chromatin immunoprecipitation and deep sequencing in Xenopus tropicalis and Xenopus laevis.</a> Methods. 66 (3), 410-421 (2014).</li><li>Metz, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+formaldehyde-induced+modifications+in+proteins:+reactions+with+model+peptides.">Identification of formaldehyde-induced modifications in proteins: reactions with model peptides.</a> J Biol Chem. 279 (8), 6235-6243 (2004).</li><li>Landt, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+guidelines+and+practices+of+the+ENCODE+and+modENCODE+consortia.">ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.</a> Genome Res. 22 (9), 1813-1831 (2012).</li><li>Mazzoni, E. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell-based+mapping+of+developmental+transcriptional+programs.">Embryonic stem cell-based mapping of developmental transcriptional programs.</a> Nat Methods. 8 (12), 1056-1058 (2011).</li><li>Deal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+method+for+gene+expression+and+chromatin+profiling+of+individual+cell+types+within+a+tissue.">A simple method for gene expression and chromatin profiling of individual cell types within a tissue.</a> Dev Cell. 18 (6), 1030-1040 (2010).</li><li>Bonn, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue-specific+analysis+of+chromatin+state+identifies+temporal+signatures+of+enhancer+activity+during+embryonic+development.">Tissue-specific analysis of chromatin state identifies temporal signatures of enhancer activity during embryonic development.</a> Nat Genet. 44 (2), 148-156 (2012).</li></ol>

The authors declare that they have no competing financial interests.

우리의 프로토콜은하고 아프리카 발톱 개구리의 배아에서 게놈 전체 염색질 프로파일을 분석하는 방법에 대해 설명합니다. 그것은 실리에 풍부한 게놈 사이트를 나타내는 읽기의 수백만을 처리하는 생체 내에서 내인성 유전자 좌에 가교 단백질에서 모든 단계를 다루고 있습니다. 게놈 초안의 증가 번호를 사용할 수 있기 때문에,이 프로토콜은 다른 모델과 비 모델 생물에 적용해야합니다. 이전의 연구 8,31,33,34에서 떨어져이 프로토콜을 설정하는 가장 중요한 실험 부분은, 가교 핵을 추출 후 고정 절차입니다. 그것은 효율적인 염색질 용해 화 및 전단 쉽게 업 스케일링을 용이하게한다. 함께 도서관 준비의 개선 된 효율성이 프로토콜은 반에서 관심있는 염색질 관련 항원을 발현하는 이백만 세포에 높은 복잡성 칩-SEQ 도서관의 건축을 할 수 있습니다. 칩 qPCR의 실험의 경우, 이들 세포의 몇 만 정상적으로 충분아마도 여섯 별개의 게놈 유전자 좌에서 DNA 농축을 확인합니다. 이러한 숫자는 보수적이지만, 단백질 발현 수준, 항체의 품질에 따라 효율, 에피토프의 접근성을 가교 달라질 수있다. 가이드로, 단일 Xenopus의 배아 중반 포배 단계 (Nieuwkoop 및 페이버 (29) 후 8.5)에서 약 4,000 세포를 포함, 후반 낭배 단계 (12)에서 40,000 세포와 초기 tailbud 단계 (20)에서 10 만 셀. 효율적인 면역에 대한 정확한 고정 시간은 칩 qPCR에 (10 항)에 의해 경험적으로 결정해야합니다. 실험이 X를 포함하는 경우 일반적으로 더 이상 고정 시간이 필요합니다 배아, 초기 발달 단계, 약한 (또는 간접) DNA 결합 특성을 laevis의. 그러나, 염색질 전단 효율성이 떨어질대로, 40 분보다 긴 아프리카 발톱 개구리 배아를 고정, 또는 표시 (섹션 3)보다 더 많은 배아를 처리하지 않는 것이 좋습니다. 그것은 중요하지매우 어려운 노른자 풍부한 배아에서 핵 추출을 할 수 포름 알데히드를 담금질이 일반적인 단계로 고정 후 어떤 글리신를 사용합니다. 현재, 그 이유는 알려져 있지 않다. 또한 포름 알데히드 부가 물 상기 글리신 아미노 기 또는 아르기닌 잔기 35 N 말단과 반응하여 생각할 수있다. 항체는 칩 실험의 핵심입니다 충분한 컨트롤 (Landt 등. (36) 가이드 라인을 참조) 관심의 항원에 대한 특이성을 보여주기 위해 수행 될 필요가있다. 더 칩 등급 항체가없는 경우이 단백질이 차지하는 결합 부위 내인성 수 37, 에피토프 태그 융합 단백질 대응 소개 합법적 대안이 될 수있다. 이 경우, uninjected 배아는 음성 대조군보다는 비특이적 혈 칩으로 사용하는 것이 최선이다. 관심의 단백질이 enri의 가난한 복구의 결과로 낮은 수준에서 표현되는 경우,이 전략은 적용 할 수있다CHED DNA. 왜냐하면 사용중인 DNA의 소량 칩-SEQ 라이브러리 제조용으로서,이 세정 공정 수를 줄이고 최소한 DNA의 손실을 유지하는 반응을 조합하는 방법을 선택하는 것을 권장한다. 어댑터와 프라이머 (특정 재료 / 장비의 표 참조) 멀티 플렉스 시퀀싱 및 NGS 플랫폼과 호환 될 수 있도록해야합니다. (긴 단일 가닥 무기를 포함) Y-어댑터를 사용하는 경우, 그것은 크기 선택 DNA 삽입하기 전에 PCR의 3-5 라운드 사전 증폭 라이브러리에 중요하다 (예., 100 내지 300 bp) 겔 전기 영동에 의해. 단일 가닥 말단 DNA 단편이 균질하게 이동. 시험은 PCR 사이클의 총 수를 결정하도록 권장 입력 DNA (예를 들면, 0.1, 0.5, 1, 2, 5, 10, 20 NG)의 다양한 양으로 실행 (이하 또는 18 사이클 같음) 크기를 만드는 데 필요한 100-200 NG의 - 선정 된 라이브러리입니다. PCR 사이클의 수를 줄이면 redu의 시퀀싱을 렌더링ndant은 덜 읽습니다. 고상 가역적 고정화 비즈 효율적으로 관심있는 DNA를 복구하고 안정적​​으로 결찰 및 PCR 반응이없는 임의의 어댑터 및 이량 체를 제거하는 시약을 정리 좋다. 수, 유형 및 길이의 측면에서 약 20-30000000 단일 엔드 36 bp의 충분한 깊이와 전체 Xenopus의 게놈을 커버하는 대부분의 칩 서열 번호 실험에 충분하다의 읽기, 읽기의. 가장 널리 NGS 기계는 이러한 기준을 충족 일상적으로 할 수있다. 그러나, 판독의 광범위한 분포가 예상되는 경우의 판독 샤프한 피크보다 오히려, 히스톤 변형 관찰로, 수를 늘리는 것이 유리할 수있다. 다수의 칩 - 서열 번호 실험을 위해, 4-5 다르게 인덱싱 라이브러리 풀링 할 수 있고, 고성능 NGS 기계를 사용하여 하나 이상의 유동 세포 차선 서열화. 때때로 mappability w을 증가 판독 길이 및 서열 DNA 템플릿의 양단 (페어링 엔드)를 연장하는 것이 바람직하다반복적 인 게놈 영역 내에서 염색질 암탉 분석입니다. 이 프로토콜은 전사 인자 시그널링 매개체 번역 후 변형으로 히스톤 염색질 다양한 기능에 성공적으로 적용되었다. 그들이 개발하고 염색질 프로파일을 해석하기 어렵게 될 그러나, 배아 세포 이질성의 증가 학위를 취득. 유망 단계는 세포 유형 특정 핵 (38, 39)를 추출하여 조직 특별히 프로필 염색질 풍경에 애기 장대와 초파리되었습니다. 우리의 프로토콜은 다른 배아 조직 특이 칩 서열 번호에 대한 방법을 포장 할 수있는 핵 추출 단계를 포함한다.

The first attempts to characterize protein-DNA interactions in vivo were reported about 30 years ago in an effort to understand RNA polymerase-mediated gene transcription in bacteria and in the fruit fly1,2. Since then, the use of immunoprecipitation to enrich distinct chromatin features (ChIP) has been widely adopted to capture binding events and chromatin states with high efficiency3. Subsequently, with the emergence of powerful microarray technologies, this method led to the characterization of genome-wide chromatin landscapes4. More recently, chromatin profiling has become even more comprehensive and high-resolution, because millions of co-immunoprecipitated DNA templates can now be sequenced in parallel and mapped to the genome (ChIP-Seq)5. As increasing numbers of genome assemblies are available, ChIP-Seq is an attractive approach to learn more about the genome regulation that underlies biological processes. 
Here we provide a protocol to perform ChIP-Seq on yolk-rich embryos such as those of the frog Xenopus. Drafts of the genomes of both widely used Xenopus species&#8212;X. tropicalis and X. laevis&#8212;have now been released by the International Xenopus Genome Consortium6. The embryos of Xenopus species share many desirable features that facilitate and allow the interpretation of genome-wide chromatin studies, including the production of large numbers of high-quality embryos, the large size of the embryos themselves, and their external development. In addition, the embryos are amenable to classic and novel manipulations like cell lineage tracing, whole-mount in situ hybridisation, RNA overexpression, and TALEN/CRISPR-mediated knockout technology.
The following protocol builds on the work of Lee et al., Blythe et al. and Gentsch et al.7-9. Briefly, Xenopus embryos are formaldehyde-fixed at the developmental stage of interest to covalently bind (cross-link) proteins to their associated genomic DNA. After nuclear extraction, cross-linked chromatin is fragmented to focus subsequent sequencing on specific genomic binding or modification sites, and to minimize the contributions of flanking DNA sequences. Subsequently, the chromatin fragments are immunoprecipitated with a ChIP-grade antibody to enrich those containing the protein of interest. The co-immunoprecipitated DNA is stripped from the protein and purified before creating an indexed (paired-end) library for next-generation sequencing (NGS). At the end, simple command lines are offered for the post-sequencing analysis of ChIP-Seq data.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>1/16 inch tapered microtip</td>
			<td>Qsonica</td>
			<td>4417</td>
			<td>This microtip is compatible with Sonicator 3000 from Misonix and Q500/700 from Qsonica.</td>
		</tr>
		<tr>
			<td>8 ml glass sample vial with cap</td>
			<td>Wheaton</td>
			<td>224884</td>
			<td>8 ml clear glass sample vials for aqueous samples with 15-425 size phenolic rubber-lined screw caps.</td>
		</tr>
		<tr>
			<td>Adaptor</td>
			<td>IDT or Sigma</td>
			<td>NA</td>
			<td>TruSeq universal adaptor, 
AATGATACGGCGACCACCGAG 
ATCTACACTCTTTCCCTACAC 
GACGCTCTTCCGATC*T. TruSeq indexed adaptor, 
P-GATCGGAAGAGCACACGTC 
TGAACTCCAGTCAC &#8208;NNNNNN&#8208; 
ATCTCGTATGCCGTCT TCTGCTT*G. *, phosphorothioate bondphosphate group at 5&#39; end. NNNNNN, index (see TruSeq ChIP Sample Preparation Guide for DNA sequence). Order adaptors HPLC purified. Adaptors can be prepared by combining equimolar amounts (each 100 &#181;M) of the universal and the indexed adaptor and cooling them down slowly from 95 &#176;C to room temperature. Use 1.5 pmol per ng of input DNA. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>b2g4pipe (software)</td>
			<td>Blast2GO</td>
			<td>non-commercial</td>
			<td>http://www.blast2go.com/data/blast2go/b2g4pipe_v2.5.zip</td>
		</tr>
		<tr>
			<td>BLAST+ (software)</td>
			<td>Camacho et al.</td>
			<td>non-commercial</td>
			<td>http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastDocs&#38;DOC_TYPE=Download</td>
		</tr>
		<tr>
			<td>Bowtie (software)</td>
			<td>Langmead et al.</td>
			<td>non-commercial</td>
			<td>http://bowtie-bio.sourceforge.net/index.shtml</td>
		</tr>
		<tr>
			<td>cisFinder (software)</td>
			<td>Sharov et al.</td>
			<td>non-commercial</td>
			<td>http://lgsun.grc.nia.nih.gov/CisFinder/</td>
		</tr>
		<tr>
			<td>Chip for capillary electrophoresis</td>
			<td>Agilent Technologies</td>
			<td>5067-1504</td>
			<td>Load this chip with 1 &#181;l DNA for library quality control. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Chip-based capillary electrophoresis system</td>
			<td>Agilent Technologies</td>
			<td>G2940CA</td>
			<td>The Agilent 2100 BioAnalyzer is used to check the quality of ChIP-Seq libraries. Keep reagents at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>ChIP-Seq library preparation kit (KAPA Hyper Prep Kit)</td>
			<td>Kapa Biosystems</td>
			<td>KK8504</td>
			<td>Kit contains KAPA end repair and A-tailing enzyme mix, end Repair and A-tailing buffer, DNA ligase, ligation buffer, KAPA HiFi HotStart ReadyMix (2X), and KAPA library amplification primer mix (10X) (see also PCR primers). Adaptors are not included. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>ChIP-Seq library preparation kit (alternative, ThruPLEX-FD Prep Kit)</td>
			<td>Rubicon Genomics</td>
			<td>R40048</td>
			<td>Kit uses their own stem-loop adaptors and primers. This kit eliminates intermediate purification steps and is as sensitive as the KAPA Hyper Prep Kit. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Cluster3 (software)</td>
			<td>de Hoon et al.</td>
			<td>non-commercial</td>
			<td>http://bonsai.hgc.jp/~mdehoon/software/cluster</td>
		</tr>
		<tr>
			<td>FastQC (software)</td>
			<td>Simon Andrews</td>
			<td>non-commercial</td>
			<td>http://www.bioinformatics.babraham.ac.uk/projects/fastqc</td>
		</tr>
		<tr>
			<td>Fluorometer</td>
			<td>life technologies</td>
			<td>Q32866</td>
			<td>Qubit 2.0 Fluorometer</td>
		</tr>
		<tr>
			<td>Fluorometer reagents</td>
			<td>life technologies</td>
			<td>Q32851</td>
			<td>The kit provides concentrated assay reagent, dilution buffer, and pre-diluted DNA standards for the Qubit fluorometer. Store DNA standards at 4 &#176;C, buffer and dye at room temperature.</td>
		</tr>
		<tr>
			<td>Formaldehyde</td>
			<td>Sigma</td>
			<td>F8775-4X25ML</td>
			<td>Formaldehyde solution, for molecular biology, 36.5-38% in H2O, stabilised with 10-15% methanol. Store at room temperature. CAUTION: Formaldehyde is corrosive and highly toxic.</td>
		</tr>
		<tr>
			<td>Gel (E-Gel EX agarose , 2%)</td>
			<td>life technologies</td>
			<td>G4010</td>
			<td>Pre-cast gel with 11 wells, openable format. Leave one lane between ladder and library empty to avoid cross-contamination. Store gels at room temperature.</td>
		</tr>
		<tr>
			<td>Gel electrophoresis system</td>
			<td>life technologies</td>
			<td>G6465</td>
			<td>E-Gel iBase and E-Gel Safe Imager combo kit for size-selecting ChIP-Seq libraries.</td>
		</tr>
		<tr>
			<td>Gel extraction kit</td>
			<td>Qiagen</td>
			<td>28706</td>
			<td>Store all reagents at room temperature. Use 500 &#181;l of QG buffer per 100 mg of 2% agarose gel slice to extract DNA. Use MinElute columns (from MinElute PCR purification kit) to elute DNA twice.</td>
		</tr>
		<tr>
			<td>HOMER (software)</td>
			<td>Chris Benner</td>
			<td>non-commercial</td>
			<td>http://homer.salk.edu/homer/index.html</td>
		</tr>
		<tr>
			<td>Hybridization oven</td>
			<td>Techne</td>
			<td>FHB1D</td>
			<td>Hybridizer HB-1D</td>
		</tr>
		<tr>
			<td>IGV (software)</td>
			<td>Robinson et al.</td>
			<td>non-commercial</td>
			<td>http://www.broadinstitute.org/igv/home</td>
		</tr>
		<tr>
			<td>Illumina CASAVA-1.8 quality filter (software)</td>
			<td>Assaf Gordon</td>
			<td>non-commercial</td>
			<td>http://cancan.cshl.edu/labmembers/gordon/fastq_illumina_filter</td>
		</tr>
		<tr>
			<td>Java TreeView (software)</td>
			<td>Alok Saldanha</td>
			<td>non-commercial</td>
			<td>http://jtreeview.sourceforge.net</td>
		</tr>
		<tr>
			<td>Laboratory jack</td>
			<td>Edu-Lab</td>
			<td>CH0642</td>
			<td>This jack is used to elevate sample in sound enclosure for sonication.</td>
		</tr>
		<tr>
			<td>Ladder, 100 bp</td>
			<td>New England BioLabs</td>
			<td>N3231</td>
			<td>Keep 1x solution at room temperature. Store stock at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Ladder, 1 kb</td>
			<td>New England BioLabs</td>
			<td>N3232</td>
			<td>Keep 1x solution at room temperature. Store stock at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Low-retention 1.5-ml microcentrifuge tubes</td>
			<td>life technologies</td>
			<td>AM12450</td>
			<td>nonstick, RNase-free microfuge tubes, 1.5 ml</td>
		</tr>
		<tr>
			<td>MACS2 (software)</td>
			<td>Tao Liu</td>
			<td>non-commercial</td>
			<td>https://github.com/taoliu/MACS</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>11201D</td>
			<td>These Dynabeads are superparamagnetic beads with affinity purified polyclonal sheep anti-mouse IgG covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>11203D</td>
			<td>These Dynabeads are superparamagnetic beads with affinity purified polyclonal sheep anti-rabbit IgG covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>10001D</td>
			<td>These Dynabeads are superparamagnetic beads with recombinant protein A covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>10003D</td>
			<td>These Dynabeads are superparamagnetic beads with recombinant protein G covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic rack</td>
			<td>life technologies</td>
			<td>12321D</td>
			<td>DynaMag-2 magnet</td>
		</tr>
		<tr>
			<td>MEME</td>
			<td>Bailey et al.</td>
			<td>non-commercial</td>
			<td>http://meme.nbcr.net/meme/</td>
		</tr>
		<tr>
			<td>Na3VO4</td>
			<td>New England BioLabs</td>
			<td>P0758</td>
			<td>Sodium orthovanadate (100 mM) is a commonly used general inhibitor for protein phosphotyrosyl phosphatases. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>NaF</td>
			<td>New England BioLabs</td>
			<td>P0759</td>
			<td>Sodium fluoride (500 mM) is commonly used as general inhibitor of phosphoseryl and phosphothreonyl phosphatases. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>NGS machine</td>
			<td>Illumina</td>
			<td>SY-301-1301</td>
			<td>Genome Analyzer IIx</td>
		</tr>
		<tr>
			<td>NGS machine (high performance)</td>
			<td>Illumina</td>
			<td>SY-401-2501</td>
			<td>HiSeq</td>
		</tr>
		<tr>
			<td>Normal serum (antibody control)</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-2028</td>
			<td>Use as control for goat polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Normal serum (antibody control)</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-2025</td>
			<td>Use as control for mouse polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Normal serum (antibody control)</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-2027</td>
			<td>Use as control for rabbit polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Nucleic acid staining solution</td>
			<td>iNtRON</td>
			<td>21141</td>
			<td>Use RedSafe nucleic acid staining solution at 1:50,000. Store at room temperature.</td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Sigma</td>
			<td>O3756-25G</td>
			<td>1-Phenylazo-2-naphthol-6,8-disulfonic acid disodium salt. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>PCR primers</td>
			<td>e.g., IDT or Sigma</td>
			<td>NA</td>
			<td>Primers to enrich adaptor-ligated DNA fragments by PCR: AATGATACGGCGACCACCGA*G and CAAGCAGAAGACGGCATACGA*G, phosphorothioate bond. Primers designed by Ethan Ford. Combine primers at 5 &#181;M each. Use 5 &#181;l in a 50 &#181;l PCR reaction. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>MinElute PCR purification kit&#160;</td>
			<td>Qiagen</td>
			<td>28006</td>
			<td>for purification of ChIP-qPCR and shearing test samples. Store MinElute spin columns at 4 &#176;C, all other buffers and collection tubes at room temperature.</td>
		</tr>
		<tr>
			<td>Phenol:chloroform:isoamyl alcohol (25:24:1, pH 7.9)</td>
			<td>life technologies</td>
			<td>AM9730</td>
			<td>Phenol:Chloroform:IAA (25:24:1) is premixed and supplied at pH 6.6. Use provided Tris alkaline buffer to raise pH to 7.9. Store at 4 &#176;C. CAUTION: phenol:chloroform:isoamyl alcohol is corrosive, highly toxic and combustible.</td>
		</tr>
		<tr>
			<td>Primer3 (software)</td>
			<td>Steve Rozen &#38; Helen Skaletsky</td>
			<td>non-commercial</td>
			<td>http://biotools.umassmed.edu/bioapps/primer3_www.cgi</td>
		</tr>
		<tr>
			<td>Protease inhibitor tablets</td>
			<td>Roche</td>
			<td>11836170001</td>
			<td>cOmplete, Mini, EDTA-free. Use 1 tablet per 10 ml. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Protease inhibitor tablets</td>
			<td>Roche</td>
			<td>11873580001</td>
			<td>cOmplete, EDTA-free. Use 1 tablet per 50 ml. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>life technologies</td>
			<td>AM2548</td>
			<td>proteinase K solution (20 &#181;g/&#181;l). Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>RNase A</td>
			<td>life technologies</td>
			<td>12091-039</td>
			<td>RNase A (20 &#181;g/&#181;l). Store at room temperature.</td>
		</tr>
		<tr>
			<td>Rotator</td>
			<td>Stuart</td>
			<td>SB3</td>
			<td>Rotator SB3</td>
		</tr>
		<tr>
			<td>SAMtools (software)</td>
			<td>Li et al.</td>
			<td>non-commercial</td>
			<td>http://samtools.sourceforge.neta</td>
		</tr>
		<tr>
			<td>Solid phase reversible immobilisation beads</td>
			<td>Beckman Coulter</td>
			<td>A63882</td>
			<td>The Agencourt AMPure XP beads are used to minimise adaptor dimer contamination in ChIP-Seq libraries. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Sonicator 3000</td>
			<td>Misonix/Qsonica</td>
			<td>NA</td>
			<td>Newer models are now available. Q125, Q500 or Q700 are all suitable for shearing crosslinked chromatin.</td>
		</tr>
		<tr>
			<td>Sound enclosure</td>
			<td>Misonix/Qsonica</td>
			<td>NA</td>
			<td>optional: follow the manufacturer&#39;s recommendation to obtain the correct sound enclosure.</td>
		</tr>
		<tr>
			<td>Thermomixer</td>
			<td>eppendorf</td>
			<td>22670000</td>
			<td>Thermomixer for 24 x 1.5 mL tubes. Precise temperature control from 4 &#176;C above room temperature to 99 &#176;C.</td>
		</tr>
	</tbody>
</table>

genome-wide snapshot of chromatin regulators and states in xenopus embryos by chip-seq

The recruitment of chromatin regulators and the assignment of chromatin states to specific genomic loci are pivotal to cell fate decisions and tissue and organ formation during development. Determining the locations and levels of such chromatin features in vivo will provide valuable information about the spatio-temporal regulation of genomic elements, and will support aspirations to mimic embryonic tissue development in vitro. The most commonly used method for genome-wide and high-resolution profiling is chromatin immunoprecipitation followed by next-generation sequencing (ChIP-Seq). This protocol outlines how yolk-rich embryos such as those of the frog Xenopus can be processed for ChIP-Seq experiments, and it offers simple command lines for post-sequencing analysis. Because of the high efficiency with which the protocol extracts nuclei from formaldehyde-fixed tissue, the method allows easy upscaling to obtain enough ChIP material for genome-wide profiling. Our protocol has been used successfully to map various DNA-binding proteins such as transcription factors, signaling mediators, components of the transcription machinery, chromatin modifiers and post-translational histone modifications, and for this to be done at various stages of embryogenesis. Lastly, this protocol should be widely applicable to other model and non-model organisms as more and more genome assemblies become available.

프로토콜은 잘 실행되는 경우 여기 제시된 동등한 결과가 예상되는 사용 및 항체 칩 품질 등급 (설명 참조)이다. 이 프로토콜은 포름 알데히드 고정 아프리카 발톱 개구리의 배아에서 핵의 추출 및 초음파에 의한 염색질의 효율적인 전단 (그림 1A-C)를 할 수 있습니다. 전단 염색질은 주로 100 내지 1000 염기쌍의 범위 및 BP (도 1C) 300 내지 500 피킹 DNA 단편의 비대칭 분포를 나타낸다. 면역 DNA의 최소 50 페이지가 성공적으로 비슷한 크기의 DNA를 삽입 (그림 2A)와 인덱스 쌍 엔드 칩-SEQ 라이브러리를 만들기 위해 필요합니다. 도서관은 약 12​​0 bp의 electropherogram에서 볼 수 있습니다 어댑터 이량 체의 크게 결여해야한다. 시퀀싱 합성에 의한시 읽기 사전 처리는 게놈 (그림 2B, C)에 매핑됩니다. 성공적인 실험과에서 <em&gt; X. tropicalis 배아는 하나의 엔드의 일반적 50-70%는 최대한 두 불일치와 7.1의 게놈 어셈블리에 고유하게 매핑 할 수 있습니다 (40) 혈압 읽습니다. 입력 게놈에 걸쳐 매우 균일하게 정렬 읽는 동안, 칩의 정렬은 관심 염색질 기능의 측면 가닥 별 부화에 결과를 읽습니다. 조각을 모두 5 &#39;말단 (그림 2C) 25 서열 때문입니다. 평균 단편 크기에 방향을 읽는 정렬을 확장하는 것은 같은 전사 인자 바인딩 이벤트와 같은 하나의 크로 마틴 기능에 대한 정확한 프로파일을 생성합니다. IGV 또는 기타 호환 게놈 브라우저 시각화 할 때 이러한 DNA의 점유는 피크로 나타납니다. MACS 등 피크 발신자는 이들 피크 (도 3a)의 위치를 결정하기 위해 사용된다. 수십 결합 부위의 수천이 방법은 X에서 결정되었습니다 tropicalis 게놈 같은 VegT (26) T-상자 전사 인자에 대한. 칩 qPCR에의 체험관사항 칩-SEQ (그림 3B)에 의해 발견 된 지역 농축을 확인해야합니다. 칩 서열 번호 실험 염색질 기능의 게놈 전체의 특성을 탐구 할 수 있습니다. 예를 들어, 전사 개시 및 종결 부위로 게놈 요소를 판독 분포를 산출하는 임의의 유전자 주위 공간 결합 선호도 (도 3c)를 강조 할 수있다. 마찬가지로, 피크 위치에서 읽기 분포의 히트 맵은 게놈 전체 규모 (그림 3D)에서 다른 염색질 기능을 비교하는 데 사용됩니다. 특정 전사 인자는 잠재적 인 공동 요인 (그림 3E)의 공동 풍부한 주제를 포함하여 이러한 종류의 정보를 검색 할 수 있습니다 게놈 DNA 기본 피크의 DNA 서열 특히. 드 노보 모티브 분석을 결합한다. 표적 유전자의 대다수는 DNA의 하부에 점유보다는 더 높은 레벨 (도 3f)를 도시한다. 이 규모없는 기능은 그럴 사이에서 매우 일반적인 것 같다anscription 인자와 표적 유전자의 작은 부분을 직접 생물학적 관련성 27,28으로 조절되는 것을 제시한다. 이러한 추가 Xenopus의 배아 (그림 3G)에서 염색질 기능의 생물학적 기능에 대한 통찰력을 공개 할 수있다 표적 유전자의 발현 차이 등 풍부한 GO의 조건이나 다른 속성의 분석. <img alt="그림 1" src="/files/ftp_upload/52535/52535fig1highres.jpg" /> 아프리카 발톱 개구리의 배아 1. 염색질 면역 침전 과정을 그림. (A) 배아 포름 알데히드 고정 공유 바인드 (가교)에 관심 게놈 DNA와 관련된 단백질의 발달 단계에있다. 핵 추출 (B)시, 가교 염색질 바인딩 게놈 DNA 또는 측면에서는 DN을 최소화하여 염색질 변형 사이트를 좁힐 조각난시퀀스 (C). 그 후, 염색질 조각은이자 (D)의 에피토프를 포함하는 사람들을 풍요롭게 칩 수준의 항체와 면역 있습니다. 공동 면역 DNA가 단백질을 제거하고 NGS (그림 2)의 칩 조각 라이브러리를 작성하기 전에 (E)를 정제한다. <a href="https://www.jove.com/files/ftp_upload/52535/52535fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/52535/52535fig2highres.jpg" /> 그림 2. 칩 서열 번호 라이브러리 준비, 시퀀싱 합성에 의한, 매핑 및 피크를 호출합니다. (A) electropherogram는 250 bp의 450의 DNA 템플릿과 좋은 칩 서열 번호 라이브러리를 표시합니다. 이러한 템플릿은 보편적 (58 BP)에 의해 형벌 관심의 DNA 삽입 및 인덱스 (63 BP) 어댑터를 수반한다. (B) </동일한 템플릿을 포함하는 각 클러스터와 클러스터의 강한&gt; 수백만, 가역, 독특한 형광과 동일한 종료 속성을 가진 네 개의 뉴클레오티드의 존재에 기초하여 시퀀스 기본이다. 형광 이미지 읽기에 궁극적으로 조립 해당 기지를, 전화를 실시간으로 처리됩니다. (C)는 만 유일하게 아프리카 발톱 개구리의 게놈지도가 유지되는 것을 읽습니다. 모든 단편은 5 &#39;말단으로부터 순서가되기 때문에, 칩의 매핑은 관심 염색질 기능의 측면 가닥 특정 피크의 결과를 판독한다. 이에 따라, 피크 호출자가 정확하게 크로 마틴 기능을 현지화 평균 조각 길이로 읽어 면역에서 유래하고 확장 농축을 감지합니다. <a href="https://www.jove.com/files/ftp_upload/52535/52535fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img aLT = &quot;그림 3&quot;SRC = &quot;/ 파일 / ftp_upload / 52535 / 52535fig3highres.jpg&quot;/&gt; 그림 3. 접합체의 T-상자 전사 인자 VegT (zVegT). 모두 여기에 표시된 수가 10 만명 정규화 읽어 고유 매핑과 비 중복이 읽습니다. (A) 발췌에 의한 후 염기 서열 분석 및 데이터 시각화의 예 zVegT의 게놈 전체 프로필 X에서 바인딩 (Nieuwkoop 및 페이버 (29) 후 12.5로 무대 11) tropicalis 낭배 배아. 각 피크, 확장 된 읽기의 더미 업, 하나의 결합 부위를 나타냅니다. 이들 피크는 1 % 미만의 오류 발견 레이트 (FDR)와 MACS2 의해 호출된다. 각 mesp 유전자 바인딩 매우 인접 상류 zVegT를 보여줍니다,하지만 mespa 및 mespb는 그 단계 (RNA-SEQ 데이터 30)에 의해 표현된다. (B) zVegT의 DNA 점유율 수준 여러 유전자 ​​좌에서 칩 qPCR에 의해 결정 (비 포함 KB 상류 β 액틴의 -bound 지역 0.5) 확인 합니칩 서열 번호에 의해 발견 된 특정 농축을 RM은. (A)에서 (빨간색 막대)라고 피크 mespa에 대한 결과를 비교한다. DNA 점유 레벨은 모두 입력의 비율, VegT 항체 (IgG의 이소 타입의 토끼 폴리 클로 날) 및 항체 제어 (정상 토끼의 IgG)와 칩 (Chip) 칩으로 보여집니다. 오차 막대는 두 개의 생물학적 반복 실험의 표준 편차를 반영한다. (C) Metagene 분석 주위에 다른 게놈 영역 및 유전자 기관 내 프로모터 상대에 바인딩 우선 zVegT을 (태그 25 bp의 이상 비닝)를 보여줍니다. (D)는 히트 맵은 K-평균을 보여줍니다 클러스터 (K = 5) DNA 점유율 수준 낭배 단계에서 모든 zVegT 바인딩 지역에 zVegT과 된 Smad2 /의 Smad3 (칩 서열 번호 데이터 31) 상대의 (태그는 25 bp의 이상 비닝). 히트 맵은 드 노보 모티브 분석 zVegT-의 38 %에 결합 모티프 정식 T-상자 전사 인자를 발견 2 기반 BP 당 5 태그를 중심으로. (E) 로그입니다기본 모티브 스코어 배경 서열에서 5 %의 비율로 발견 정규화 경우 결합 영역. 정식 된 Smad2 / Smad3이 결합 모티프가 거의 농축되지 않은 반면, 밀도지도, zVegT 결합 부위의 중앙에 T-상자 모티브 가장 높은 농축을 보여줍니다. (F) 히스토그램은 각 표적 유전자에 대해 계산된다 zVegT의 DNA 점유율 수준을 보여줍니다 [-] 모든 피크 (+/- 200 BP) 5킬로바이트 상류 사이에서. 전사 시작 사이트를 대응하고 1킬로바이트 하류 [+] (G) 가장 높은 DNA 점유율 내 -5 킬로바이트 수준과 1킬로바이트 아르와 최고 300 유전자 초기 배아 발달의 생물학적 과정에 대한 풍부. 이 용어가 zVegT의 추정 함수와 함께 줄에 이동합니다. FDR은 양측 피셔의 정확한 테스트를 기반으로 여러 테스트를 위해 수정됩니다. <a href="https://www.jove.com/files/ftp_upload/52535/52535fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq at JoVE.com

Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

방법 염색질 규제 및 염색질 상태의 문제는 생체 내에서 유전자가 세포 운명 결정이 배아에서 어떻게 만들어 지는지 초기에 대한 우리의 이해의 열쇠입니다 영향을 미칩니다. 칩 서열 번호 - 글로벌 수준입니다 Xenopus의 배아 여기 설명에서 크로 마틴의 기능을 조사하기 가장 인기있는 방법.

염색질 레귤레이터 및 미국에서의 게놈 전체의 스냅 샷<em&gt; 아프리카 발톱 개구리</em칩 서열 번호&gt; 태아

The recruitment of chromatin regulators and the assignment of chromatin states to specific genomic loci are pivotal to cell fate decisions and tissue and ...

Research

JoVE Journal

Developmental Biology

Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

Manipulation and In Vitro Maturation of Xenopus laevis Oocytes, Followed by Intracytoplasmic Sperm Injection, to Study Embryonic Development

Manipulation and In Vitro Maturation of Xenopus laevis Oocytes, Followed by Intracytoplasmic Sperm Injection, to Study Embryonic Development

조작 및<em&gt; 체외</em의&gt; 성숙<em&gt; 아프리카 발톱 개구리 laevis의</em세포질 내 정자 주입에 이어&gt; 난 모세포, 배아 발달을 연구하는

Amphibian eggs have been widely used to study embryonic development. Early embryonic development is driven by maternally stored factors accumulated during ...

연구

발생학

Accurate and Phenol Free DNA Sexing of Day 30 Porcine Embryos by PCR

PCR에 의한 날 (30) 돼지 배아의 정확하고 페놀 무료 DNA Sexing

Research into prenatal programming in the pig has shown that the sex of the developing embryo or fetus can influence the developmental outcome. Therefore, ...

Technique to Target Microinjection to the Developing Xenopus Kidney

Technique to Target Microinjection to the Developing Xenopus Kidney

개발에 미세 주입을 대상으로 기술<em&gt; Xenopus의</em&gt; 신장

The embryonic kidney of Xenopus&#160;laevis (frog), the pronephros, consists of a single nephron, and can be used as a model for kidney disease. Xenopus ...

Generation of Parabiotic Zebrafish Embryos by Surgical Fusion of Developing Blastulae

Blastulae 개발의 외과 융합에 의해 Parabiotic 제브라 피쉬 배아의 생성

Surgical parabiosis of two animals of different genetic backgrounds creates a unique scenario to study cell-intrinsic versus cell-extrinsic roles for ...

Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the ...

Visualization and Quantitative Analysis of Embryonic Angiogenesis in Xenopus tropicalis

Visualization and Quantitative Analysis of Embryonic Angiogenesis in Xenopus tropicalis

의 배아 혈관 신생에 대한 시각화 및 정량 분석<em&gt; Xenopus tropicalis</em

Blood vessels supply oxygen and nutrients throughout the body, and the formation of the vascular network is under tight developmental control. The ...

Induction of Hypoxia in Living Frog and Zebrafish Embryos

살아있는 개구리와 Zebrafish 태아의 저산소증 유도

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and ...

CARIP-Seq and ChIP-Seq: Methods to Identify Chromatin-Associated RNAs and Protein-DNA Interactions in Embryonic Stem Cells

CARIP-Seq와 칩 Seq: Chromatin 관련 된 RNAs 및 배아 줄기 세포에 단백질 DNA 상호 작용을 식별 하는 방법

Embryonic stem (ES) cell self-renewal&#160;and differentiation is governed by extrinsic signals and intrinsic networks of transcription factors, ...

Visualizing the Node and Notochordal Plate In Gastrulating Mouse Embryos Using Scanning Electron Microscopy and Whole Mount Immunofluorescence

노드 및 스캐닝 전자 현미경 검사 법, 면역 형광 산 전체를 사용 하 여 Gastrulating 마우스 배아에서 Notochordal 접시를 시각화

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is ...

Microinjection of DNA into Eyebuds in Xenopus laevis Embryos and Imaging of GFP Expressing Optic Axonal Arbors in Intact, Living Xenopus Tadpoles

Microinjection of DNA into Eyebuds in Xenopus laevis Embryos and Imaging of GFP Expressing Optic Axonal Arbors in Intact, Living Xenopus Tadpoles

제노푸스 laevis 배아에서 눈부안으로 DNA의 미세 주입 및 GFP의 이미징 그대로 광학 축색 아버를 표현, 살아있는 제노푸스 올챙이

The primary visual projection of tadpoles of the aquatic frog Xenopus laevis serves as an excellent model system for studying mechanisms that regulate the ...