Name: induction of maternal immune activation in mice at mid-gestation stage with viral mimic poly(i:c)
Uploaded: 2016-03-25T13:00:00
Description: Watch this Scientific Journal Video about Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C at JoVE.com

ברצוננו לכבד את פול ה פטרסון המנוח ד&quot;ר על תרומתו התקדמות המודל MIA, אוטיזם, סכיזופרניה ומחקר. אנו מכירים סרקיס ק Mazmanian עבור אהדתו הגדולה על פרוטוקול זה; רובן מ באיון, איווט גרסיה-פלורס, קארן ג Lencioni, ולסלי א נוימן לסיוע מינהלי; עלי Khoshnan ויאן ג Ko על הסיוע על הצילומים; איליין י סיאו ונטליה Malkova עבור עצתם על אינדוקציה MIA; ג&#39;פרי ס Cochrane, חואקין גוטיירז, קוואן פ לי, חיימה רודריגז, לורנה ג סנדובל, ונטלי א Verduzco לגידול צאן המומחה שלהם. עבודה זו נתמכה על ידי פרס מרכז NIH קונטה (NIH 5P50MH086383-04, לפול ח פטרסון); Autism Speaks (# 7670, לפול ח פטרסון); סימונס קרן (# 322,839, כדי סרקיס ק Mazmanian); אימון NIH גרנט (NIH / NRSA T32GM07616 כדי ק-HC); מלגת מחקר לתואר ראשון קיץ Caltech (SURF) (כדי ZY); Amgen חוקרים תוכנית בקלטק (כדי ZY); ו fr אחוות דוקטוריםאום הלאומית למדע המועצה, טייוואן (המל&quot;ל 101-2917-I-564-039, לו&#39;-LW).

כל הפרוטוקולים בוצעו תחת האישור של המכון בקליפורניה של טיפול בבעלי חיים מוסדי טכנולוגית ועדת השימוש (IACUC). 1. הכנה עבור זוגות מתוזמן-הזדווגות <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> השתמש לפחות 6 סכרים עבור ניסויים התנהג?...

<ol>
	<li>Brown, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiologic+studies+of+exposure+to+prenatal+infection+and+risk+of+schizophrenia+and+autism.">Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism.</a> Dev Neurobiol. 72 (10), 1272-1276 (2012).</li><li>Fatemi, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+viral+theory+of+schizophrenia+revisited:+abnormal+placental+gene+expression+and+structural+changes+with+lack+of+evidence+for+H1N1+viral+presence+in+placentae+of+infected+mice+or+brains+of+exposed+offspring.">The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring.</a> Neuropharmacology. 62 (3), 1290-1298 (2012).</li><li>Shi, L., Tu, N., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+influenza+infection+is+likely+to+alter+fetal+brain+development+indirectly:+the+virus+is+not+detected+in+the+fetus.">Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus.</a> Int J Dev Neurosci. 23 (2-3), 299-305 (2005).</li><li>Knuesel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+abnormal+brain+development+across+CNS+disorders.">Maternal immune activation and abnormal brain development across CNS disorders.</a> Nat Rev Neurol. 10 (11), 643-660 (2014).</li><li>Meyer, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+poly(i:C)+exposure+and+other+developmental+immune+activation+models+in+rodent+systems.">Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems.</a> Biol Psychiatry. 75 (4), 307-315 (2014).</li><li>Meyer, U., Feldon, J., Yee, B. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+the+fetal+brain+cytokine+imbalance+hypothesis+of+schizophrenia.">A review of the fetal brain cytokine imbalance hypothesis of schizophrenia.</a> Schizophr Bull. 35 (5), 959-972 (2009).</li><li>Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+prenatal+infection+on+brain+development+and+behavior:+a+review+of+findings+from+animal+models.">Effects of prenatal infection on brain development and behavior: a review of findings from animal models.</a> Brain Behav Immun. 24 (6), 881-897 (2010).</li><li>Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+an+autism+risk+factor+in+mice+leads+to+permanent+immune+dysregulation.">Modeling an autism risk factor in mice leads to permanent immune dysregulation.</a> Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).</li><li>Ito, H. T., Smith, S. E., Hsiao, E., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+nonspatial+information+processing+in+the+hippocampus+of+the+adult+offspring.">Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring.</a> Brain Behav Immun. 24 (6), 930-941 (2010).</li><li>Smith, S. E., Li, J., Garbett, K., Mirnics, K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+fetal+brain+development+through+interleukin-6.">Maternal immune activation alters fetal brain development through interleukin-6.</a> J Neurosci. 27 (40), 10695-10702 (2007).</li><li>Shi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+alters+cerebellar+development+in+the+offspring.">Activation of the maternal immune system alters cerebellar development in the offspring.</a> Brain Behav Immun. 23 (1), 116-123 (2009).</li><li>Hsiao, E. Y., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+induces+endocrine+changes+in+the+placenta+via+IL-6.">Activation of the maternal immune system induces endocrine changes in the placenta via IL-6.</a> Brain Behav Immun. 25 (4), 604-615 (2011).</li><li>Wu, W. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+interaction+between+maternal+immune+activation+and+alpha+7+nicotinic+acetylcholine+receptor+in+regulating+behaviors+in+the+offspring.">The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring.</a> Brain Behav Immun. , (2015).</li><li>Garay, P. A., Hsiao, E. Y., Patterson, P. H., McAllister, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+causes+age-+and+region-specific+changes+in+brain+cytokines+in+offspring+throughout+development.">Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development.</a> Brain Behav Immun. 31, 54-68 (2013).</li><li>Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., Mirnics, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+maternal+immune+activation+on+gene+expression+patterns+in+the+fetal+brain.">Effects of maternal immune activation on gene expression patterns in the fetal brain.</a> Transl Psychiatry. 2, e98 (2012).</li><li>Hsiao, E. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbiota+modulate+behavioral+and+physiological+abnormalities+associated+with+neurodevelopmental+disorders.">Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders.</a> Cell. 155 (7), 1451-1463 (2013).</li><li>Naviaux, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antipurinergic+therapy+corrects+the+autism-like+features+in+the+poly(IC)+mouse+model.">Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model.</a> PLoS One. 8 (3), e57380 (2013).</li><li>Pratt, L., Ni, L., Ponzio, N. M., Jonakait, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+inflammation+promotes+fetal+microglial+activation+and+increased+cholinergic+expression+in+the+fetal+basal+forebrain:+role+of+interleukin-6.">Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6.</a> Pediatr Res. 74 (4), 393-401 (2013).</li><li>Schwartzer, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+strain+specific+interactions+in+the+development+of+autism-like+behaviors+in+mice.">Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice.</a> Transl Psychiatry. 3, e240 (2013).</li><li>Khan, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+effects+of+maternal+immune+activation+on+depression-like+behavior+in+the+mouse.">Long-term effects of maternal immune activation on depression-like behavior in the mouse.</a> Transl Psychiatry. 4, e363 (2014).</li><li>Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., Finlay, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+transformations+of+neurodevelopmental+sequences+across+mammalian+species.">Modeling transformations of neurodevelopmental sequences across mammalian species.</a> J Neurosci. 33 (17), 7368-7383 (2013).</li><li>Abazyan, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+interaction+of+mutant+DISC1+and+immune+activation+produces+adult+psychopathology.">Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology.</a> Biol Psychiatry. 68 (12), 1172-1181 (2010).</li><li>Meyer, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adult+behavioral+and+pharmacological+dysfunctions+following+disruption+of+the+fetal+brain+balance+between+pro-inflammatory+and+IL-10-mediated+anti-inflammatory+signaling.">Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling.</a> Mol Psychiatry. 13 (2), 208-221 (2008).</li><li>Vuillermot, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+immune+activation+interacts+with+genetic+Nurr1+deficiency+in+the+development+of+attentional+impairments.">Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments.</a> J Neurosci. 32 (2), 436-451 (2012).</li><li>Bechard, A., Nicholson, A., Mason, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Litter+size+predicts+adult+stereotypic+behavior+in+female+laboratory+mice.">Litter size predicts adult stereotypic behavior in female laboratory mice.</a> J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).</li><li>Harvey, L., Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stereological+comparison+of+GAD67+and+reelin+expression+in+the+hippocampal+stratum+oriens+of+offspring+from+two+mouse+models+of+maternal+inflammation+during+pregnancy.">A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy.</a> Neuropharmacology. 62 (4), 1767-1776 (2012).</li></ol>

MIA אינדוקציה בחלונות זמן שונים מדאיגה אירועי התפתחות המוח שונים במכרסמים, וכתוצאה מכך מובילה ליקויי neuropathologies התנהגותיים שונים אצל צאצאיהם. כאן, אנו תארנו פרוטוקול לגרום MIA בעכברים עם פולי (אני: C) הזרקה ב E12.5. שיטה זו של אינדוקצית MIA מובילה התנהגותי, נוירולוגיות, אימונו?...

הרעיון של הפעלת החיסון האמהית (MIA) מקורו מחקרים באפידמיולוגיה על הקשר בין זיהום אימהי עם אוטיזם וסכיזופרניה 1. בשל העדר של פתוגנים ויראליים שכפול לגילוי בשליה או במוח העוברי לאחר זיהום ויראלי אימהי 2,3, השפעת הזיהום על הצאצאים משערת להיגרם על ידי הפעלת המערכת האימהית החיסון ולא פתוגנים עצמם . כדי להבהיר את היחס אפקט-ו-הגורם בין MIA והפרעות פסיכיאטריות, הזרקת מסונתז כימית, polyinosinic גדילי RNA כפול ויראלי לחקות: חומצה polycytidylic (פולי (אני: C)) לתוך מכרסמים בהריון כבר בשימוש נרחב כמו במודל חיה עבור MIA 4,5. פולי (אני: C) הוא מוכר על ידי קולטן לחיוג כמו 3 (TLR3), ומנהל מערכתי של פולי (אני: C) גורם לתגובה דלקתית חריפה ויראלי דמוי. אחד המנגנונים שבאמצעותם פולי (אני: C) יחסי ציבורליקויי neuropathologies התנהגותי oduces אצל צאצאיהם הם לגרום לחוסר איזון של ציטוקינים דלקתיים פרו ואנטי בציר האימהי-שליה-העוברי 6. כמה קבוצות אימצו את המודל MIA להבין את האטיולוגיה של הפרעות פסיכיאטריות 7, ובשל אינטרסים מגוונים בקרב קבוצות מחקר, בנקודות זמן שונות של הפעלה חיסונית שימשו להשיג הפרעות שונות על התפתחות המוח והתנהגויות 7. המעבדה פול ה פטרסון במכון הטכנולוגי של קליפורניה מאמצת את האסטרטגיה של הזרקת פולי (אני: C) לעכברים בהריון עובריים 12.5 ימים (E12.5), אשר הוכיחה בהצלחה כי MIA הוא מסוגל גרימת התנהגותי, נוירולוגיות, ושינויים אימונולוגיים אצל צאצאיהם המשויכים אוטיזם וסכיזופרניה 8-11. העבודות הקודמות שלנו מראות כי צאצאי MIA להציג ליקויים התנהגותיים (למשל, impairmen החברתיt, גירעון תקשורת, התנהגות שחוזרת על עצמו, התנהגות כמו חרדה, ונסתרי עיכוב גירעון 8,10,12), חוסר איזון dysregulation וציטוקינים חיסוני 8,13,14, שינוי של ביטוי גנים במוח עוברי 15, אובדן של תאי פורקינג ב lobule VII של מוח קטן 11, שינוי של נכסים הסינפטי בהיפוקמפוס 9, אינטראקצית סביבת x גן 13, שינוי של חדירות מעי, ורכב חיידקים במעיים 16. יתר על כן, אסטרטגיות טיפוליות-מונעות מפותחות גם 13,16,17 מערכת מודל זה. גרימת MIA ב E12.5, ואחרים הראו כי MIA מייצרת ההפעלה microglial עוברית שינוי התפתחותי כולינרגית בקידמתו הבזליים 18, אינטראקציה ספציפית זן 19, המוח מוחין synaptosomal מומים ultrastructural, מומים hyperfunction שרשרת הנשימה במיטוכונדריה מוחין, downregulation של מולקולות synaptosomal מוחין 17 ,התנהגויות דיכאוניות דמוי, ירידת קוגניציה הגברה לטווח ארוך בהיפוקמפוס (LTP), והגירעון הנוירוגנזה בהיפוקמפוס מבוגר 20. כאן, אנו מספקים שיטה מפורטת של איך לגרום MIA ב E12.5 ידי פולי (אני: C), כמו גם פרדיגמות של איך ליישם מודל זה ללמוד את האטיולוגיה של אוטיזם וסכיזופרניה. חשוב לציין כי MIA הוא גורם סיכון עבור מגוון רחב של הפרעות 4, ותוצאותיה רגישות במיוחד את הזמן ואת שיטת האינדוקציה וכן הבעלים של הסכרים בהריון. ככזה, אפילו סתירות קלות בין מעבדות לעתים לגרום שחזור נמוך ו / או פנוטיפים שונים אצל צאצאיהם. השיטה שלנו היא תוכננה במיוחד עבור אלו המעוניינים ללמוד MIA כגורם סיכון סביבתי לאוטיזם וסכיזופרניה, ואת התיאור המפורט הניתנים יסייע לחוקרים לשפר השחזור של הנתונים שלהם.

<table border="0" cellpadding="0" cellspacing="0" width="711">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:283px;">Polyinosinic&#8211;polycytidylic acid potassium salt</td>
			<td style="width:129px;">SIGMA</td>
			<td style="width:167px;">P9582</td>
			<td style="width:133px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">0.9% sodium chloride INJ. USP</td>
			<td>HOSPIRA</td>
			<td>NDC 0409-4888-10</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MONOJECT insuline syrinage 3/10 mL 29G x 1/2&#34;</td>
			<td>COVIDIEN</td>
			<td>8881600145</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">50 ml conical screw cap tubes</td>
			<td>USA SCIENTIFIC</td>
			<td>1500-1211</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nanodrop 1000 spectrophotometer</td>
			<td>THERMO SCIENTIFIC</td>
			<td>1000</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Stereomicroscope</td>
			<td>Wild Heerbrugg</td>
			<td>M5A</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dumont #5 Forceps Inox Tip Size .10 X .06mm</td>
			<td>Roboz</td>
			<td>RS-5045</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNAlater RNA stabilization reagent</td>
			<td>Qiagen</td>
			<td>76104</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TRIzol reagent</td>
			<td>Life Technologies</td>
			<td>15596-026&#160;</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RQ1 Rnase-free DNase</td>
			<td>Promega</td>
			<td>M610A</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iScript cDNA synthesis kit</td>
			<td>Bio-Rad</td>
			<td>170-8891</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastStart universal SYBR green master mix with ROX&#160;</td>
			<td>Roche</td>
			<td>4913922001</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Real-time PCR</td>
			<td>ABI</td>
			<td>7300</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: Il6 forward</td>
			<td>Life Technologies</td>
			<td>TAGTCCTTCCTACCCCAATTTCC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: Il6 Reverse</td>
			<td>Life Technologies</td>
			<td>TTGGTCCTTAGCCACTCCTTC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: beta-actin forward</td>
			<td>Life Technologies</td>
			<td>AGAGGGAAATCGTGCGTGAC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: beta-actin Reverse</td>
			<td>Life Technologies</td>
			<td>CAATAGTGATGACCTGGCCGT</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MicroAmp optical 96-well reaction plate</td>
			<td>Life Technologies</td>
			<td>4306737</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MicroAmp optical adhesive film&#160;</td>
			<td>Life Technologies</td>
			<td>4311971</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EthoVision</td>
			<td>Noldus</td>
			<td>EthoVision</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SR-LAB apparatus (PPI)</td>
			<td>San Diego Instruments&#160;</td>
			<td>SR-LAB</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Marbles</td>
			<td>PENN-PLAX</td>
			<td>Blue gem stones marbles</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dulbecco&#39;s Phosphate-Buffered Saline (DPBS)</td>
			<td>Life Technologies</td>
			<td>21600-069</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Paraformaldehyde</td>
			<td>MACRON</td>
			<td>2621-59</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Vibratome</td>
			<td>Leica</td>
			<td>VT1000 S</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium azide</td>
			<td>Sigma</td>
			<td>S2002</td>
			<td>Optionl</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Triton x-100</td>
			<td>Sigma</td>
			<td>X100</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hydrogen peroxide solution</td>
			<td>Sigma</td>
			<td>18312</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Goat serum</td>
			<td>Vector Laboratories</td>
			<td>S-1000</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rabbit anti-calbindin antibody</td>
			<td>Abcam</td>
			<td>ab11426</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Biotinlyated goat anti-rabbit IgGantibody</td>
			<td>Vector Laboratories</td>
			<td>BA-1000</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">VECTASTAIN ABC Kit</td>
			<td>Vector Laboratories</td>
			<td>PK-4000</td>
			<td>Optionl</td>
		</tr>
	</tbody>
</table>

induction of maternal immune activation in mice at mid-gestation stage with viral mimic poly(i:c)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.

<html> הזרקה של 20 מ&quot;ג / קילו פולי (אני: C) ב E12.5 יכולה לעורר תגובה דלקתית חריפה בציר האימהי-שליה-עוברית לזרז השפעה כרונית להתפתחות מוח פנוטיפים התנהגותיים 12,13. רמות גבוהות של ציטוקינים מעודדי דלקת, Interleukin (IL) -6, הוא אינדיקטור אמין של תגובה דלקתית חרי?...

Watch this Scientific Journal Video about Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C at JoVE.com

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

אינדוקציה של הפעלה האימהית חיסונית בעכברים בשלב אמצע הריון עם ויראלי לחקות פולי (אני: C)

Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

The overall goal of this procedure is to induce maternal immune activation, or MIA, in mice by intraperitoneal injection of the viral mimic poly at the mid-gestational embryonic stage. This method can help us answer key questions in a neuro-immunology field, such as, how immune dysfunction can lead to perturbations in brain development and behavior. The main advantage of this technique is that it's specifically designed for researchers interested in studying MIA as an environmental risk factor for autism and schizophrenia.Generally, individuals new to this method will struggle, because small differences in the MIA induction method can significantly alter the downstream response in the offspring. To set up a timed mating pair, begin by housing five female mice per cage next to each other in standard mouse cages to synchronize their estra cycles, and use an ear punch to label each animal. Zero to two hours before the dark cycle begins, house the female mice two to a cage, and weigh and record the body weight of each individual mouse, then add one male mouse per cage of two female mice.Zero to four hours after the dark cycle ends, gently lift each female mouse by the base of the tail, allowing the animal to grip the cage grid with the forepaws, to determine the existence of a whitish mass in the vaginal opening. If a plug is not apparent, gently insert a 200 microliter pipette tip into the vaginal opening. Resistance from coagulation confirms the formation of a plug.Group the plugged mice into a new cage, as the presence of a vaginal plug confirms only that copulation has occurred. On embryonic days 10.5 to 11.5, lift each plugged female mouse by the base of the tail, and look for a bulge in the abdomen, then weigh the mice to verify the pregnancy, and house the pregnant animals in individual clean cages. Weigh the poly(I:C)powder in a 50 milliliter conical.On embryonic day 12.5, add the appropriate volume of 0.9%sodium chloride to the corresponding volume of poly(I:C)in a conical tube, and close the cap. Gently roll the saline droplet over the powder until the solution is clear. then centrifuge the tube, and transfer the poly(I:C)solution to a microcentrifuge tube.Use a spectrophotometer to measure the 260 to 280 ratio of the poly(I:C)solution. The ratio should be between 1.54 and 1.82, as described by the manufacturer. Next, weigh the first mouse and load a 0.3 milliliter insulin syringe with the corresponding calculated volume of poly(I:C)solution.Then, picking the mouse up by the tail, place it on the cage top, and secure it by the scruff. Now insert the needle, bevel side up, into the center of the two upper nipples at approximately 20 degrees relative to the mouse, and administer the poly(I:C)solution. Then place the mouse back into the cage.After all of the mice have been injected, house the cages in a quiet, low-traffic room to avoid other confounding effects, and weigh the mice the next morning. At least three days before the behavioral testing, change the cage bedding of the eight to 12 week old adult maternal immune activation or MIA offspring. 30 minutes before the test, acclimate the mice to the testing room.For a pre-pulse inhibition test, restrain the mice in plexiglass cylinders on top of a piezoelectric sensor. Acclimate the mouse to the pre-pulse inhibition chamber for five minutes, with six trials of 120 decibels of white noise. Then expose the mice to randomized mixtures of sound, as outlined in the table, and compare the results to the baseline startle response, to determine the pre-pulse inhibition of the MIA animals.For an open field test, place a mouse in the corner of an open square arena, with a defined 17 by 17 centimeter center zone, and record the trajectory of the mouse for 10 minutes, through a ceiling-mounted camera. Then quantify the center zone entries, and the time spent in the center zone. For a marble burying test, acclimate a mouse to a test cage, with compressed five centimeter deep, clean aspen pine bedding for 10 minutes, then place the mouse back in the home cage, and gently arrange 20 navy blue 1.5 centimeter diameter glass marbles in a four by five grid in the test cage.Now return the mouse to the test cage for 10 minutes, then place the animal back in the home cage, and count the number of marbles that were buried during the test period. Poly(I:C)injection at embryonic day 12.5 can evoke an acute inflammatory response in the maternal placental fetal axis, and precipitate a chronic effect on brain development and behavioral phenotypes. Indeed, poly(I:C)induces a higher Il6 gene expression in the maternal spleen, placenta, and fetal brain, three hours post-injection.Generally, when compared to saline-treated adult offspring, MIA adult offspring exhibit fewer center zone entries, and a shorter center zone duration in the open field test. The poly(I:C)injected animals also display more frequent burying behaviors in the marble burying test, and a lower pre-pulse inhibition. The loss of Purkinje cells in the cerebellum lobule seven is another hallmark of MIA offspring, with fewer calbindin positive Purkinje cells observed in the cerebellum lobule seven of these animals, compared to saline injected controls.While attempting this procedure, it's important to remember not to disturb the pregnant mice after MIA induction. Afterward, additional factors such as postnatal stress or infection can be induced to study additional environment environment interactions.

Research

JoVE Journal

Immunology and Infection

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

Induction of Experimental Autoimmune Hypophysitis in SJL Mice

אינדוקציה של Hypophysitis אוטואימוניות הניסויי עכברים SJL

Autoimmune hypophysitis can be reproduced experimentally by the injection of pituitary proteins mixed with an adjuvant into susceptible mice1. Mouse ...

Seven Steps to Stellate Cells

שבעה צעדים Stellate תאים

Hepatic stellate cells are liver-resident  cells of star-like morphology and are located in the space of Disse between  liver sinusoidal endothelial cells ...

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

מדידת עומס בקטריאלי ותגובות החיסון של עכברים נגועים עם חיידקי ליסטריה</em

Listeria monocytogenes (Listeria) is a Gram-positive facultative intracellular pathogen1. Mouse studies typically employ intravenous injection of ...

Right Ventricular Systolic Pressure Measurements in Combination with Harvest of Lung and Immune Tissue Samples in Mice

מדידות נכונות חדרית סיסטולי לחץ בשילוב עם קציר של ריאה ודגימות רקמה חיסוניות בעכברים

The function of the right heart is to pump blood through the lungs, thus linking right heart physiology and pulmonary vascular physiology. Inflammation is ...

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

הביתור מולדת איתות חיסון בהתחמקות ויראלי של ציטוקין ייצור

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

אינדוקציה של Murine דלקת מעיים על ידי העברת המאמצת של מפעיל CD4<sup&gt; +</sup&gt; CD45RB<sup&gt; גבוה</sup&gt; תאי T לעכברי immunodeficient

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages ...

Isolation of Leukocytes from the Murine Tissues at the Maternal-Fetal Interface

בידוד של לויקוציטים מרקמות Murine בממשק האם והעובר

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing ...

Induction of Experimental Autoimmune Encephalomyelitis in Mice and Evaluation of the Disease-dependent Distribution of Immune Cells in Various Tissues

אינדוקציה של ניסיוני אוטואימוניות Encephalomyelitis עכברים וההערכה של הפצת מחלות התלויה של תאים חיסוניים ברקמות שונות

Multiple sclerosis is presumed to be an inflammatory autoimmune disease, which is characterized by lesion formation in the central nervous system (CNS) ...

Human Placental and Decidual Organ Cultures to Study Infections at the Maternal-fetal Interface

שלית Decidual אדם תרבויות איברים ללמוד זיהומים בבית הממשק האם והעובר

The placenta shows a large degree of interspecies anatomic variability. To best understand biology and pathophysiology of the human placenta, it is ...

Determining Immune System Suppression versus CNS Protection for Pharmacological Interventions in Autoimmune Demyelination

דיכוי מערכת החיסון קביעת לעומת להגנת CNS להתערבויות פרמקולוגיים demyelination אוטואימוניות

A major hallmark of the autoimmune demyelinating disease multiple sclerosis (MS) is immune cell infiltration into the brain and spinal cord resulting in ...