Name: induction of maternal immune activation in mice at mid-gestation stage with viral mimic poly(i:c)
Uploaded: 2016-03-25T13:00:00
Description: Watch this Scientific Journal Video about Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C at JoVE.com

Nous tenons à rendre hommage à feu le Dr Paul H. Patterson pour sa contribution à l&#39;avancement du modèle MIA, l&#39;autisme et la recherche sur la schizophrénie. Nous reconnaissons Sarkis K. Mazmanian pour son grand soutien sur ce protocole; Ruben M. Bayon, Yvette Garcia-Flores, Karen C. Lencioni et Leslie A. Neumann d&#39;assistance administrative; Ali Khoshnan et Jan C. Ko pour l&#39;assistance sur le tournage; Elaine Y. Hsiao et Natalia Malkova pour leurs conseils sur MIA induction; Jeffrey S. Cochrane, Joaquin Gutierrez, Kwan F. Lee, Jaime Rodriguez, Lorena C. Sandoval, et Natalie A. Verduzco pour leur élevage expert. Ce travail a été soutenu par le Conte Centre Award NIH (NIH 5P50MH086383-04, Paul H. Patterson); Autism Speaks (# 7670, à Paul H. Patterson); Fondation Simons (# 322839, à Sarkis K. Mazmanian); Subvention de formation NIH (NIH / NRSA T32GM07616 K.-HC); Caltech Summer Undergraduate Research Fellowship (SURF) (à ZY); Amgen Scholars Program à Caltech (à ZY); et postdoctorale from National Science Council, Taiwan (NSC 101-2917-I-564-039, à W.-LW).

Tous les protocoles ont été réalisées sous l&#39;approbation du California Institute of Care Committee et l&#39;utilisation des animaux Institutionnel Technologie (IACUC). 1. Préparation des paires Timed-accouplement <ol><li> Utilisez au moins 6 barrages pour des expériences comportementales et 3 pour l&#39;analyse de l&#39;expression des gènes. REMARQUE: Utilisez le double du nombre de souris femelles estimés, puisque seulement environ 50% des souris sera branché du chrono...

<ol>
	<li>Brown, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiologic+studies+of+exposure+to+prenatal+infection+and+risk+of+schizophrenia+and+autism.">Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism.</a> Dev Neurobiol. 72 (10), 1272-1276 (2012).</li><li>Fatemi, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+viral+theory+of+schizophrenia+revisited:+abnormal+placental+gene+expression+and+structural+changes+with+lack+of+evidence+for+H1N1+viral+presence+in+placentae+of+infected+mice+or+brains+of+exposed+offspring.">The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring.</a> Neuropharmacology. 62 (3), 1290-1298 (2012).</li><li>Shi, L., Tu, N., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+influenza+infection+is+likely+to+alter+fetal+brain+development+indirectly:+the+virus+is+not+detected+in+the+fetus.">Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus.</a> Int J Dev Neurosci. 23 (2-3), 299-305 (2005).</li><li>Knuesel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+abnormal+brain+development+across+CNS+disorders.">Maternal immune activation and abnormal brain development across CNS disorders.</a> Nat Rev Neurol. 10 (11), 643-660 (2014).</li><li>Meyer, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+poly(i:C)+exposure+and+other+developmental+immune+activation+models+in+rodent+systems.">Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems.</a> Biol Psychiatry. 75 (4), 307-315 (2014).</li><li>Meyer, U., Feldon, J., Yee, B. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+the+fetal+brain+cytokine+imbalance+hypothesis+of+schizophrenia.">A review of the fetal brain cytokine imbalance hypothesis of schizophrenia.</a> Schizophr Bull. 35 (5), 959-972 (2009).</li><li>Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+prenatal+infection+on+brain+development+and+behavior:+a+review+of+findings+from+animal+models.">Effects of prenatal infection on brain development and behavior: a review of findings from animal models.</a> Brain Behav Immun. 24 (6), 881-897 (2010).</li><li>Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+an+autism+risk+factor+in+mice+leads+to+permanent+immune+dysregulation.">Modeling an autism risk factor in mice leads to permanent immune dysregulation.</a> Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).</li><li>Ito, H. T., Smith, S. E., Hsiao, E., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+nonspatial+information+processing+in+the+hippocampus+of+the+adult+offspring.">Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring.</a> Brain Behav Immun. 24 (6), 930-941 (2010).</li><li>Smith, S. E., Li, J., Garbett, K., Mirnics, K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+fetal+brain+development+through+interleukin-6.">Maternal immune activation alters fetal brain development through interleukin-6.</a> J Neurosci. 27 (40), 10695-10702 (2007).</li><li>Shi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+alters+cerebellar+development+in+the+offspring.">Activation of the maternal immune system alters cerebellar development in the offspring.</a> Brain Behav Immun. 23 (1), 116-123 (2009).</li><li>Hsiao, E. Y., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+induces+endocrine+changes+in+the+placenta+via+IL-6.">Activation of the maternal immune system induces endocrine changes in the placenta via IL-6.</a> Brain Behav Immun. 25 (4), 604-615 (2011).</li><li>Wu, W. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+interaction+between+maternal+immune+activation+and+alpha+7+nicotinic+acetylcholine+receptor+in+regulating+behaviors+in+the+offspring.">The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring.</a> Brain Behav Immun. , (2015).</li><li>Garay, P. A., Hsiao, E. Y., Patterson, P. H., McAllister, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+causes+age-+and+region-specific+changes+in+brain+cytokines+in+offspring+throughout+development.">Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development.</a> Brain Behav Immun. 31, 54-68 (2013).</li><li>Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., Mirnics, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+maternal+immune+activation+on+gene+expression+patterns+in+the+fetal+brain.">Effects of maternal immune activation on gene expression patterns in the fetal brain.</a> Transl Psychiatry. 2, e98 (2012).</li><li>Hsiao, E. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbiota+modulate+behavioral+and+physiological+abnormalities+associated+with+neurodevelopmental+disorders.">Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders.</a> Cell. 155 (7), 1451-1463 (2013).</li><li>Naviaux, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antipurinergic+therapy+corrects+the+autism-like+features+in+the+poly(IC)+mouse+model.">Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model.</a> PLoS One. 8 (3), e57380 (2013).</li><li>Pratt, L., Ni, L., Ponzio, N. M., Jonakait, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+inflammation+promotes+fetal+microglial+activation+and+increased+cholinergic+expression+in+the+fetal+basal+forebrain:+role+of+interleukin-6.">Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6.</a> Pediatr Res. 74 (4), 393-401 (2013).</li><li>Schwartzer, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+strain+specific+interactions+in+the+development+of+autism-like+behaviors+in+mice.">Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice.</a> Transl Psychiatry. 3, e240 (2013).</li><li>Khan, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+effects+of+maternal+immune+activation+on+depression-like+behavior+in+the+mouse.">Long-term effects of maternal immune activation on depression-like behavior in the mouse.</a> Transl Psychiatry. 4, e363 (2014).</li><li>Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., Finlay, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+transformations+of+neurodevelopmental+sequences+across+mammalian+species.">Modeling transformations of neurodevelopmental sequences across mammalian species.</a> J Neurosci. 33 (17), 7368-7383 (2013).</li><li>Abazyan, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+interaction+of+mutant+DISC1+and+immune+activation+produces+adult+psychopathology.">Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology.</a> Biol Psychiatry. 68 (12), 1172-1181 (2010).</li><li>Meyer, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adult+behavioral+and+pharmacological+dysfunctions+following+disruption+of+the+fetal+brain+balance+between+pro-inflammatory+and+IL-10-mediated+anti-inflammatory+signaling.">Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling.</a> Mol Psychiatry. 13 (2), 208-221 (2008).</li><li>Vuillermot, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+immune+activation+interacts+with+genetic+Nurr1+deficiency+in+the+development+of+attentional+impairments.">Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments.</a> J Neurosci. 32 (2), 436-451 (2012).</li><li>Bechard, A., Nicholson, A., Mason, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Litter+size+predicts+adult+stereotypic+behavior+in+female+laboratory+mice.">Litter size predicts adult stereotypic behavior in female laboratory mice.</a> J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).</li><li>Harvey, L., Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stereological+comparison+of+GAD67+and+reelin+expression+in+the+hippocampal+stratum+oriens+of+offspring+from+two+mouse+models+of+maternal+inflammation+during+pregnancy.">A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy.</a> Neuropharmacology. 62 (4), 1767-1776 (2012).</li></ol>

MIA induction à différentes fenêtres de temps perturbe différents événements de développement du cerveau chez les rongeurs, et conduit par conséquent à différentes anomalies comportementales et neuropathologies chez la progéniture. Ici, nous avons décrit un protocole pour induire MIA chez la souris avec le poly (I: C) injection à E12.5. Cette méthode de MIA conduit à l&#39; induction de comportement, neurologiques, immunologiques et des anomalies gastro - intestinaux associés à l&#39; autisme et la schi...

Le concept de l&#39; activation immunitaire maternelle (MIA) provient des études épidémiologiques sur l&#39;association de l&#39; infection maternelle avec l&#39; autisme et la schizophrénie 1. En raison de l&#39;absence d&#39;agents pathogènes viraux replication détectables dans le placenta ou le cerveau du fœtus après l&#39; infection virale de la mère 2,3, l&#39;effet de l&#39;infection sur la descendance est supposée être provoquée par l&#39;activation du système immunitaire maternel plutôt que les agents pathogènes eux - mêmes . Pour élucider la relation et de cause à effet entre MIA et les troubles psychiatriques, l&#39;injection de synthétisé chimiquement, viral mimique à double polyinosinique ARN brin: acide polycytidylique (poly (I: C)) dans les rongeurs enceintes a été largement utilisé comme modèle animal pour MIA 4,5. Poly (I: C) est reconnu par Toll-like récepteur 3 (TLR3), et l&#39;administration systémique de poly (I: C) induit une réponse inflammatoire aiguë de type viral. L&#39;un des mécanismes par lesquels le poly (I: C) produces anomalies comportementales et neuropathologies chez la progéniture est en provoquant un déséquilibre de cytokines pro - inflammatoires et anti dans l&#39;axe de la mère-placentaire-foetal 6. Plusieurs groupes ont adopté le modèle MIA pour comprendre l&#39;étiologie des troubles psychiatriques 7, et en raison de la diversité des intérêts entre les groupes de recherche, divers points de temps d&#39;activation immunitaire ont été utilisés pour réaliser différentes perturbations sur le développement du cerveau et les comportements 7. Le laboratoire Paul H. Patterson à l&#39;Institut de Technologie de Californie adopte la stratégie d&#39;injection de poly (I: C) dans des souris enceintes à embryonnaires 12,5 jours (E12.5), qui a démontré avec succès que MIA est capable d&#39;induire des comportements, neurologique, et des modifications immunologiques chez la progéniture qui sont associés à l&#39; autisme et la schizophrénie 11/08. Nos travaux antérieurs montrent que MIA progéniture afficher des anomalies du comportement (par exemple, impairmen sociauxt, le déficit de communication, comportement répétitif, le comportement à l&#39; anxiété, et latente déficit d&#39;inhibition 8,10,12), immunitaire dysrégulation et cytokines déséquilibre 8,13,14, altération de l&#39; expression des gènes du cerveau du fœtus 15, la perte de cellules de Purkinje dans lobule VII du cervelet 11, altération des propriétés synaptiques dans l&#39; hippocampe 9, gène x environnement interaction 13, altération de la perméabilité intestinale, et la composition du microbiote intestinal 16. En outre, des stratégies thérapeutiques et prophylactiques sont également développés à partir de ce 13,16,17 système modèle. En induisant MIA à E12.5, d&#39; autres ont montré que MIA produit l&#39; activation du fœtus microglie et l&#39; altération du développement cholinergique cerveau antérieur basal 18, souche spécifique interaction 19, le cerveau synaptosomiques cérébrale anomalies ultrastructurales, cérébrales mitochondriales respiratoires abnormalties chaîne hyperfonctionnement, la régulation négative de molécules synaptosomiques cérébrales 17 ,comportements dépressifs-like, déficience de la cognition et hippocampique potentialisation à long terme (LTP), et le déficit de la neurogenèse hippocampique adulte 20. Ici, nous fournissons une méthode détaillée de la façon d&#39;induire MIA à E12.5 par poly (I: C), ainsi que les paradigmes de la façon d&#39;appliquer ce modèle pour étudier l&#39;étiologie de l&#39;autisme et la schizophrénie. Il est important de noter que la MIA est un facteur de risque pour une variété de troubles 4, et ses résultats sont extrêmement sensibles au temps et un procédé d&#39;induction ainsi que l&#39;élevage des femelles gravides. En tant que tel, même des incohérences mineures entre les laboratoires aboutissent souvent à faible reproductibilité et / ou différents phénotypes de la progéniture. Notre méthode est spécifiquement conçu pour les personnes intéressées à étudier MIA comme un facteur de risque environnemental pour l&#39;autisme et la schizophrénie, et la description détaillée fournie aidera les chercheurs à améliorer la reproductibilité de leurs données.

<table border="0" cellpadding="0" cellspacing="0" width="711">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:283px;">Polyinosinic&#8211;polycytidylic acid potassium salt</td>
			<td style="width:129px;">SIGMA</td>
			<td style="width:167px;">P9582</td>
			<td style="width:133px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">0.9% sodium chloride INJ. USP</td>
			<td>HOSPIRA</td>
			<td>NDC 0409-4888-10</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MONOJECT insuline syrinage 3/10 mL 29G x 1/2&#34;</td>
			<td>COVIDIEN</td>
			<td>8881600145</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">50 ml conical screw cap tubes</td>
			<td>USA SCIENTIFIC</td>
			<td>1500-1211</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nanodrop 1000 spectrophotometer</td>
			<td>THERMO SCIENTIFIC</td>
			<td>1000</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Stereomicroscope</td>
			<td>Wild Heerbrugg</td>
			<td>M5A</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dumont #5 Forceps Inox Tip Size .10 X .06mm</td>
			<td>Roboz</td>
			<td>RS-5045</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNAlater RNA stabilization reagent</td>
			<td>Qiagen</td>
			<td>76104</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TRIzol reagent</td>
			<td>Life Technologies</td>
			<td>15596-026&#160;</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RQ1 Rnase-free DNase</td>
			<td>Promega</td>
			<td>M610A</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iScript cDNA synthesis kit</td>
			<td>Bio-Rad</td>
			<td>170-8891</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastStart universal SYBR green master mix with ROX&#160;</td>
			<td>Roche</td>
			<td>4913922001</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Real-time PCR</td>
			<td>ABI</td>
			<td>7300</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: Il6 forward</td>
			<td>Life Technologies</td>
			<td>TAGTCCTTCCTACCCCAATTTCC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: Il6 Reverse</td>
			<td>Life Technologies</td>
			<td>TTGGTCCTTAGCCACTCCTTC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: beta-actin forward</td>
			<td>Life Technologies</td>
			<td>AGAGGGAAATCGTGCGTGAC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: beta-actin Reverse</td>
			<td>Life Technologies</td>
			<td>CAATAGTGATGACCTGGCCGT</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MicroAmp optical 96-well reaction plate</td>
			<td>Life Technologies</td>
			<td>4306737</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MicroAmp optical adhesive film&#160;</td>
			<td>Life Technologies</td>
			<td>4311971</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EthoVision</td>
			<td>Noldus</td>
			<td>EthoVision</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SR-LAB apparatus (PPI)</td>
			<td>San Diego Instruments&#160;</td>
			<td>SR-LAB</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Marbles</td>
			<td>PENN-PLAX</td>
			<td>Blue gem stones marbles</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dulbecco&#39;s Phosphate-Buffered Saline (DPBS)</td>
			<td>Life Technologies</td>
			<td>21600-069</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Paraformaldehyde</td>
			<td>MACRON</td>
			<td>2621-59</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Vibratome</td>
			<td>Leica</td>
			<td>VT1000 S</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium azide</td>
			<td>Sigma</td>
			<td>S2002</td>
			<td>Optionl</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Triton x-100</td>
			<td>Sigma</td>
			<td>X100</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hydrogen peroxide solution</td>
			<td>Sigma</td>
			<td>18312</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Goat serum</td>
			<td>Vector Laboratories</td>
			<td>S-1000</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rabbit anti-calbindin antibody</td>
			<td>Abcam</td>
			<td>ab11426</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Biotinlyated goat anti-rabbit IgGantibody</td>
			<td>Vector Laboratories</td>
			<td>BA-1000</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">VECTASTAIN ABC Kit</td>
			<td>Vector Laboratories</td>
			<td>PK-4000</td>
			<td>Optionl</td>
		</tr>
	</tbody>
</table>

induction of maternal immune activation in mice at mid-gestation stage with viral mimic poly(i:c)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.

<html> L&#39; injection de 20 mg / kg de poly (I: C) à E12.5 pourrait provoquer une réponse inflammatoire aiguë dans l&#39;axe de la mère-placentaire fœtal et précipiter un effet chronique au développement du cerveau et de phénotypes comportementaux 12,13. Des niveaux élevés d&#39;une cytokine pro-inflammatoire, l&#39;interleukine (IL) -6, est un indicateur fiable de la réponse inflammatoire aiguë après MIA. Le temps de pointe pour l&#39; expression du gène IL...

Watch this Scientific Journal Video about Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C at JoVE.com

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

Induction de la mère Immune Activation chez la souris à mi-gestation scène avec Viral Mimic Poly (I: C)

Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

The overall goal of this procedure is to induce maternal immune activation, or MIA, in mice by intraperitoneal injection of the viral mimic poly at the mid-gestational embryonic stage. This method can help us answer key questions in a neuro-immunology field, such as, how immune dysfunction can lead to perturbations in brain development and behavior. The main advantage of this technique is that it's specifically designed for researchers interested in studying MIA as an environmental risk factor for autism and schizophrenia.Generally, individuals new to this method will struggle, because small differences in the MIA induction method can significantly alter the downstream response in the offspring. To set up a timed mating pair, begin by housing five female mice per cage next to each other in standard mouse cages to synchronize their estra cycles, and use an ear punch to label each animal. Zero to two hours before the dark cycle begins, house the female mice two to a cage, and weigh and record the body weight of each individual mouse, then add one male mouse per cage of two female mice.Zero to four hours after the dark cycle ends, gently lift each female mouse by the base of the tail, allowing the animal to grip the cage grid with the forepaws, to determine the existence of a whitish mass in the vaginal opening. If a plug is not apparent, gently insert a 200 microliter pipette tip into the vaginal opening. Resistance from coagulation confirms the formation of a plug.Group the plugged mice into a new cage, as the presence of a vaginal plug confirms only that copulation has occurred. On embryonic days 10.5 to 11.5, lift each plugged female mouse by the base of the tail, and look for a bulge in the abdomen, then weigh the mice to verify the pregnancy, and house the pregnant animals in individual clean cages. Weigh the poly(I:C)powder in a 50 milliliter conical.On embryonic day 12.5, add the appropriate volume of 0.9%sodium chloride to the corresponding volume of poly(I:C)in a conical tube, and close the cap. Gently roll the saline droplet over the powder until the solution is clear. then centrifuge the tube, and transfer the poly(I:C)solution to a microcentrifuge tube.Use a spectrophotometer to measure the 260 to 280 ratio of the poly(I:C)solution. The ratio should be between 1.54 and 1.82, as described by the manufacturer. Next, weigh the first mouse and load a 0.3 milliliter insulin syringe with the corresponding calculated volume of poly(I:C)solution.Then, picking the mouse up by the tail, place it on the cage top, and secure it by the scruff. Now insert the needle, bevel side up, into the center of the two upper nipples at approximately 20 degrees relative to the mouse, and administer the poly(I:C)solution. Then place the mouse back into the cage.After all of the mice have been injected, house the cages in a quiet, low-traffic room to avoid other confounding effects, and weigh the mice the next morning. At least three days before the behavioral testing, change the cage bedding of the eight to 12 week old adult maternal immune activation or MIA offspring. 30 minutes before the test, acclimate the mice to the testing room.For a pre-pulse inhibition test, restrain the mice in plexiglass cylinders on top of a piezoelectric sensor. Acclimate the mouse to the pre-pulse inhibition chamber for five minutes, with six trials of 120 decibels of white noise. Then expose the mice to randomized mixtures of sound, as outlined in the table, and compare the results to the baseline startle response, to determine the pre-pulse inhibition of the MIA animals.For an open field test, place a mouse in the corner of an open square arena, with a defined 17 by 17 centimeter center zone, and record the trajectory of the mouse for 10 minutes, through a ceiling-mounted camera. Then quantify the center zone entries, and the time spent in the center zone. For a marble burying test, acclimate a mouse to a test cage, with compressed five centimeter deep, clean aspen pine bedding for 10 minutes, then place the mouse back in the home cage, and gently arrange 20 navy blue 1.5 centimeter diameter glass marbles in a four by five grid in the test cage.Now return the mouse to the test cage for 10 minutes, then place the animal back in the home cage, and count the number of marbles that were buried during the test period. Poly(I:C)injection at embryonic day 12.5 can evoke an acute inflammatory response in the maternal placental fetal axis, and precipitate a chronic effect on brain development and behavioral phenotypes. Indeed, poly(I:C)induces a higher Il6 gene expression in the maternal spleen, placenta, and fetal brain, three hours post-injection.Generally, when compared to saline-treated adult offspring, MIA adult offspring exhibit fewer center zone entries, and a shorter center zone duration in the open field test. The poly(I:C)injected animals also display more frequent burying behaviors in the marble burying test, and a lower pre-pulse inhibition. The loss of Purkinje cells in the cerebellum lobule seven is another hallmark of MIA offspring, with fewer calbindin positive Purkinje cells observed in the cerebellum lobule seven of these animals, compared to saline injected controls.While attempting this procedure, it's important to remember not to disturb the pregnant mice after MIA induction. Afterward, additional factors such as postnatal stress or infection can be induced to study additional environment environment interactions.

Research

JoVE Journal

Immunology and Infection

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

Induction of Experimental Autoimmune Hypophysitis in SJL Mice

L&#39;induction de hypophysite auto-immune expérimentale chez la souris SJL

Autoimmune hypophysitis can be reproduced experimentally by the injection of pituitary proteins mixed with an adjuvant into susceptible mice1. Mouse ...

Recherche

Immunologie et infection

Seven Steps to Stellate Cells

Sept étapes pour Stellate Cellules

Hepatic stellate cells are liver-resident  cells of star-like morphology and are located in the space of Disse between  liver sinusoidal endothelial cells ...

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

Mesure de la charge bactérienne et les réponses immunitaires chez des souris infectées avec des Listeria monocytogenes</em

Listeria monocytogenes (Listeria) is a Gram-positive facultative intracellular pathogen1. Mouse studies typically employ intravenous injection of ...

Right Ventricular Systolic Pressure Measurements in Combination with Harvest of Lung and Immune Tissue Samples in Mice

Mesures systolique ventriculaire droite pression en combinaison avec la récolte du poumon et des échantillons de tissus immunitaires chez des souris

The function of the right heart is to pump blood through the lungs, thus linking right heart physiology and pulmonary vascular physiology. Inflammation is ...

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

Dissection Innate Immune signalisation Evasion virale de la production de cytokines

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

Induction de murin inflammation intestinale par transfert adoptif de effecteur CD4<sup&gt; +</sup&gt; CD45RB<sup&gt; Haute</sup&gt; T cellules dans des souris immunodéficientes

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages ...

Isolation of Leukocytes from the Murine Tissues at the Maternal-Fetal Interface

Isolement de leucocytes des tissus murins à l&#39;interface materno-foetale

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing ...

Induction of Experimental Autoimmune Encephalomyelitis in Mice and Evaluation of the Disease-dependent Distribution of Immune Cells in Various Tissues

Induction of Experimental encéphalomyélite allergique chez la souris et l&#39;évaluation de la distribution des maladies dépendant des cellules immunitaires dans divers tissus

Multiple sclerosis is presumed to be an inflammatory autoimmune disease, which is characterized by lesion formation in the central nervous system (CNS) ...

Human Placental and Decidual Organ Cultures to Study Infections at the Maternal-fetal Interface

Cultures placentaire et déciduale organe humain pour l&#39;étude des infections à l&#39;interface materno-fœtale

The placenta shows a large degree of interspecies anatomic variability. To best understand biology and pathophysiology of the human placenta, it is ...

Determining Immune System Suppression versus CNS Protection for Pharmacological Interventions in Autoimmune Demyelination

Détermination Suppression du système immunitaire contre la protection du système nerveux central pour les interventions pharmacologiques dans démyélinisation autoimmune

A major hallmark of the autoimmune demyelinating disease multiple sclerosis (MS) is immune cell infiltration into the brain and spinal cord resulting in ...