Name: direct protein delivery to mammalian cells using cell-permeable cys2-his2 zinc-finger domains
Uploaded: 2015-03-25T15:00:00
Description: Watch this Scientific Journal Video about Direct Protein Delivery to Mammalian Cells Using Cell-permeable Cys2-His2 Zinc-finger Domains at JoVE.com

Ce travail a été soutenu par les Instituts nationaux de la santé (DP1CA174426 à Carlos F. Barbas) et l&#39;Université ShanghaiTech, Shanghai, Chine (à JL). Graphiques moléculaires ont été générés en utilisant PyMol.

1. Clonage <ol><li> Obtenir deux doigts domaines ZIF substitution alanine qui ont été sous-clonés dans le système de vecteur d&#39;expression pET-28 et sont disponibles sur demande (PET-2F-ZiF). 34 </li><li> Amplifier par PCR à partir du plasmide EmGFP Emerald-pBAD avec les amorces 5 &#39;Xmal-EmGFP (5&#39;-CCCGGG GGAAATTG ATGGTGAGCAAGGGCGAGGAGCTGTTCAC-3&#39;; Xmal place en gras) et 3 &#39;Sacl-EmGFP (5&#39;-CGGATCT TTACTTGTACAGCTCGTCCATGCCGAG GAGCTC-3&#39; ; ...

<ol>
	<li>Berg, A., Dowdy, S. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+transduction+domain+delivery+of+therapeutic+macromolecules.">Protein transduction domain delivery of therapeutic macromolecules.</a> Curr. Opin. Biotechnol. 22, 888-893 (2011).</li><li>Lindsay, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peptide-mediated+cell+delivery:+application+in+protein+target+validation.">Peptide-mediated cell delivery: application in protein target validation.</a> Curr. Opin. Pharmacol. 2, 587-594 (2002).</li><li>Luo, D., Saltzman, W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+DNA+delivery+systems.">Synthetic DNA delivery systems.</a> Nat. Biotechnol. 18, 33-37 (2000).</li><li>Guo, X., Huang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+nonviral+vectors+for+gene+delivery.">Recent advances in nonviral vectors for gene delivery.</a> Acc. Chem. Res. 45, 971-979 (2012).</li><li>Thomas, C. E., Ehrhardt, A., Kay, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+and+problems+with+the+use+of+viral+vectors+for+gene+therapy.">Progress and problems with the use of viral vectors for gene therapy.</a> Nat. Rev. Genet. 4, 346-358 (2003).</li><li>Frankel, A. D., Pabo, C. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+uptake+of+the+tat+protein+from+human+immunodeficiency+virus.">Cellular uptake of the tat protein from human immunodeficiency virus.</a> Cell. 55, 1189-1193 (1988).</li><li>Elliott, G., O'Hare, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intercellular+trafficking+and+protein+delivery+by+a+herpesvirus+structural+protein.">Intercellular trafficking and protein delivery by a herpesvirus structural protein.</a> Cell. 88, 223-233 (1997).</li><li>Derossi, D., Joliot, A. H., Chassaing, G., Prochiantz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+third+helix+of+the+Antennapedia+homeodomain+translocates+through+biological+membranes.">The third helix of the Antennapedia homeodomain translocates through biological membranes.</a> J. Biol. Chem. 269, 10444-10450 (1994).</li><li>Smith, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Minimally+cationic+cell-permeable+miniature+proteins+via+alpha-helical+arginine+display.">Minimally cationic cell-permeable miniature proteins via alpha-helical arginine display.</a> J. Am. Chem. Soc. 130, 2948-2949 (2008).</li><li>Daniels, D. S., Schepartz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrinsically+cell-permeable+miniature+proteins+based+on+a+minimal+cationic+PPII+motif.">Intrinsically cell-permeable miniature proteins based on a minimal cationic PPII motif.</a> J. Am. Chem. Soc. 129, 14578-14579 (2007).</li><li>Karagiannis, E. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rational+design+of+a+biomimetic+cell+penetrating+peptide+library.">Rational design of a biomimetic cell penetrating peptide library.</a> ACS Nan. 7, 8616-8626 (2013).</li><li>Gao, S., Simon, M. J., Hue, C. D., Morrison, B., 3r, S., Banta, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+unusual+cell+penetrating+peptide+identified+using+a+plasmid+display-based+functional+selection+platform.">An unusual cell penetrating peptide identified using a plasmid display-based functional selection platform.</a> ACS Chem. Biol. 6, 484-491 (2011).</li><li>Fuchs, S. M., Raines, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arginine+grafting+to+endow+cell+permeability.">Arginine grafting to endow cell permeability.</a> ACS Chem. Biol. 2, 167-170 (2007).</li><li>Cronican, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+delivery+of+functional+proteins+into+mammalian+cells+in+vitro+and+in+vivo+using+a+supercharged+protein.">Potent delivery of functional proteins into mammalian cells in vitro and in vivo using a supercharged protein.</a> ACS Chem. Biol. 5, 747-752 (2010).</li><li>Panyam, J., Labhasetwar, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biodegradable+nanoparticles+for+drug+and+gene+delivery+to+cells+and+tissue.">Biodegradable nanoparticles for drug and gene delivery to cells and tissue.</a> Adv. Drug Deliv. Rev. 55, 329-347 (2003).</li><li>Zelphati, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracellular+delivery+of+proteins+with+a+new+lipid-mediated+delivery+system.">Intracellular delivery of proteins with a new lipid-mediated delivery system.</a> J. Biol. Chem. 276, 35103-35110 (2001).</li><li>Kaczmarczyk, S. J., Sitaraman, K., Young, H. A., Hughes, S. H., Chatterjee, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+delivery+using+engineered+virus-like+particles.">Protein delivery using engineered virus-like particles.</a> Proc. Natl. Acad. Sci. U. S. A. 108, 16998-17003 (2011).</li><li>Voelkel, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+transduction+from+retroviral+Gag+precursors.">Protein transduction from retroviral Gag precursors.</a> Proc. Natl. Acad. Sci. U. S. A. 107, 7805-7810 (2010).</li><li>Sinha, V. R., Trehan, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biodegradable+microspheres+for+protein+delivery.">Biodegradable microspheres for protein delivery.</a> J. Control Release. 90, 261-280 (2003).</li><li>Liu, J., Gaj, T., Patterson, J. T., Sirk, S. J., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-penetrating+peptide-mediated+delivery+of+TALEN+proteins+via+bioconjugation+for+genome+engineering.">Cell-penetrating peptide-mediated delivery of TALEN proteins via bioconjugation for genome engineering.</a> PLoS One. 9, e85755 (2014).</li><li>Ramakrishna, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+disruption+by+cell-penetrating+peptide-mediated+delivery+of+Cas9+protein+and+guide+RNA.">Gene disruption by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA.</a> Genome Res. 24, 1020-1027 (2014).</li><li>Fuchs, S. M., Raines, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyarginine+as+a+multifunctional+fusion+tag.">Polyarginine as a multifunctional fusion tag.</a> Protein Sci. 14, 1538-1544 (2005).</li><li>Mai, J. C., Shen, H., Watkins, S. C., Cheng, T., Robbins, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficiency+of+protein+transduction+is+cell+type-dependent+and+is+enhanced+by+dextran+sulfate.">Efficiency of protein transduction is cell type-dependent and is enhanced by dextran sulfate.</a> J. Biol. Chem. 277, 30208-30218 (2002).</li><li>Al-Taei, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracellular+traffic+and+fate+of+protein+transduction+domains+HIV-1+TAT+peptide+and+octaarginine.+Implications+for+their+utilization+as+drug+delivery+vectors.">Intracellular traffic and fate of protein transduction domains HIV-1 TAT peptide and octaarginine. Implications for their utilization as drug delivery vectors.</a> Bioconjug. Chem. 17, 90-100 (2006).</li><li>Jones, S. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterisation+of+cell-penetrating+peptide-mediated+peptide+delivery.">Characterisation of cell-penetrating peptide-mediated peptide delivery.</a> Br. J. Pharmacol. 145, 1093-1102 (2005).</li><li>Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S., Gregory, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+editing+with+engineered+zinc+finger+nucleases.">Genome editing with engineered zinc finger nucleases.</a> Nat. Rev. Genet. 11, 636-646 (2010).</li><li>Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+with+zinc-finger+nucleases.">Genome engineering with zinc-finger nucleases.</a> Genetics. 188, 773-782 (2011).</li><li>Guo, J., Gaj, T., Barbas, C. F., 3rd, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+an+enhanced+and+highly+efficient+FokI+cleavage+domain+for+zinc+finger+nucleases.">Directed evolution of an enhanced and highly efficient FokI cleavage domain for zinc finger nucleases.</a> J. Mol. Biol. 400, 96-107 (2010).</li><li>Gaj, T., Guo, J., Kato, Y., Sirk, S. J., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+gene+knockout+by+direct+delivery+of+zinc-finger+nuclease+proteins.">Targeted gene knockout by direct delivery of zinc-finger nuclease proteins.</a> Nat. Methods. 9, 805-807 (2012).</li><li>Gersbach, C. A., Gaj, T., Barbas, C. F., 3rd, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+zinc+finger+proteins:+the+advent+of+targeted+gene+regulation+and+genome+modification+technologies.">Synthetic zinc finger proteins: the advent of targeted gene regulation and genome modification technologies.</a> Acc. Chem. Res. 47, 2309-2318 (2014).</li><li>Gaj, T., Gersbach, C. A., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ZFN,+TALEN,+and+CRISPR/Cas-based+methods+for+genome+engineering.">ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering.</a> Trends Biotechnol. 31, 397-405 (2013).</li><li>Perez-Pinera, P., Ousterout, D. G., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+targeted+genome+editing.">Advances in targeted genome editing.</a> Curr. Opin. Chem. Biol. 16, 268-277 (2012).</li><li>Cronican, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+class+of+human+proteins+that+deliver+functional+proteins+into+mammalian+cells+in+vitro+and+in+vivo.">A class of human proteins that deliver functional proteins into mammalian cells in vitro and in vivo.</a> Chem. Biol. 18, 833-838 (2011).</li><li>Gaj, T., Liu, J., Anderson, K. E., Sirk, S. J., Barbas, C. F., 3rd, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+delivery+using+Cys2-His2+zinc-finger+domains.">Protein delivery using Cys2-His2 zinc-finger domains.</a> ACS Chem. Biol. 9, 1662-1667 (2014).</li><li>Radcliff, G., Jaroszeski, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basics+of+flow+cytometry.">Basics of flow cytometry.</a> Methods Mol. Biol. 91, 1-24 (1998).</li><li>Mercer, A. C., Gaj, T., Sirk, S. J., Lamb, B. M., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+endogenous+human+gene+expression+by+ligand-inducible+TALE+transcription+factors.">Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors.</a> ACS Synth. Biol. 3, 723-730 (2014).</li><li>Segal, D. J., Crotty, J. W., Bhakta, M. S., Barbas, C. F., Horton, N. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure+of+Aart,+a+designed+six-finger+zinc+finger+peptide,+bound+to+DNA.">Structure of Aart, a designed six-finger zinc finger peptide, bound to DNA.</a> J. Mol. Biol. 363, 405-421 (2006).</li></ol>

Ici, un protocole étape par étape, pour la délivrance de protéines à doigt de zinc en utilisant (ZiF domaines cellulaires) perméable est présentée. Le domaine ZiF ne réduit pas l&#39;activité enzymatique de la cargaison 34 condensé; permet la production et la purification de protéines avec des rendements pratiquement identiques à celles observées avec la protéine non modifiée; et peut transporter des protéines et des enzymes dans un large éventail de types de cellules avec des rendements qui...

Très stratégies de prestation de protéines efficaces et polyvalents sont essentiels pour beaucoup la recherche fondamentale et les applications thérapeutiques. La livraison directe des protéines purifiées dans les cellules représente l&#39;une des méthodes les plus sûres et les plus faciles pour atteindre cet objectif. 1,2 Contrairement aux stratégies qui se appuient sur ​​l&#39;expression des gènes à partir d&#39;acides nucléiques, 3-5 délivrance de protéines ne pose pas de risque de mutagenèse insertionnelle, est indépendante de la transcription / machinerie de traduction cellulaire et permet pour un effet immédiat. Cependant, le manque de méthodes simples et généralisables pour doter l&#39;activité pénétrant dans les cellules sur des protéines confond régulièrement leur entrée directe dans les cellules. Les méthodes actuelles pour faciliter la délivrance de protéines intracellulaires sont basés sur l&#39;utilisation d&#39;origine naturelle ou conçus 08.06 peptides de pénétration cellulaire, 12.9 domaines de transduction suralimentés, 13,14 nanoparticules, des liposomes 15 et 16 particules pseudo-virales 17,18 </sup&gt; et les matériaux de microsphères polymères. 19 Malheureusement, plusieurs de ces approches sont entravés par de faibles taux d&#39;absorption cellulaire, 20,21 mauvaise stabilité, 22 par inadvertance spécificité de type cellulaire, 23 bas endosomales échappement propriétés 24 et la toxicité. 25 En outre, beaucoup de protéines technologies de transduction de réduire la bioactivité des protéines livrés. 14 Notre laboratoire précédemment démontré que la nucléase en doigt de zinc (ZFN) protéines - restriction endonucléases chimérique constitué d&#39;un Cys 2 -His deux doigt de zinc protéine de liaison à l&#39;ADN programmable et le domaine de clivage de l&#39;endonucléase de restriction FokI 26-28 - sont intrinsèquement Cell- perméable. 29 Cette activité pénétrant les cellules-surprenant se est révélée être une propriété intrinsèque du domaine en doigt de zinc conçu sur mesure, une plate-forme de liaison à l&#39;ADN qui a émergé comme un outil puissant pour génome ciblé eningé-, 30-32 et est considéré comme le résultat de la constellation de six résidus chargés positivement sur ​​la surface de la protéine. En effet, plusieurs protéines de liaison à l&#39;ADN, y compris c-Jun et N-DEK ont été démontré qu&#39;ils possèdent une capacité innée à traverser les membranes cellulaires. 33 Plus récemment, notre laboratoire élargi sur ces résultats et a démontré que l&#39;activité pénétrant dans les cellules du zinc doigt (ZiF) domaines pourraient être mises à profit pour la livraison de protéine intracellulaire. Fusion génétique soit des domaines de ZIF une ou deux doigts à la cargaison de protéine spécifique conduit à l&#39;absorption efficacité qui dépassaient de nombreux systèmes de livraison classiques de peptides de pénétration cellulaire. 34 Plus particulièrement, la livraison ZiF médiation n&#39;a pas compromis l&#39;activité de fret enzymatique fusionné et facilité des niveaux élevés de livraison cytosolique. Collectivement, ces résultats démontrent le potentiel du domaine ZiF pour faciliter la prestation efficace et facile de protéines, et potentiellement plus divers types de macromolécules, dans les cellules. Ici, un protocole étape par étape détaillées sur la façon de mettre en œuvre la technologie ZIF pour la distribution des protéines dans les cellules de mammifères sont présentées. Nous avons déjà construit une suite de un, deux, trois, quatre, cinq et six doigt des domaines ZIF qui ne ont pas la capacité de lier l&#39;ADN, en raison de la substitution de chacun des résidus de liaison à l&#39;ADN α-hélicoïdale, mais sont capables de délivrer des protéines dans des cellules 34 (figure 1). La production et la transduction de Emerald GFP (EmGFP) dans des cellules HeLa en utilisant un domaine ZiF deux doigt est décrite. Ce protocole est extensible à presque ne importe quelle protéine soluble capable d&#39;expression dans Escherichia coli et presque ne importe quel type de cellule de mammifère. Les résultats attendus sont fournis et des stratégies pour maximiser la performance de ce système sont également discutés.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>XmaI</td>
			<td>New England Biolabs</td>
			<td>R0180L</td>
			<td></td>
		</tr>
		<tr>
			<td>SacI</td>
			<td>New England Biolabs</td>
			<td>R0156L</td>
			<td></td>
		</tr>
		<tr>
			<td>Expand High Fidelity PCR system</td>
			<td>Roche</td>
			<td>11759078001</td>
			<td></td>
		</tr>
		<tr>
			<td>dNTPs</td>
			<td>New England Biolabs</td>
			<td>N0446S</td>
			<td></td>
		</tr>
		<tr>
			<td>4-20% Tris-Glycine Mini protein gels, 1.5 mm, 10 wells</td>
			<td>Life Technologies</td>
			<td>EC6028BOX</td>
			<td></td>
		</tr>
		<tr>
			<td>2x Laemmli Sample Buffer</td>
			<td>BioRad</td>
			<td>161-0737</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA Ligase</td>
			<td>Life Technologies</td>
			<td>15224-017</td>
			<td></td>
		</tr>
		<tr>
			<td>BL21 (DE3) Competent E. coli</td>
			<td>New England Biolabs</td>
			<td>C2527I</td>
			<td></td>
		</tr>
		<tr>
			<td>IPTG</td>
			<td>Thermo Scientific</td>
			<td>R0391</td>
			<td></td>
		</tr>
		<tr>
			<td>Zinc Chloride</td>
			<td>Sigma-Aldrich</td>
			<td>208086-5G</td>
			<td></td>
		</tr>
		<tr>
			<td>Kanamycin Sulfate</td>
			<td>Fisher Scientific</td>
			<td>BP906-5</td>
			<td></td>
		</tr>
		<tr>
			<td>Glucose</td>
			<td>Sigma-Aldrich</td>
			<td>G8270-100G</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris Base</td>
			<td>Fisher Scientific</td>
			<td>BP152-25</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Chloride</td>
			<td>Sigma-Aldrich</td>
			<td>S9888-25G</td>
			<td></td>
		</tr>
		<tr>
			<td>DTT</td>
			<td>Fisher Scientific</td>
			<td>PR-V3151&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>PMSF</td>
			<td>Thermo Scientific</td>
			<td>36978</td>
			<td></td>
		</tr>
		<tr>
			<td>Ni-NTA Agarose Resin</td>
			<td>QIAGEN</td>
			<td>30210</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>Sigma-Aldrich</td>
			<td>G5516-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Imidazole</td>
			<td>Sigma-Aldrich</td>
			<td>I5513-25G</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra-15 Centrifugal Filter Units</td>
			<td>EMO Millipore</td>
			<td>UFC900324</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>Life Technologies</td>
			<td>11966-025</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Life Technologies</td>
			<td>10437-028</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibiotic-Antimycotic&#160;</td>
			<td>Life Technologies</td>
			<td>15240-062</td>
			<td></td>
		</tr>
		<tr>
			<td>24-Well Flat Bottom Plate</td>
			<td>Sigma-Aldrich</td>
			<td>CLS3527-100EA</td>
			<td></td>
		</tr>
		<tr>
			<td>Poly-Lysine</td>
			<td>Sigma-Aldrich</td>
			<td>P7280</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS, No Calcium, No Magnesium</td>
			<td>Life Technologies</td>
			<td>21600010</td>
			<td></td>
		</tr>
		<tr>
			<td>Heparan Sulfate</td>
			<td>Sigma-Aldrich</td>
			<td>H4777</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypsin</td>
			<td>Life Technologies</td>
			<td>25300054</td>
			<td></td>
		</tr>
		<tr>
			<td>Hela cells</td>
			<td>ATCC</td>
			<td>CCL-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Nano Drop ND-1000 spectrophotometer&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick PCR Purification Kit</td>
			<td>QIAGEN</td>
			<td>28104</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction Kit</td>
			<td>QIAGEN</td>
			<td>28704</td>
			<td></td>
		</tr>
	</tbody>
</table>

direct protein delivery to mammalian cells using cell-permeable cys2-his2 zinc-finger domains

Due to their modularity and ability to be reprogrammed to recognize a wide range of DNA sequences, Cys2-His2 zinc-finger DNA-binding domains have emerged as useful tools for targeted genome engineering. Like many other DNA-binding proteins, zinc-fingers also possess the innate ability to cross cell membranes. We recently demonstrated that this intrinsic cell-permeability could be leveraged for intracellular protein delivery. Genetic fusion of zinc-finger motifs leads to efficient transport of protein and enzyme cargo into a broad range of mammalian cell types. Unlike other protein transduction technologies, delivery via zinc-finger domains does not inhibit enzyme activity and leads to high levels of cytosolic delivery. Here a detailed step-by-step protocol is presented for the implementation of zinc-finger technology for protein delivery into mammalian cells. Key steps for achieving high levels of intracellular zinc-finger-mediated delivery are highlighted and strategies for maximizing the performance of this system are discussed.

Deux doigts protéines de fusion ZiF-EmGFP peuvent être exprimées dans E. coli avec&gt; 95% d&#39;homogénéité et des rendements élevés (&gt; 25 mg / ml) (Figure 2). En général, un ou deux doigts protéines de fusion ZIF peuvent être produites en quantités presque identiques à celles de type sauvage protéine non modifiée. Toutefois, dans certains contextes, des protéines de fusion ZiF cinq et six doigts ne peuvent pas être produits avec des rendements suffisamment élevés pour l...

Watch this Scientific Journal Video about Direct Protein Delivery to Mammalian Cells Using Cell-permeable Cys2-His2 Zinc-finger Domains at JoVE.com

Direct Protein Delivery to Mammalian Cells Using Cell-permeable Cys2-His2 Zinc-finger Domains

Domaines à doigt de zinc sont intrinsèquement perméable cellule et capable de médier la délivrance de protéines dans une large gamme de types de cellules de mammifères. Ici, un protocole étape par étape détaillé pour la mise en œuvre de la technologie à doigt de zinc pour la livraison de protéine intracellulaire est présenté.

Protein livraison directe aux cellules de mammifères en utilisant la cellule perméable Cys<sub&gt; 2</sub&gt; -His<sub&gt; 2</sub&gt; Domaines doigt de zinc

Due to their modularity and ability to be reprogrammed to recognize a wide range of DNA sequences, Cys2-His2 zinc-finger DNA-binding domains have emerged ...

Research

JoVE Journal

Biology

Direct Protein Delivery to Mammalian Cells Using Cell-permeable Cys2-His2 Zinc-finger Domains

Long-term Imaging Mammalian Cells using Wide-Field Microscopy

Cellules d&#39;imagerie à long terme des mammifères en utilisant la microscopie à champ large

Recherche

Biologie

Trypsinizing and Subculturing Mammalian Cells

Trypsinisation et Repiquage des cellules de mammifères

As cells reach confluency, they must be subcultured or passaged. Failure to subculture confluent cells results in reduced mitotic index and eventually in ...

Engineering Cell-permeable Protein

Ingénierie cellulaire perméable protéines

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can ...

Using the GELFREE 8100 Fractionation System for Molecular Weight-Based Fractionation with Liquid Phase Recovery

Utiliser le système de fractionnement GELFREE 8100 pour les Poids Moléculaire à base de fractionnement avec récupération de la phase liquide

The GELFREE 8100 Fractionation System is a novel protein fractionation system designed to maximize protein recovery during molecular weight based ...

Genome Editing with CompoZr Custom Zinc Finger Nucleases (ZFNs)

Genome Editing with CompoZr Custom Zinc Finger Nucleases ZFNs

Génome édition avec des nucléases personnalisés CompoZr doigt de zinc (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

siRNA contrôle pour la ubiquitine et les régulateurs du système ubiquitine-comme des voies biologiques dans des cellules de mammifères en culture

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...

Identification of Protein Interaction Partners in Mammalian Cells Using SILAC-immunoprecipitation Quantitative Proteomics

Identification des protéines d&#39;interaction partenaires dans les cellules de mammifères à l&#39;aide SILAC-immunoprécipitation quantitatives en protéomique

Quantitative proteomics combined with immuno-affinity purification, SILAC immunoprecipitation, represent a powerful means for the discovery of novel ...

Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

Doigt de zinc nucléase Gene meilleur ciblage dans embryonnaires humaines Cellules souches

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell ...

Examination of Proteins Bound to Nascent DNA in Mammalian Cells Using  BrdU-ChIP-Slot-Western Technique

Examen des protéines liées à Nascent ADN dans les cellules de mammifères utilisant la technique BrdU-Chip-Slot-Ouest

Histone deacetylases 1 and 2 (HDAC1,2) localize to the sites of DNA replication. In the previous study, using a selective inhibitor and a genetic ...

A Graphical User Interface for Software-assisted Tracking of Protein Concentration in Dynamic Cellular Protrusions

Une interface utilisateur graphique pour le suivi assisté par logiciel de la concentration de protéines dans les protrusions cellulaires dynamiques

Filopodia are dynamic, finger-like cellular protrusions associated with migration and cell-cell communication. In order to better understand the complex ...