Name: genome-wide snapshot of chromatin regulators and states in xenopus embryos by chip-seq
Uploaded: 2015-02-26T13:00:00
Duration: 10 min 23 s
Description: Watch this Scientific Journal Video about Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq at JoVE.com

We thank Chris Benner for implementing the X. tropicalis genome (xenTro2, xenTro2r) into HOMER and the Gilchrist lab for discussions on post-sequencing analysis. I.P. assisted the GO term analysis. G.E.G and J.C.S. were supported by the Wellcome Trust and are now supported by the Medical Research Council (program number U117597140).

<ol>
	<li>Gilmour, D. S., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detecting+protein-DNA+interactions+in+vivo:+distribution+of+RNA+polymerase+on+specific+bacterial+genes.">Detecting protein-DNA interactions in vivo: distribution of RNA polymerase on specific bacterial genes.</a> Proc Natl Acad Sci U S A. 81 (14), 4275-4279 (1984).</li><li>Gilmour, D. S., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+interactions+of+RNA+polymerase+II+with+genes+of+Drosophila+melanogaster.">In vivo interactions of RNA polymerase II with genes of Drosophila melanogaster.</a> Mol Cell Biol. 5 (8), 2009-2018 (1985).</li><li>Solomon, M. J., Larsen, P. L., Varshavsky, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+protein-DNA+interactions+in+vivo+with+formaldehyde:+evidence+that+histone+H4+is+retained+on+a+highly+transcribed+gene.">Mapping protein-DNA interactions in vivo with formaldehyde: evidence that histone H4 is retained on a highly transcribed gene.</a> Cell. 53 (6), 937-947 (1988).</li><li>Ren, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+location+and+function+of+DNA+binding+proteins.">Genome-wide location and function of DNA binding proteins.</a> Science. 290 (5500), 2306-2309 (2000).</li><li>Johnson, D., Mortazavi, A., Myers, R., Wold, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+mapping+of+in+vivo+protein-DNA+interactions.">Genome-wide mapping of in vivo protein-DNA interactions.</a> Science. 316 (5830), 1497-1502 (2007).</li><li>Hellsten, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genome+of+the+Western+clawed+frog+Xenopus+tropicalis.">The genome of the Western clawed frog Xenopus tropicalis.</a> Science. 328 (5978), 633-636 (2010).</li><li>Lee, T. I., Johnstone, S. E., Young, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+and+microarray-based+analysis+of+protein+location.">Chromatin immunoprecipitation and microarray-based analysis of protein location.</a> Nature Protocols. 1 (2), 729-748 (2006).</li><li>Blythe, S. A., Reid, C. D., Kessler, D. S., Klein, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+in+early+Xenopus+laevis+embryos.">Chromatin immunoprecipitation in early Xenopus laevis embryos.</a> Dev Dyn. 238 (6), 1422-1432 (2009).</li><li>Gentsch, G. E., Smith, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+physical+chromatin+associations+across+the+Xenopus+genome+by+chromatin+immunoprecipitation.">Investigating physical chromatin associations across the Xenopus genome by chromatin immunoprecipitation.</a> Cold Spring Harb Protoc. 2014 (5), (2014).</li><li>Ubbels, G. A., Hara, K., Koster, C. H., Kirschner, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+a+functional+role+of+the+cytoskeleton+in+determination+of+the+dorsoventral+axis+in+Xenopus+laevis+eggs.">Evidence for a functional role of the cytoskeleton in determination of the dorsoventral axis in Xenopus laevis eggs.</a> J Embryol Exp Morphol. 77, 15-37 (1983).</li><li>Langmead, B., Trapnell, C., Pop, M., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrafast+and+memory-efficient+alignment+of+short+DNA+sequences+to+the+human+genome.">Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.</a> Genome Biol. 10 (3), R25 (2009).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Heinz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+combinations+of+lineage-determining+transcription+factors+prime+cis-regulatory+elements+required+for+macrophage+and+B+cell+identities.">Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities.</a> Mol Cell. 38 (4), 576-589 (2010).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+analysis+of+ChIP-Seq+(MACS).">Model-based analysis of ChIP-Seq (MACS).</a> Genome Biol. 9 (9), R137 (2008).</li><li>Robinson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomics+viewer.">Integrative genomics viewer.</a> Nat Biotechnol. 29 (1), 24-26 (2011).</li><li>Thorvaldsdottir, H., Robinson, J. T., Mesirov, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+Genomics+Viewer+(IGV):+high-performance+genomics+data+visualization+and+exploration.">Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration.</a> Brief Bioinform. 14 (2), 178-192 (2013).</li><li>Imoto, S., Nolan, J., Bioinformatics Miyano, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> 20 (9), 1453-1454 (2004).</li><li>Camacho, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BLAST+:+architecture+and+applications.">BLAST+: architecture and applications.</a> BMC Bioinformatics. 10, 421 (2009).</li><li>Conesa, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blast2GO:+a+universal+tool+for+annotation,+visualization+and+analysis+in+functional+genomics+research.">Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research.</a> Bioinformatics. 21 (18), 3674-3676 (2005).</li><li>Sive, H., Grainger, R., Harland, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Early development of Xenopus laevis: A laboratory manual. , (2000).</li><li>Chen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+evaluation+of+factors+influencing+ChIP-seq+fidelity.">Systematic evaluation of factors influencing ChIP-seq fidelity.</a> Nat Methods. 9 (6), 609-614 (2012).</li><li>Sharov, A. A., Ko, M. S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exhaustive+search+for+over-represented+DNA+sequence+motifs+with+CisFinder.">Exhaustive search for over-represented DNA sequence motifs with CisFinder.</a> DNA Res. 16 (5), 261-273 (2009).</li><li>Bailey, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MEME+SUITE:+tools+for+motif+discovery+and+searching.">MEME SUITE: tools for motif discovery and searching.</a> Nucl Acids Res. 37 (2), W202-W208 (2009).</li><li>Livak, K. J., Schmittgen, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+relative+gene+expression+data+using+real-time+quantitative+PCR+and+the+2(-Delta+Delta+C(T))+Method.">Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.</a> Methods. 25 (4), 402-408 (2001).</li><li>Park, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq:+advantages+and+challenges+of+a+maturing+technology.">ChIP-seq: advantages and challenges of a maturing technology.</a> Nat Rev Genet. 10 (10), 669-680 (2009).</li><li>Gentsch, G. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+T-box+transcription+factor+profiling+reveals+joint+regulation+of+embryonic+neuromesodermal+bipotency.">In vivo T-box transcription factor profiling reveals joint regulation of embryonic neuromesodermal bipotency.</a> Cell Rep. 4 (6), 1185-1196 (2013).</li><li>Barabasi, A. L., Oltvai, Z. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Network+biology:+understanding+the+cell's+functional+organization.">Network biology: understanding the cell's functional organization.</a> Nat Rev Genet. 5 (2), 101-113 (2004).</li><li>Biggin, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+transcription+networks+as+highly+connected,+quantitative+continua.">Animal transcription networks as highly connected, quantitative continua.</a> Dev Cell. 21 (4), 611-626 (2011).</li><li>Nieuwkoop, P. D., Faber, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Normal table of Xenopus laevis (Daudin): a systematical and chronological survey of the development from the fertilized egg till the end of metamorphosis. , (1994).</li><li>Akkers, R. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+hierarchy+of+H3K4me3+and+H3K27me3+acquisition+in+spatial+gene+regulation+in+Xenopus+embryos.">A hierarchy of H3K4me3 and H3K27me3 acquisition in spatial gene regulation in Xenopus embryos.</a> Dev Cell. 17 (3), 425-434 (2009).</li><li>Yoon, S. J., Wills, A. E., Chuong, E., Gupta, R., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> HEB and E2A function as SMAD/FOXH1 cofactors. Genes Dev. 25 (15), 1654-1661 (2011).</li><li>Jallow, Z., Jacobi, U. G., Weeks, D. L., Dawid, I. B., Veenstra, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specialized+and+redundant+roles+of+TBP+and+a+vertebrate-specific+TBP+paralog+in+embryonic+gene+regulation+in+Xenopus.">Specialized and redundant roles of TBP and a vertebrate-specific TBP paralog in embryonic gene regulation in Xenopus.</a> Proc Natl Acad Sci U S A. 101 (37), 13525 (2004).</li><li>Buchholz, D. R., Paul, B. D., Shi, Y. -. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene-specific+changes+in+promoter+occupancy+by+thyroid+hormone+receptor+during+frog+metamorphosis.+Implications+for+developmental+gene+regulation.">Gene-specific changes in promoter occupancy by thyroid hormone receptor during frog metamorphosis. Implications for developmental gene regulation.</a> J Biol Chem. 280 (50), 41222-41228 (2005).</li><li>Wills, A. E., Guptaa, R., Chuonga, E., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+and+deep+sequencing+in+Xenopus+tropicalis+and+Xenopus+laevis.">Chromatin immunoprecipitation and deep sequencing in Xenopus tropicalis and Xenopus laevis.</a> Methods. 66 (3), 410-421 (2014).</li><li>Metz, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+formaldehyde-induced+modifications+in+proteins:+reactions+with+model+peptides.">Identification of formaldehyde-induced modifications in proteins: reactions with model peptides.</a> J Biol Chem. 279 (8), 6235-6243 (2004).</li><li>Landt, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+guidelines+and+practices+of+the+ENCODE+and+modENCODE+consortia.">ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.</a> Genome Res. 22 (9), 1813-1831 (2012).</li><li>Mazzoni, E. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell-based+mapping+of+developmental+transcriptional+programs.">Embryonic stem cell-based mapping of developmental transcriptional programs.</a> Nat Methods. 8 (12), 1056-1058 (2011).</li><li>Deal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+method+for+gene+expression+and+chromatin+profiling+of+individual+cell+types+within+a+tissue.">A simple method for gene expression and chromatin profiling of individual cell types within a tissue.</a> Dev Cell. 18 (6), 1030-1040 (2010).</li><li>Bonn, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue-specific+analysis+of+chromatin+state+identifies+temporal+signatures+of+enhancer+activity+during+embryonic+development.">Tissue-specific analysis of chromatin state identifies temporal signatures of enhancer activity during embryonic development.</a> Nat Genet. 44 (2), 148-156 (2012).</li></ol>

The authors declare that they have no competing financial interests.

Bizim protokol yapmak ve Xenopus embriyolar genom kromatin profillerini analiz nasıl özetliyor. Bu silico zenginleştirilmiş genomik siteleri temsil okur milyonlarca işlem, in vivo olarak, endojen mahallere çapraz bağlama proteinlerinden her adımı kapsar. Genom taslaklarının artan sayıda mevcut olduğundan, bu protokol diğer model olan ve olmayan model organizmalar için geçerli olmalıdır. Önceki çalışma 8,31,33,34 dışında bu protokol belirler en önemli deney bölümünde, çapraz-bağlanmış çekirdekleri elde etmek sonrası tespit işlemdir. Verimli kromatin çözünmesini ve kesme ve kolay upscaling kolaylaştırır. Birlikte kütüphane hazırlık geliştirilmiş verimlilik ile bu protokol yarısından itibaren faiz kromatin-ilişkili epitopu ifade iki milyona hücrelerine yüksek karmaşıklık ChIP-Seq kütüphaneler yapıyı sağlar. ChIP-QPCR deneyler için, bu hücrelerin birkaç on bin normal olarak yeterlibelki altı farklı genomik DNA loci zenginleştirme kontrol etmek için. Bu numaralar tahminlerdir, ancak protein ifadesi seviyesi, antikor kalitesine bağlı olarak etkinliği ve epitop ulaşmak çapraz bağlama olarak değişiklik gösterebilir. Bir rehber olarak, tek bir Xenopus embriyo orta Blastula aşama (Nieuwkoop ve Faber 29 den sonra 8.5) yaklaşık 4000 hücreleri içeren geç gastrula aşama (12) de 40,000 hücre ve erken tailbud aşama (20) de 100.000 hücre. etkin immüno-çökeltme için kesin sabitleme süresi ChIP-qPCR (bölüm 10) tarafından empirik olarak tespit edilmesi gerekmektedir. Deney X içeriyorsa Genel olarak, uzun tespit süreleri gereklidir embriyolar, erken gelişim aşamalarını ve zayıf (ya da dolaylı) DNA bağlama özelliklerini laevis. Bununla birlikte, kromatin kesme daha az etkili hale gelir, 40 dakikadan daha uzun bir Xenopus embriyolar sabitleme ya da belirtilmedikçe, (bölüm 3) daha fazla embriyolar işlem tavsiye edilmez. Bu önemli değildirçok zor sarısı zengin embriyolardan nükleer çıkarma yapabilir formaldehit söndürülmesi için bu ortak adım olarak tespit sonrasında herhangi bir glisin kullanmak için. Şu anda, bunun nedeni bilinmemektedir. Formaldehit-glisin ilave maddesi, ayrıca aşağıdaki amino grupları ya da arginin artığını 35 N-terminali ile reaksiyona düşünülebilir. Antikor herhangi bir çip deney anahtarıdır ve yeteri kadar kontrol (Landt ve ark. 36 ile kılavuza bakınız) ilgi epitopu için spesifikliğini göstermek amacıyla gerekmektedir. Hiçbir ChIP dereceli antikor varsa bu proteinler işgal endojen bağlayıcı siteleri 37 gibi, epitop füzyon proteinleri karşılık gelen giriş meşru bir alternatif olabilir. Bu durumda, enjeksiyon yapılmamış embriyolar bir negatif kontrol yerine non-spesifik serum ile bir çip olarak kullanmak en iyisidir. İlgi dahilindeki protein Enri zayıf kazanımı ile sonuçlanan, düşük seviyelerde ifade edilir, bu strateji de tatbik edilebilirched DNA. Çünkü kullanımda DNA düşük miktarda ChIP-Seq kütüphaneler, yapım gelince, bu temizlik adımların sayısını azaltmak ve en azından DNA kaybı tutmak tepkileri birleştirmek işlemleri için tercih edilmesi önerilir. adaptörleri ve primerler (Belirli Malzemeleri / Ekipman Tabloya bakınız) multipleks sıralama ve NGS platformu ile uyumlu olması gerekir. (Uzun tek sarmallı silah içeren) Y-adaptörler kullanarak, bu boyut seçerek DNA ekler önce PCR 3-5 mermi ile ön yükseltmek kütüphane için kritik (örn., 100 bp 300) jel elektroforezi ile. Tek iplikli uçları, DNA fragmanları, heterojen geçirilecek neden olur. Deneme PCR döngüsü sayısını belirlemek için tavsiye edilir giriş DNA (örneğin, 0.1, 0.5, 1, 2, 5, 10 ve 20 ng) farklı miktarlarda (daha az veya 18 döngü eşit) bir boyuta getirmek için gerekli olan 100 ila 200 ng -seçilmiş kütüphanesi. PCR döngü sayısını azaltmak Redu sekanslanmasını vermektedirndant daha az olasıdır okur. Katı faz geri dönüşümlü immobilizasyon boncuklar verimli ilgi DNA kurtarmak ve güvenilir ligasyon ve PCR reaksiyonları herhangi bir serbest adaptörleri ve dimerlerini kaldırmak için reaktifler temizlik iyi. Sayı, tip ve uzunluk açısından civarında 20-30.000.000 tek uç 36 bp yeterli derinliğe sahip tüm Xenopus genomunu kapsayacak şekilde en ChIP-Seq deneyler için yeterli okur, okur. En yaygın NGS makineleri bu kriterleri karşılama rutin yeteneğine sahiptir. Bununla birlikte, okuma geniş bir dağılımı beklenen ise okur oldukça keskin yükselme daha histon modifikasyonları ile gözlemlendiği üzere, sayısını artırmak için yararlı olabilir. Birçok ChIP-Dizi deneyler için, 4-5 farklı dizin kütüphaneleri birleştirilebiliyor ve yüksek performanslı NGS makinesi kullanılarak bir akış hücresi şeritte dizilenmiştir. Bazen w mappability artırmak için okuma uzunluğu ve diziyi DNA örneğinin iki ucu (paired-end) genişletmek için de tavsiye edilirtekrarlayan genomik bölgelerde kromatin tavuk analiz. Bu protokol, kopyalama faktörleri, bu sinyal aracı ve post-translasyonel modifikasyonları histon olarak kromatin özelliğin çok çeşitli başarı ile uygulanmıştır. Onlar geliştirmek ve kromatin profilleri yorumlamak zor hale Ancak, embriyolar hücresel heterojenite artan derecesi elde. Ümitli adımlar hücre tipine özgü çekirdek 38,39 ayıklanması doku-spesifik profil kromatin manzara Arabidopsis ve Drosophila yapılmıştır. Bizim protokol, diğer embriyolar doku-spesifik ChIP-Sek için önünü açabilecek bir nükleer çıkarma adımı içerir.

The first attempts to characterize protein-DNA interactions in vivo were reported about 30 years ago in an effort to understand RNA polymerase-mediated gene transcription in bacteria and in the fruit fly1,2. Since then, the use of immunoprecipitation to enrich distinct chromatin features (ChIP) has been widely adopted to capture binding events and chromatin states with high efficiency3. Subsequently, with the emergence of powerful microarray technologies, this method led to the characterization of genome-wide chromatin landscapes4. More recently, chromatin profiling has become even more comprehensive and high-resolution, because millions of co-immunoprecipitated DNA templates can now be sequenced in parallel and mapped to the genome (ChIP-Seq)5. As increasing numbers of genome assemblies are available, ChIP-Seq is an attractive approach to learn more about the genome regulation that underlies biological processes. 
Here we provide a protocol to perform ChIP-Seq on yolk-rich embryos such as those of the frog Xenopus. Drafts of the genomes of both widely used Xenopus species&#8212;X. tropicalis and X. laevis&#8212;have now been released by the International Xenopus Genome Consortium6. The embryos of Xenopus species share many desirable features that facilitate and allow the interpretation of genome-wide chromatin studies, including the production of large numbers of high-quality embryos, the large size of the embryos themselves, and their external development. In addition, the embryos are amenable to classic and novel manipulations like cell lineage tracing, whole-mount in situ hybridisation, RNA overexpression, and TALEN/CRISPR-mediated knockout technology.
The following protocol builds on the work of Lee et al., Blythe et al. and Gentsch et al.7-9. Briefly, Xenopus embryos are formaldehyde-fixed at the developmental stage of interest to covalently bind (cross-link) proteins to their associated genomic DNA. After nuclear extraction, cross-linked chromatin is fragmented to focus subsequent sequencing on specific genomic binding or modification sites, and to minimize the contributions of flanking DNA sequences. Subsequently, the chromatin fragments are immunoprecipitated with a ChIP-grade antibody to enrich those containing the protein of interest. The co-immunoprecipitated DNA is stripped from the protein and purified before creating an indexed (paired-end) library for next-generation sequencing (NGS). At the end, simple command lines are offered for the post-sequencing analysis of ChIP-Seq data.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>1/16 inch tapered microtip</td>
			<td>Qsonica</td>
			<td>4417</td>
			<td>This microtip is compatible with Sonicator 3000 from Misonix and Q500/700 from Qsonica.</td>
		</tr>
		<tr>
			<td>8 ml glass sample vial with cap</td>
			<td>Wheaton</td>
			<td>224884</td>
			<td>8 ml clear glass sample vials for aqueous samples with 15-425 size phenolic rubber-lined screw caps.</td>
		</tr>
		<tr>
			<td>Adaptor</td>
			<td>IDT or Sigma</td>
			<td>NA</td>
			<td>TruSeq universal adaptor, 
AATGATACGGCGACCACCGAG 
ATCTACACTCTTTCCCTACAC 
GACGCTCTTCCGATC*T. TruSeq indexed adaptor, 
P-GATCGGAAGAGCACACGTC 
TGAACTCCAGTCAC &#8208;NNNNNN&#8208; 
ATCTCGTATGCCGTCT TCTGCTT*G. *, phosphorothioate bondphosphate group at 5&#39; end. NNNNNN, index (see TruSeq ChIP Sample Preparation Guide for DNA sequence). Order adaptors HPLC purified. Adaptors can be prepared by combining equimolar amounts (each 100 &#181;M) of the universal and the indexed adaptor and cooling them down slowly from 95 &#176;C to room temperature. Use 1.5 pmol per ng of input DNA. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>b2g4pipe (software)</td>
			<td>Blast2GO</td>
			<td>non-commercial</td>
			<td>http://www.blast2go.com/data/blast2go/b2g4pipe_v2.5.zip</td>
		</tr>
		<tr>
			<td>BLAST+ (software)</td>
			<td>Camacho et al.</td>
			<td>non-commercial</td>
			<td>http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastDocs&#38;DOC_TYPE=Download</td>
		</tr>
		<tr>
			<td>Bowtie (software)</td>
			<td>Langmead et al.</td>
			<td>non-commercial</td>
			<td>http://bowtie-bio.sourceforge.net/index.shtml</td>
		</tr>
		<tr>
			<td>cisFinder (software)</td>
			<td>Sharov et al.</td>
			<td>non-commercial</td>
			<td>http://lgsun.grc.nia.nih.gov/CisFinder/</td>
		</tr>
		<tr>
			<td>Chip for capillary electrophoresis</td>
			<td>Agilent Technologies</td>
			<td>5067-1504</td>
			<td>Load this chip with 1 &#181;l DNA for library quality control. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Chip-based capillary electrophoresis system</td>
			<td>Agilent Technologies</td>
			<td>G2940CA</td>
			<td>The Agilent 2100 BioAnalyzer is used to check the quality of ChIP-Seq libraries. Keep reagents at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>ChIP-Seq library preparation kit (KAPA Hyper Prep Kit)</td>
			<td>Kapa Biosystems</td>
			<td>KK8504</td>
			<td>Kit contains KAPA end repair and A-tailing enzyme mix, end Repair and A-tailing buffer, DNA ligase, ligation buffer, KAPA HiFi HotStart ReadyMix (2X), and KAPA library amplification primer mix (10X) (see also PCR primers). Adaptors are not included. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>ChIP-Seq library preparation kit (alternative, ThruPLEX-FD Prep Kit)</td>
			<td>Rubicon Genomics</td>
			<td>R40048</td>
			<td>Kit uses their own stem-loop adaptors and primers. This kit eliminates intermediate purification steps and is as sensitive as the KAPA Hyper Prep Kit. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Cluster3 (software)</td>
			<td>de Hoon et al.</td>
			<td>non-commercial</td>
			<td>http://bonsai.hgc.jp/~mdehoon/software/cluster</td>
		</tr>
		<tr>
			<td>FastQC (software)</td>
			<td>Simon Andrews</td>
			<td>non-commercial</td>
			<td>http://www.bioinformatics.babraham.ac.uk/projects/fastqc</td>
		</tr>
		<tr>
			<td>Fluorometer</td>
			<td>life technologies</td>
			<td>Q32866</td>
			<td>Qubit 2.0 Fluorometer</td>
		</tr>
		<tr>
			<td>Fluorometer reagents</td>
			<td>life technologies</td>
			<td>Q32851</td>
			<td>The kit provides concentrated assay reagent, dilution buffer, and pre-diluted DNA standards for the Qubit fluorometer. Store DNA standards at 4 &#176;C, buffer and dye at room temperature.</td>
		</tr>
		<tr>
			<td>Formaldehyde</td>
			<td>Sigma</td>
			<td>F8775-4X25ML</td>
			<td>Formaldehyde solution, for molecular biology, 36.5-38% in H2O, stabilised with 10-15% methanol. Store at room temperature. CAUTION: Formaldehyde is corrosive and highly toxic.</td>
		</tr>
		<tr>
			<td>Gel (E-Gel EX agarose , 2%)</td>
			<td>life technologies</td>
			<td>G4010</td>
			<td>Pre-cast gel with 11 wells, openable format. Leave one lane between ladder and library empty to avoid cross-contamination. Store gels at room temperature.</td>
		</tr>
		<tr>
			<td>Gel electrophoresis system</td>
			<td>life technologies</td>
			<td>G6465</td>
			<td>E-Gel iBase and E-Gel Safe Imager combo kit for size-selecting ChIP-Seq libraries.</td>
		</tr>
		<tr>
			<td>Gel extraction kit</td>
			<td>Qiagen</td>
			<td>28706</td>
			<td>Store all reagents at room temperature. Use 500 &#181;l of QG buffer per 100 mg of 2% agarose gel slice to extract DNA. Use MinElute columns (from MinElute PCR purification kit) to elute DNA twice.</td>
		</tr>
		<tr>
			<td>HOMER (software)</td>
			<td>Chris Benner</td>
			<td>non-commercial</td>
			<td>http://homer.salk.edu/homer/index.html</td>
		</tr>
		<tr>
			<td>Hybridization oven</td>
			<td>Techne</td>
			<td>FHB1D</td>
			<td>Hybridizer HB-1D</td>
		</tr>
		<tr>
			<td>IGV (software)</td>
			<td>Robinson et al.</td>
			<td>non-commercial</td>
			<td>http://www.broadinstitute.org/igv/home</td>
		</tr>
		<tr>
			<td>Illumina CASAVA-1.8 quality filter (software)</td>
			<td>Assaf Gordon</td>
			<td>non-commercial</td>
			<td>http://cancan.cshl.edu/labmembers/gordon/fastq_illumina_filter</td>
		</tr>
		<tr>
			<td>Java TreeView (software)</td>
			<td>Alok Saldanha</td>
			<td>non-commercial</td>
			<td>http://jtreeview.sourceforge.net</td>
		</tr>
		<tr>
			<td>Laboratory jack</td>
			<td>Edu-Lab</td>
			<td>CH0642</td>
			<td>This jack is used to elevate sample in sound enclosure for sonication.</td>
		</tr>
		<tr>
			<td>Ladder, 100 bp</td>
			<td>New England BioLabs</td>
			<td>N3231</td>
			<td>Keep 1x solution at room temperature. Store stock at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Ladder, 1 kb</td>
			<td>New England BioLabs</td>
			<td>N3232</td>
			<td>Keep 1x solution at room temperature. Store stock at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Low-retention 1.5-ml microcentrifuge tubes</td>
			<td>life technologies</td>
			<td>AM12450</td>
			<td>nonstick, RNase-free microfuge tubes, 1.5 ml</td>
		</tr>
		<tr>
			<td>MACS2 (software)</td>
			<td>Tao Liu</td>
			<td>non-commercial</td>
			<td>https://github.com/taoliu/MACS</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>11201D</td>
			<td>These Dynabeads are superparamagnetic beads with affinity purified polyclonal sheep anti-mouse IgG covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>11203D</td>
			<td>These Dynabeads are superparamagnetic beads with affinity purified polyclonal sheep anti-rabbit IgG covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>10001D</td>
			<td>These Dynabeads are superparamagnetic beads with recombinant protein A covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>10003D</td>
			<td>These Dynabeads are superparamagnetic beads with recombinant protein G covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic rack</td>
			<td>life technologies</td>
			<td>12321D</td>
			<td>DynaMag-2 magnet</td>
		</tr>
		<tr>
			<td>MEME</td>
			<td>Bailey et al.</td>
			<td>non-commercial</td>
			<td>http://meme.nbcr.net/meme/</td>
		</tr>
		<tr>
			<td>Na3VO4</td>
			<td>New England BioLabs</td>
			<td>P0758</td>
			<td>Sodium orthovanadate (100 mM) is a commonly used general inhibitor for protein phosphotyrosyl phosphatases. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>NaF</td>
			<td>New England BioLabs</td>
			<td>P0759</td>
			<td>Sodium fluoride (500 mM) is commonly used as general inhibitor of phosphoseryl and phosphothreonyl phosphatases. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>NGS machine</td>
			<td>Illumina</td>
			<td>SY-301-1301</td>
			<td>Genome Analyzer IIx</td>
		</tr>
		<tr>
			<td>NGS machine (high performance)</td>
			<td>Illumina</td>
			<td>SY-401-2501</td>
			<td>HiSeq</td>
		</tr>
		<tr>
			<td>Normal serum (antibody control)</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-2028</td>
			<td>Use as control for goat polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Normal serum (antibody control)</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-2025</td>
			<td>Use as control for mouse polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Normal serum (antibody control)</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-2027</td>
			<td>Use as control for rabbit polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Nucleic acid staining solution</td>
			<td>iNtRON</td>
			<td>21141</td>
			<td>Use RedSafe nucleic acid staining solution at 1:50,000. Store at room temperature.</td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Sigma</td>
			<td>O3756-25G</td>
			<td>1-Phenylazo-2-naphthol-6,8-disulfonic acid disodium salt. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>PCR primers</td>
			<td>e.g., IDT or Sigma</td>
			<td>NA</td>
			<td>Primers to enrich adaptor-ligated DNA fragments by PCR: AATGATACGGCGACCACCGA*G and CAAGCAGAAGACGGCATACGA*G, phosphorothioate bond. Primers designed by Ethan Ford. Combine primers at 5 &#181;M each. Use 5 &#181;l in a 50 &#181;l PCR reaction. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>MinElute PCR purification kit&#160;</td>
			<td>Qiagen</td>
			<td>28006</td>
			<td>for purification of ChIP-qPCR and shearing test samples. Store MinElute spin columns at 4 &#176;C, all other buffers and collection tubes at room temperature.</td>
		</tr>
		<tr>
			<td>Phenol:chloroform:isoamyl alcohol (25:24:1, pH 7.9)</td>
			<td>life technologies</td>
			<td>AM9730</td>
			<td>Phenol:Chloroform:IAA (25:24:1) is premixed and supplied at pH 6.6. Use provided Tris alkaline buffer to raise pH to 7.9. Store at 4 &#176;C. CAUTION: phenol:chloroform:isoamyl alcohol is corrosive, highly toxic and combustible.</td>
		</tr>
		<tr>
			<td>Primer3 (software)</td>
			<td>Steve Rozen &#38; Helen Skaletsky</td>
			<td>non-commercial</td>
			<td>http://biotools.umassmed.edu/bioapps/primer3_www.cgi</td>
		</tr>
		<tr>
			<td>Protease inhibitor tablets</td>
			<td>Roche</td>
			<td>11836170001</td>
			<td>cOmplete, Mini, EDTA-free. Use 1 tablet per 10 ml. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Protease inhibitor tablets</td>
			<td>Roche</td>
			<td>11873580001</td>
			<td>cOmplete, EDTA-free. Use 1 tablet per 50 ml. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>life technologies</td>
			<td>AM2548</td>
			<td>proteinase K solution (20 &#181;g/&#181;l). Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>RNase A</td>
			<td>life technologies</td>
			<td>12091-039</td>
			<td>RNase A (20 &#181;g/&#181;l). Store at room temperature.</td>
		</tr>
		<tr>
			<td>Rotator</td>
			<td>Stuart</td>
			<td>SB3</td>
			<td>Rotator SB3</td>
		</tr>
		<tr>
			<td>SAMtools (software)</td>
			<td>Li et al.</td>
			<td>non-commercial</td>
			<td>http://samtools.sourceforge.neta</td>
		</tr>
		<tr>
			<td>Solid phase reversible immobilisation beads</td>
			<td>Beckman Coulter</td>
			<td>A63882</td>
			<td>The Agencourt AMPure XP beads are used to minimise adaptor dimer contamination in ChIP-Seq libraries. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Sonicator 3000</td>
			<td>Misonix/Qsonica</td>
			<td>NA</td>
			<td>Newer models are now available. Q125, Q500 or Q700 are all suitable for shearing crosslinked chromatin.</td>
		</tr>
		<tr>
			<td>Sound enclosure</td>
			<td>Misonix/Qsonica</td>
			<td>NA</td>
			<td>optional: follow the manufacturer&#39;s recommendation to obtain the correct sound enclosure.</td>
		</tr>
		<tr>
			<td>Thermomixer</td>
			<td>eppendorf</td>
			<td>22670000</td>
			<td>Thermomixer for 24 x 1.5 mL tubes. Precise temperature control from 4 &#176;C above room temperature to 99 &#176;C.</td>
		</tr>
	</tbody>
</table>

genome-wide snapshot of chromatin regulators and states in xenopus embryos by chip-seq

The recruitment of chromatin regulators and the assignment of chromatin states to specific genomic loci are pivotal to cell fate decisions and tissue and organ formation during development. Determining the locations and levels of such chromatin features in vivo will provide valuable information about the spatio-temporal regulation of genomic elements, and will support aspirations to mimic embryonic tissue development in vitro. The most commonly used method for genome-wide and high-resolution profiling is chromatin immunoprecipitation followed by next-generation sequencing (ChIP-Seq). This protocol outlines how yolk-rich embryos such as those of the frog Xenopus can be processed for ChIP-Seq experiments, and it offers simple command lines for post-sequencing analysis. Because of the high efficiency with which the protocol extracts nuclei from formaldehyde-fixed tissue, the method allows easy upscaling to obtain enough ChIP material for genome-wide profiling. Our protocol has been used successfully to map various DNA-binding proteins such as transcription factors, signaling mediators, components of the transcription machinery, chromatin modifiers and post-translational histone modifications, and for this to be done at various stages of embryogenesis. Lastly, this protocol should be widely applicable to other model and non-model organisms as more and more genome assemblies become available.

Protokol de idam eğer burada sunulan eşdeğer sonuçlar beklenmektedir ve kullanım antikor ChIP dereceli kalitesi (tartışma) biridir. Bu protokol formaldehit sabit Xenopus embriyolar çekirdeklerin çıkarma ve sonikasyon ile kromatin verimli kesme (Şekil 1A-C) izin verir. Kesilmiş kromatin esas olarak 100 ila 1000 bp arasında değişen ve bp (Şekil 1C) 300 ila 500 zirve DNA fragmanlarının asimetrik dağılımı gösterilmektedir. Çökeltilir DNA minimal 50 pg başarıyla benzer büyüklükteki DNA ekler (Şekil 2A) ile bir dizine eşleştirilmiş-uç ChIP-Sıra kütüphane yapmakla yükümlüdür. Kütüphane, yaklaşık 120 bp Elektroforegramda görülebilir adaptör dimerlerinin, büyük ölçüde yoksun olmalıdır. Sekanslama-sentez sırasında, okuma ön işlemden genom (Şekil 2B, C) ​​eşleştirilir. Başarılı bir deneyde In <em&gt; X. tropicalis embriyolar, tek sonu normalde 50 ila 70% maksimum iki uyumsuzlukları ile V7.1 genom düzeneğine benzersiz eşlenebilir 40 bp okur. Giriş genomu boyunca oldukça eşit hizaya okur iken, ChIP hizalama ilgi kromatin özelliğini kanadını iplikçik özgü zenginleşme sonuçları okur. Bütün parçalar 5 &#39;ucuna (Şekil 2C) 25 dizilenmiştir olmasıdır. Ortalama fragman büyüklüğü yön okuma uyum uzatılması gibi transkripsiyon faktörü bağlayıcı olaylar gibi tek kromatin özellikleri doğru profiller üretmektedir. IGV veya başka bir uyumlu genom tarayıcıda görüntülendi zaman bu DNA doluluk zirveleri olarak görünür. MACS gibi Tepe arayanlar bu zirveleri (Şekil 3A) konumunu belirlemek için kullanılır. Onlarca bağlayıcı sitelerin binlerce Bu şekilde X tespit edilmiştir tropicalis genom gibi vegt 26 gibi T-box transkripsiyon faktörleri. ChIP-qPCR deneyrından ChIP-Sek (Şekil 3B) tarafından bulundu yerel zenginleştirme teyit etmelidir. ChIP-Seq deneyler kromatin özellikleri genom özelliklerini keşfetmek izin. Örneğin, transkripsiyon başlangıç ​​ve sonlandırma siteleri gibi genomik elemanları üzerinde okuma dağılımı hesaplanırken genlerin etrafında herhangi bir mekansal bağlama tercihleri ​​(Şekil 3C) vurgulamak olabilir. Benzer şekilde, tepe yerlerde okuma dağıtımları bir heatmap bir genom ölçeğinde (Şekil 3D) farklı kromatin özelliklerini karşılaştırmak için kullanılır. Bazı transkripsiyon faktörleri potansiyel eş-faktörler (Şekil 3E) eş-zenginleştirilmiş motifler içeren bu tür bilgileri alabilirsiniz genomik DNA yatan zirveleri DNA dizisi-özellikle. De novo motifi analizini bağlamak. hedef genlerin büyük bir çoğunluğu DNA düşük doluluk ziyade yüksek düzeyde (Şekil 3F) gösterir. Bu ölçek serbest özelliği tr arasında oldukça yaygın gibi görünüyoranscription faktörleri ve hedef genlerin yalnızca küçük bir bölümünün doğrudan biyolojik uygunluğu 27,28 düzenlenmiştir olduğunu göstermektedir. Böyle daha Xenopus embriyo (Şekil 3G) kromatin özelliğinin biyolojik fonksiyonu anlayışlar ortaya çıkarabilir hedef genlerin diferansiyel ifadesi olarak zenginleştirilmiş GO açısından veya diğer niteliklerin analizi. <img alt="Şekil 1," src="/files/ftp_upload/52535/52535fig1highres.jpg" /> Xenopus embriyolar 1. Kromatin immüno-çökeltmesi prosedürü Şekil. (A) Embriyolar formaldehit-sabit kovalent bağlama (cross-link) ilgi genomik DNA ile ilişkili herhangi bir proteinlerin gelişimsel aşamadadır. Nükleer ekstraksiyon (B) üzerine, çapraz bağlı kromatin bağlayıcı genomik DNA veya yan DN minimize ederek kromatin modifikasyon siteleri daraltmak için parçalanmışBir dizi (° C). Daha sonra, kromatin fragmanları ilgi (D) epitop ihtiva eden ettirecek bir çip dereceli antikoru ile imüno-çökeltilir. ko-immunoprecipitated DNA protein sıyrıldı ve NGS (Şekil 2) için ChIP fragmanı kütüphane oluşturmadan önce (E) arıtılır. <a href="https://www.jove.com/files/ftp_upload/52535/52535fig1large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 2," src="/files/ftp_upload/52535/52535fig2highres.jpg" /> Şekil 2. ChIP-Sıra kütüphane hazırlık, sıralama-sentez, haritalama ve pik arama. (A) &#39;elektroferogramıdır 250 bp 450 DNA şablonları ile iyi talaş-Dizi kütüphane gösterir. Bu şablonlar evrensel (58 bp) tarafından çevrili ilgi DNA insert ve dövize endeksli (63 bp) adaptörü gerektirir. (B) </aynı şablonları içeren her küme kümelerin strong&gt; Milyonlarca, geri dönüşümlü, farklı floroforu ve aynı sonlandırma özelliklere sahip dört nükleotidin varlığında tabanı tarafından sıralı taban vardır. Floresan görüntüleri okur içine sonuçta monte karşılık gelen bazlar, aramak için gerçek zamanlı olarak işlenir. (C) Sadece benzersiz Ksenopus genomuna haritası tutulmasını okur. Bütün parçalar 5 &#39;ucundan dizilenmiştir gibi, yonga eşleme ilgi kromatin özelliği kuşatan şerit spesifik pikler okur. Böylece, pik arayanlar doğru kromatin özelliklerini lokalize bir ortalama fragman uzunluğu okur immunoprecipitation kaynaklanan ve genişletmek zenginleştirme tespit. <a href="https://www.jove.com/files/ftp_upload/52535/52535fig2large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt = &quot;Şekil 3&quot; src = &quot;/ files / ftp_upload / 52.535 / 52535fig3highres.jpg&quot; /&gt; Şekil 3. Zigotik T-box transkripsiyon faktörü vegt (zVegT). Hepsi burada gösterilen sayıları 10 milyona normalize olan okuma benzersiz haritalanmış ve olmayan gereksiz okur. (A) alıntı vasıtasıyla sonrası dizi analizi ve veri görselleştirme örneği zVegT genom profil X. bağlanma (Nieuwkoop ve Faber 29 sonra 12.5 sahne 11) Tropicalis gastrula embriyolar. Her tepe, genişletilmiş okur yığılma, tek bir bağlanma yeri temsil eder. Bu doruklarına% 1&#39;den daha az bir yanlış keşif oranı (FDR) ile MACS2 tarafından denir. Her MESP gen bağlanma oldukça yakın ve üst baş zVegT gösterir, ancak MESPA ve mespb Bu aşamada (RNA&#39;ya Dizi verileri 30) ile ifade edilir. (B) &#39;zVegT DNA doluluk seviyeleri birkaç loci talaş-qPCR tarafından (bir non içeren kb yukarısında β aktin arasında TT-bağlı bölgesi 0.5) konfiChIP-Sıra tarafından bulunan özel zenginleştirme rm. (A) (kırmızı çubuk) olarak adlandırılan tepe MESPA sonuçları karşılaştırın. DNA doluluk seviyesi hem de giriş yüzdesi, vegt antikor (IgG izotipinin tavşan poliklonal) ve antikor kontrolü (normal tavşan IgG) ile ChIP ile ChIP olarak görüntülenmiştir. Hata çubukları iki biyolojik çoğaltır standart sapmasını yansıtır. (C) Metagene analizi etrafında başka genomik bölge ve gen organları içinde promotör göreceli bağlama tercihli zVegT (etiketler 25 bp üzerinde binned) gösterir. (D) Heatmap k-ortalama gösterir kümelenmiş (k = 5), DNA doluluk seviyeleri gastrula aşamasında tüm zVegT bağlı bölgelere zVegT ve Smad2 / Smad3 (ChIP-Dizi veriler 31) göreceli (etiketler 25 bp üzerinde binned). heatmap De novo motif analizi zVegT-% 38&#39;inde motifi bağlayıcı kanonik T-box transkripsiyon faktörü keşfeder 2 tabanlı ve bp başına 5 etiketleri merkezli. (E) logaltta yatan motifi mı arka dizileri,% 5 bulma oranı normalize ise, bağlı bölgeleri. kanonik Smad2 / Smad3 bağlayıcı motifi pek zenginleştirilmiş ise yoğunluk haritası, zVegT bağlanma sitelerin merkezinde T-box motifi için en yüksek zenginleştirme gösterir. (F) Histogram, her hedef genin hesaplanır zVegT DNA doluluk seviyelerini gösterir [-] tüm zirveleri (+/- 200 bp) 5 kb yukarı arasından. transkripsiyon başlangıç ​​siteleri gelen ve 1 kb mansap [+] (G) yüksek DNA doluluk içinde -5 kb düzeyleri ve 1 kb with Top 300 genlerin Erken embriyonik gelişim biyolojik süreçleri için zenginleştirilmiş. Bu terimler zVegT varsayımsal fonksiyonu ile uyumludur GO. FDR iki kuyruklu Fisher testine göre ve çoklu test için düzeltilir. <a href="https://www.jove.com/files/ftp_upload/52535/52535fig3large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a>

Watch this Scientific Journal Video about Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq at JoVE.com

Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

nasıl kromatin düzenleyiciler ve kromatin devletlerin soru in vivo genom hücre kaderi kararları gelişen embriyonun yapılır ne kadar erken anlayışımıza önemli olduğunu etkileyebilir. ChIP-Seq-küresel düzey bir Xenopus embriyolar için burada özetlenen kromotin özelliklerini araştırmak için en popüler yaklaşım.

Kromatin Regülatörleri ve Devletleri&#39;nde genom Anlık<em&gt; Ksenopus</emChIP-Sıra tarafından&gt; Embriyolar

The recruitment of chromatin regulators and the assignment of chromatin states to specific genomic loci are pivotal to cell fate decisions and tissue and ...

Research

JoVE Journal

Developmental Biology

Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

Manipulation and In Vitro Maturation of Xenopus laevis Oocytes, Followed by Intracytoplasmic Sperm Injection, to Study Embryonic Development

Manipulation and In Vitro Maturation of Xenopus laevis Oocytes, Followed by Intracytoplasmic Sperm Injection, to Study Embryonic Development

Manipülasyon ve<em&gt; İn Vitro</emVe&gt; Olgunlaşma<em&gt; Xenopus laevis</emIntrasitoplazmik sperm enjeksiyonu izledi&gt; oositler, Embriyonik Geliştirme Çalışması

Amphibian eggs have been widely used to study embryonic development. Early embryonic development is driven by maternally stored factors accumulated during ...

Accurate and Phenol Free DNA Sexing of Day 30 Porcine Embryos by PCR

PCR ile Gün 30 Domuz Embriyolar Doğru ve Fenol Ücretsiz DNA cinsiyet tayini

Research into prenatal programming in the pig has shown that the sex of the developing embryo or fetus can influence the developmental outcome. Therefore, ...

Technique to Target Microinjection to the Developing Xenopus Kidney

Technique to Target Microinjection to the Developing Xenopus Kidney

Gelişmekte olan mikroenjeksiyon Hedef Tekniği<em&gt; Xenopus</em&gt; Böbrek

The embryonic kidney of Xenopus&#160;laevis (frog), the pronephros, consists of a single nephron, and can be used as a model for kidney disease. Xenopus ...

Generation of Parabiotic Zebrafish Embryos by Surgical Fusion of Developing Blastulae

Blastulae Gelişmekte Cerrahi Fusion tarafından Parabiyotik balığı Embriyolar Üretimi

Surgical parabiosis of two animals of different genetic backgrounds creates a unique scenario to study cell-intrinsic versus cell-extrinsic roles for ...

Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos

Canlı Zebra balığı Embriyolarında Biosense Motor Nöron Membranı Potansiyeli

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the ...

Visualization and Quantitative Analysis of Embryonic Angiogenesis in Xenopus tropicalis

Visualization and Quantitative Analysis of Embryonic Angiogenesis in Xenopus tropicalis

Embriyonik Anjiyojenezin Görselleştirilmesi ve Nicel Analizi<emXenopus tropicalis</em

Blood vessels supply oxygen and nutrients throughout the body, and the formation of the vascular network is under tight developmental control. The ...

Induction of Hypoxia in Living Frog and Zebrafish Embryos

Kurbağa ve Zebra balığı Embriyolarında Hipoksinin İndüklenmesi

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and ...

CARIP-Seq and ChIP-Seq: Methods to Identify Chromatin-Associated RNAs and Protein-DNA Interactions in Embryonic Stem Cells

CARIP-Seq ve ChIP-Seq: kromatin ilişkili RNA ve Protein-DNA etkileşimleri embriyonik kök hücreleri tanımlamak için yöntemleri

Embryonic stem (ES) cell self-renewal&#160;and differentiation is governed by extrinsic signals and intrinsic networks of transcription factors, ...

Visualizing the Node and Notochordal Plate In Gastrulating Mouse Embryos Using Scanning Electron Microscopy and Whole Mount Immunofluorescence

Düğüm ve Notochordal plaka Gastrulating fare embriyo Tarama elektron mikroskobu ve bütün Dağı ayirt kullanarak görselleştirme

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is ...

Microinjection of DNA into Eyebuds in Xenopus laevis Embryos and Imaging of GFP Expressing Optic Axonal Arbors in Intact, Living Xenopus Tadpoles

Microinjection of DNA into Eyebuds in Xenopus laevis Embryos and Imaging of GFP Expressing Optic Axonal Arbors in Intact, Living Xenopus Tadpoles

Xenopus laevis Embriyolarında Göz tomurcuklarına DNA'nın mikroenjeksiyonu ve GFP'nin Sağlam Optik Aksonal Arbors'u İfade Etme Görüntülemesi, Yaşayan Xenopus Kurbağaları

The primary visual projection of tadpoles of the aquatic frog Xenopus laevis serves as an excellent model system for studying mechanisms that regulate the ...