Name: multi-exon skipping using cocktail antisense oligonucleotides in the canine x-linked muscular dystrophy
Uploaded: 2016-05-24T13:00:00
Duration: 10 min 30 s
Description: Watch this Scientific Journal Video about Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy at JoVE.com

This work was supported by The University of Alberta Faculty of Medicine and Dentistry, The Friends of Garrett Cumming Research Chair Fund, HM Toupin Neurological Science Research Chair Fund, Muscular Dystrophy Canada, Canada Foundation for Innovation (CFI), Alberta Advanced Education and Technology (AET), Canadian Institutes of Health Research (CIHR), Jesse's Journey - The Foundation for Gene and Cell Therapy, and the Women and Children's Health Research Institute (WCHRI).

Open access fees for this article were provided by, Gene Tools, LLC.

Exon skipping is a promising therapeutic technique for the treatment of DMD. Both in vitro and in vivo experiments have shown that multi-exon skipping is feasible. Here, the use of the CXMD dog model is discussed. First, AONs were designed using the Rescue-ESE and ESEfinder programs to target dystrophin exons 6 - 8. The 2&#39;OMePS AON chemistry was used for CXMD myoblast transfection and the morpholino AON backbone chemistry was chosen for in vivo experiments. vPMOs are more efficient than unmodified PMOs but due to their higher toxicity they are not suitable for systemic injections. RNA extraction, RT-PCR, and cDNA sequencing were performed on the CXMD myoblasts. Dogs injected with the PMO cocktail were clinically graded to assess any improvement in&#160;clinical symptoms. After the dogs were humanely euthanized, muscle samples were taken and prepared for cryo-sectioning.&#160;The half-life of dystrophin protein induced by AONs is believed to be approximately 1 - 2 months. Young adult dogs were used in this study, although these experiments can be done with neonatal dogs and older dogs (&#62;5 years old). Prepared muscle sections were used to evaluate histopathology and assess dystrophin protein rescue through Western blotting and immunohistochemistry48.
It is important to ensure that the volume of the PMO solution is correct before injections; failing to do so will have significant effects on results. During intramuscular injections, sufficient pressure is required to enter the muscle fibers. Monitoring of dog health and inspection of the surgery site are important for troubleshooting. To monitor animal health, weekly blood tests and weighing should be performed. After euthanization of the animal and preparation of muscle samples, a critical step for ensuring sensitivity in detecting dystrophin protein is to use both the Tris-acetate gel and semi-dry blotting method during the Western blotting procedure.
As shown in the representative results, myoblasts treated with Ex6A, Ex6B, Ex8A, and the cocktail (containing Ex6A, Ex6B, Ex8A, and Ex8B) produced in-frame DMD products. Since Ex8B produced no exon-skipped products, it was not used in subsequent in vivo experiments. cDNA sequencing showed that exons 6 - 9 skipping occurred and immunocytochemistry with DYS-2 staining showed restored dystrophin expression in treated samples. AON-treated dogs showed a significant increase in dystrophin-positive fibers. This indicates that exons 6 - 8 were being skipped and a shortened protein was produced. The amount of dystrophin-positive fibers increased when a cocktail of AONs was used and was proportional to AON dosage. Immunoblots showed increased dystrophin expression in systemic morpholino-treated dogs. Skeletal muscle had variable levels of dystrophin fibers; however, morpholino-treated heart tissue showed little improvement in dystrophin expression. Since dystrophin has a high molecular weight (427 kDa), detection of low amounts of dystrophin can be difficult. For the best results, Tris-acetate gel and the semi-dry transfer method were used. HE staining showed improved histopathology in the morpholino-treated dogs. Centrally-nucleated fibers (CNFs) are a sign of unhealthy muscle and represent cycles of muscle degeneration and regeneration. Morpholino-treated CXMD dogs showed a decrease in the percentage of CNFs in comparison to non-treated CXMD dogs. Clinical grading revealed an improvement in symptoms, such as increased walking and running ability, in morpholino-treated animals. The hardness of muscles is believed to reflect muscle atrophy, thus, it was included in the grading scheme&#160;59. The hardness of thigh (hind-limb) muscles was evaluated; however, we excluded cranial sartorius muscles because they tend to exhibit hypertrophy rather than atrophy in CXMD. Treated dogs showed lower grading scores and had faster times on the 15 m running test. Improved times on the 15 m test are indicative of improved muscle function 40. Higher overall grading scores indicate poor health and increased muscle atrophy.
While these results are promising, multi-exon skipping still presents many challenges that will need to be overcome before the technique has clinical applicability. Cardiac tissue still displays reduced uptake of AONs, likely due to the difference in cellular trafficking between cardiac and skeletal tissue. No toxic effects have been observed in animals under current dosage regimens; however, more work needs to be done to assess long-term toxicity before the use of AON cocktails can move to clinical trials. It is difficult to gain approval for AON cocktail drugs because regulatory agencies define each AON sequence as a unique drug. This means that each sequence in a cocktail would need to be individually tested for safety, requiring more time and more money. Another barrier to the use of multi-exon skipping in a clinical setting is a&#160;large amount of intermediate protein products produced with unknown functions. These proteins can potentially lead to unpredictable side-effects, depending on the individual mutation 22. Additionally, the mutation patterns available within current dystrophic dog models are limited. There are few naturally-occurring mutations, and not all mutations are useful for studying multi-exon skipping. The dystrophic pig model promises to be a good alternative for future DMD exon skipping studies 33, 34.
The DMD dog models have some advantages over other DMD models. Being a larger animal model, clinical grading and MRI are possible, allowing for more detailed analysis. Since dogs are large animals they are also more suited for toxicology studies and more closely represent the human disease in comparison to the mouse model. Dog models also have DMD gene sequences that are more similar to humans 23, 34, 45.
Although technically challenging, the multi-exon skipping approach could&#160;ultimately benefit &#62;90% of DMD patients 24. This makes it a much better alternative to single-exon skipping, as single-exon skipping is only applicable to a small subset of patients. In addition, multi-exon skipping will enable us to select the deletion patterns that optimize the functionality of the shortened dystrophin proteins. For example, deletion&#160;of&#160;DMD exons 45 - 55 is associated with exceptionally mild symptoms or asymptomatic individuals 14,19,60-63. The multi-exon skipping of exons 45 - 55 has already been demonstrated in a mouse model of DMD with an exon 52 deletion (mdx52) using systemic injections of vPMOs 22,26. The use of cocktail vPMOs has also been demonstrated in other forms of muscular dystrophy, such as Fukuyama congenital muscular dystrophy (FCMD). FCMD is caused by exon trapping, in which aberrant mRNA splicing is caused by retrotransposon insertion. vPMOs have been shown to rescue the splicing pattern in both an FCMD mouse model and in human cell lines 64. Next-generation AON chemistries exhibiting higher efficacy and lower toxicity would facilitate the effective translation of the multi-exon skipping approach into clinical application. Additionally, multi-exon skipping could potentially be applied to other genetic disorders, such as the dysferlinopathies 24, 65.

Duchenne muscular dystrophy (DMD) is an X-linked recessive muscle disease characterized by progressive muscle weakness, first described by Dr. Guillaume-Benjamin-Amand Duchenne (de Boulogne) 1. DMD is a common genetic disease affecting about 1 in 3,500 boys worldwide, with approximately 20,000 affected children born each year 2,3. Motor development is delayed and gait disturbances are seen in early childhood 4, followed by wheelchair dependency at about the early teens. Death typically occurs between the ages of 20 and 30 due to respiratory or cardiac failure 5-8. There is currently no cure for DMD. Treatment with glucocorticoids can slow the progression of muscle degeneration to some degree but is associated with significant side effects, including obesity and diabetes mellitus 2,7,8. DMD results from mutations in the dystrophin (DMD) gene, leading to a loss of functional dystrophin protein. DMD is an extremely large gene with over 2 million base pairs and 79 exons 9,10. Deletion, nonsense, and duplication mutations leading to out-of-frame mutations are the most common cause of the DMD phenotype. The regions of exons 3 - 9 and exons 45 - 55 are termed &#34;mutation hotspots&#34; as most patients have deletion mutations within these portions of the gene, leading to non-functional dystrophin in DMD patients 3,9,11-16. Dystrophin functions within the dystrophin-glycoprotein complex (DGC), which has a major role in muscle membrane stabilization. The N- and C-termini are the most important domains for function, while the central rod domain plays a less important role 3,9,17. The observance of a mild phenotype associated with Becker muscular dystrophy (BMD), which mostly results from in-frame mutations within the DMD gene, inspired the application of exon skipping for treating DMD. BMD patients have a shortened, but functional, dystrophin protein that maintains both termini 3,6,18. Exon skipping, in theory, can restore the reading frame, resulting in shortened-but-functional dystrophin proteins similar to those seen in BMD 3,19.
Multiple types of antisense oligonucleotides (AONs) have been tested in clinical trials, including 2&#39;O-methylated phosphorothioates (2&#39;OMePS) and phosphorodiamidate morpholino oligomers (PMOs). Skipping exons 51 and 53 using these AONs has been examined and while results are promising, single-exon skipping has limited applicability, as it is mutation-specific 3, 19, 20,21, 22-26. Questions also remain about the stability of the resulting shortened dystrophin proteins produced from single-exon skipping 22,23. Additionally, some patients require more than a single exon to be skipped in order to restore the reading frame 3. While technically more difficult, multi-exon skipping is one method that could address these problems 3,19. Multi-exon skipping has previously been demonstrated in dystrophic dog and human cell lines in vitro. Additionally, mdx52 mouse and canine X-linked muscular dystrophy (CXMD) dog models have been used for in vivo studies 22,24-27. Canine X-linked muscular dystrophy Japan (CXMDJ)&#160;beagles were used here, as the reading frame of CXMDJ can be restored by multi-exon skipping of exons 6 and 8, or additional exons (e.g., exons 3 - 9) (Figure 1). Beagle-based CXMD shares the same mutation pattern as the Golden Retriever muscular dystrophy (GRMD) model, but beagles are smaller and cheaper to maintain due to their body size, thus providing a useful model for DMD 28,29. CXMD dogs more closely mimic the human DMD phenotype than smaller animal models, like rodent, and are more reliable for toxicological assessments 3,22,30,31 (Figure 2). CXMD dogs display progressive muscle decay, gait disturbances, and cardiac and respiratory problems similar to those seen in DMD. Compared with single-exon skipping, multi-exon skipping is applicable to a much larger proportion of patients. Among the three most common mutation types (deletions, nonsense, and duplications), 80 - 98% of patients could be treated through multi-exon skipping 14,32,33, while 45% of all DMD patients could benefit from specifically skipping exons 45 - 55&#160;&#160;3,19,22,34.
With the development of modified morpholinos, the efficiency of AON cocktails at facilitating exon skipping has improved. Arginine-rich cell-penetrating peptide-conjugated PMOs (PPMOs), and vivo-morpholinos (vPMOs) are AON chemistries that have significantly improved cell-penetrating ability&#160;and stability 3,35-38. Concerns remain about long-term AON toxicity; however, significant progress has been made. Chemical modifications made to morpholinos greatly decrease off-target effects and pre-clinical studies have reported no significant toxic effects 3,22,39,40. A remaining challenge for multi-exon skipping is the current requirement for each single AON to be tested for toxicity alone, as a single drug,&#160;instead of together as a cocktail 3,19,22,41,42. In DMD studies involving both single and multi-exon skipping targeted to the heart, there has been little improvement in dystrophic heart tissue. The efficacy of morpholinos in the heart is thought to be low because of poor cell-penetrating ability. Peptide-conjugated PPMOs have improved the ability of&#160;AONs to penetrate cardiac cells, increasing the amount of functional dystrophin protein rescued in the heart 3,19,38.
Here, our AON cocktail approach is discussed at length, including the design of AON sequences using ESEfinder software 43. Protocols for dog experiments with multi-exon skipping are also described. CXMDJ beagles were used for exons 6 and 8 skipping experiments. Multi-exon skipping in the CXMD dog model shows promising results, but challenges remain that need to be overcome before they are clinically applicable.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="2">2&#39;OMePS Transfection of Dog Myoblasts&#160;</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>3ml 6 welled plates</td>
			<td>IWAKI</td>
			<td>5816-006&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#8217;s modified Eagle&#8217;s medium (DMEM)&#160;</td>
			<td>Gibco</td>
			<td>11965-092</td>
			<td></td>
		</tr>
		<tr>
			<td>fetal bovine serum (FBS)&#160;</td>
			<td>HyClone</td>
			<td>SH30071.01</td>
			<td></td>
		</tr>
		<tr>
			<td>&#160;Penicillin&#160;</td>
			<td>Sigma-Aldrich&#160;</td>
			<td>P4333&#160;</td>
			<td>&#160;200 U/mL&#160;</td>
		</tr>
		<tr>
			<td>Lipofectin&#160;</td>
			<td>Invitrogen&#160;</td>
			<td>18292-011</td>
			<td>Total volume of 100 mL in opti-MEM media at a ratio of 2:1 for lipofectin.&#160; 
			10 mL lipofectin for 5 mg RNA.&#160;</td>
		</tr>
		<tr>
			<td>2&#8217;OMePS</td>
			<td>Eurogentec&#160;</td>
			<td></td>
			<td>&#160;Ex6A (GUU GAUUGUCGGACCCAGCUCAGG), Ex6B (ACCUAUGA CUGUGGAUGAGAGCGUU), and Ex8A (CUUCCUGG AUGGCUUCAAUGCUCAC).&#160;</td>
		</tr>
		<tr>
			<td>Horse Serum&#160;</td>
			<td>Gibco</td>
			<td>16050-114</td>
			<td>2%</td>
		</tr>
		<tr>
			<td>streptomycin&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>P4333&#160;</td>
			<td>200 ug/mL</td>
		</tr>
		<tr>
			<td>Bovine serum albumin (BSA)&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>A9418&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>Insulin&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td colspan="2">Morpholino transfection of dog myoblasts&#160;</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td colspan="4">All material from MePS Transfection of Dog Myoblasts&#160; for culturing</td>
		</tr>
		<tr>
			<td>Antisense morpholinos&#160;</td>
			<td>Gene-tools</td>
			<td></td>
			<td>
			Ex6A(GTTGATTGTCGGACCCAGC 
			TCAGG), 
			Ex6B(ACCTATGACTGTGGATGAG 
			AGCGTT),&#160; 
			Ex8A(CTTCCTGGATGGCTTCAAT 
			GCTCAC)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; 
			Dilute to a final volume of 100L in opti-MEM media.&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; 
			120&#8211;200 mg/kg of morpholinos at 32 mg/mL in saline
			</td>
		</tr>
		<tr>
			<td>Endo-Porter</td>
			<td>Gene-tools</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>guanidinium thiocyanate-phenol-chloroform</td>
			<td>Invitrogen</td>
			<td>15596-018</td>
			<td>1mL/plate</td>
		</tr>
		<tr>
			<td colspan="4">RNA Extraction and Reverse Transcription Polymerase Chain Reaction (RT-PCR)</td>
		</tr>
		<tr>
			<td>guanidinium thiocyanate-phenol-chloroform</td>
			<td>Invitrogen</td>
			<td>15596-018</td>
			<td>1mL/plate</td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>Sigma-Aldrich</td>
			<td>P3803</td>
			<td>200 uL&#160;</td>
		</tr>
		<tr>
			<td>1.5 ml Tubes&#160;</td>
			<td>Eppendorf</td>
			<td>22363204</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifudge&#160;</td>
			<td colspan="2">Beckman-Coulter</td>
			<td></td>
		</tr>
		<tr>
			<td>75% Ethanol&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>34852</td>
			<td></td>
		</tr>
		<tr>
			<td>UV Spectrometer&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Forward primer in exon 5&#160;</td>
			<td>Invitrogen</td>
			<td></td>
			<td>CTGACTCTTGGTTTGATTTGGA&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; 
			1.5 mL 10 mM</td>
		</tr>
		<tr>
			<td>Reverse primer in exon 10&#160;</td>
			<td>Invitrogen</td>
			<td></td>
			<td>TGCTTCGGTCTCTGTCAATG&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; 
			1.5 L 10 mM</td>
		</tr>
		<tr>
			<td>dNTPS</td>
			<td>Clontech</td>
			<td>3040</td>
			<td></td>
		</tr>
		<tr>
			<td>One-Step RT-PCR kit&#160;</td>
			<td>Qiagen&#160;</td>
			<td>210210</td>
			<td></td>
		</tr>
		<tr>
			<td>Thermo-cycler</td>
			<td>Scinco</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td colspan="2">Complementary DNA (cDNA) Sequencing&#160;</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Gel extraction kit&#160;</td>
			<td>Qiagen&#160;</td>
			<td>28704</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifudge&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>&#160;Terminator v3.1 Cycle Sequencing Kit&#160;</td>
			<td>Applied Biosystems&#160;</td>
			<td>4337454</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="3">&#160;Intramuscular injections or open muscle biopsy</td>
			<td></td>
		</tr>
		<tr>
			<td>Surgical Tools</td>
			<td></td>
			<td></td>
			<td>Scissors, Scapal, needle, surgical thread&#160;</td>
		</tr>
		<tr>
			<td>Vet Ointment&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Iodophors&#160;</td>
			<td>webtextiles</td>
			<td>12190-71-5</td>
			<td></td>
		</tr>
		<tr>
			<td>chlorohexidine</td>
			<td>Peridex</td>
			<td>12134</td>
			<td></td>
		</tr>
		<tr>
			<td>Surgical Drapes&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Srubs</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Facial Mask&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Surgical Gloves&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Head Covering&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Thiopental sodium&#160;</td>
			<td>Mitsubishi Tanabe Pharma&#160;</td>
			<td></td>
			<td>20 mg/kg&#160;</td>
		</tr>
		<tr>
			<td>Isoflurane</td>
			<td>Abbott laboratories&#160;</td>
			<td>05260-05</td>
			<td>2-3%</td>
		</tr>
		<tr>
			<td>Antisense morpholinos&#160;</td>
			<td>Gene-tools</td>
			<td></td>
			<td>Ex6A(GTTGATTGTCGGACCCAGC 
			TCAGG), 
			Ex6B(ACCTATGACTGTGGATGAG 
			AGCGTT),&#160; 
			Ex8A(CTTCCTGGATGGCTTCAAT 
			GCTCAC)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; 
			Dilute to a final volume of 100 L in opti-MEM media.&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; 
			120&#8211;200 mg/kg of morpholinos at 32 mg/mL in saline</td>
		</tr>
		<tr>
			<td>27G Needles&#160;</td>
			<td>TERUMO&#160;</td>
			<td>SG3-2325&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>50 mL syringe&#160;</td>
			<td>TERUMO</td>
			<td>SG2-03L2225&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>buprenorphine hydrochloride</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Tougne Depressor&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>cephalexin</td>
			<td></td>
			<td>15 to 30 mg/kg&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>cefazolin</td>
			<td></td>
			<td>15 to 30 mg/kg&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>buprenorphine&#160;</td>
			<td></td>
			<td>0.01 mg/kg</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="2">&#160;buprenorphine hydrochloride&#160;</td>
			<td>0.02 mg/kg</td>
			<td></td>
		</tr>
		<tr>
			<td>Systemic Injections</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Syringe infusion pump&#160;</td>
			<td>Muromachi&#160;</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>22G Indwelling needles</td>
			<td>TERUMO</td>
			<td>SG3-2225&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>27G Needles&#160;</td>
			<td>TERUMO&#160;</td>
			<td>SG3-2325&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>50 mL syringe&#160;</td>
			<td>TERUMO</td>
			<td>SG2-03L2225&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>Saline</td>
			<td>Ohtsuka-Pharmaceutical</td>
			<td>28372</td>
			<td></td>
		</tr>
		<tr>
			<td>Clinical Grading of Dogs</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Video Camera&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Stop watch&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Magnetic resonance imaging (MRI)&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>3 Tesla MRI l&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>18 cm diameter/18 cm length human extremity coi</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td colspan="3">Muscle sampling and preparation (necropsy)</td>
			<td></td>
		</tr>
		<tr>
			<td>Thiopental sodium&#160;</td>
			<td>Mitsubishi Tanabe Pharma&#160;</td>
			<td></td>
			<td>20 mg/kg&#160;</td>
		</tr>
		<tr>
			<td>Isoflurane</td>
			<td>Abbott laboratories&#160;</td>
			<td>05260-05</td>
			<td>2-3%</td>
		</tr>
		<tr>
			<td>Tragacanth gum</td>
			<td></td>
			<td></td>
			<td>10-20 mL</td>
		</tr>
		<tr>
			<td>Liqoud Nitrogrn&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Cork Discs</td>
			<td>Iwai-kagaku&#160;</td>
			<td>101412-806</td>
			<td></td>
		</tr>
		<tr>
			<td>Dry Ice</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Tweezers</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Poly-l-lysine&#8211;coated slides&#160;</td>
			<td>Fisher</td>
			<td>22-037-216</td>
			<td></td>
		</tr>
		<tr>
			<td>Cryostat Microsystem&#160;</td>
			<td>Leica&#160;</td>
			<td></td>
			<td>cm1900&#160;</td>
		</tr>
		<tr>
			<td>Immunohistochemistry&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>DYS1&#160;</td>
			<td>Novocastra&#160;</td>
			<td>NCL-DYS1&#160;</td>
			<td>1:150 dilutions&#160;</td>
		</tr>
		<tr>
			<td>DYS2</td>
			<td>Novocastra&#160;</td>
			<td>NCL-DYS2&#160;</td>
			<td>1:150 dilutions</td>
		</tr>
		<tr>
			<td>Alexa 594 goat antimouse IgG1&#160;</td>
			<td>Invitrogen</td>
			<td>A-21125</td>
			<td>1:2,500 dilutions</td>
		</tr>
		<tr>
			<td>Alexa 594 goat antimouse IgG2&#160;</td>
			<td>Invitrogen</td>
			<td>A-11005</td>
			<td>1:2,500 dilutions</td>
		</tr>
		<tr>
			<td>DAPI&#160;</td>
			<td>Invitrogen</td>
			<td>D1306</td>
			<td>Contans mounting agent</td>
		</tr>
		<tr>
			<td>Goat Serum&#160;</td>
			<td>Invitrogen</td>
			<td>10000C</td>
			<td>15%</td>
		</tr>
		<tr>
			<td>PBS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Moisture chamber&#160;</td>
			<td>Scientific Devise Laboratory&#160;</td>
			<td>197-BL</td>
			<td></td>
		</tr>
		<tr>
			<td>Chamber slide&#160;</td>
			<td>Lab-tek&#160;</td>
			<td>154453</td>
			<td></td>
		</tr>
		<tr>
			<td>Cover Glasses&#160;</td>
			<td>Fisher</td>
			<td>12-540A</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrophobic barrier pen&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Flpurescent microcope&#160;</td>
			<td></td>
			<td></td>
			<td>594 nm at 20X magnification.&#160;</td>
		</tr>
		<tr>
			<td>Western Blotting&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Distillied Water&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Hand Homogenizer&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>2&#215; Laemmli SDS-loading buffer&#160;</td>
			<td></td>
			<td></td>
			<td>0.1 M Tris&#8211;HCl (pH 6.6), 2% (w/v) SDS, 2% (0.28 M) beta-mercaptoethanol, 20% glycerol, 0.01% bromophenol blue&#160;</td>
		</tr>
		<tr>
			<td>SDS gels&#160;</td>
			<td>Bio-Rad&#160;</td>
			<td>161-1210</td>
			<td>5% resolving</td>
		</tr>
		<tr>
			<td>SDS gels</td>
			<td>Invitrogen&#160;</td>
			<td>Invitrogen, WG1601BOX</td>
			<td>3-8%</td>
		</tr>
		<tr>
			<td>PVDF membrane&#160;</td>
			<td>GE</td>
			<td>10600021</td>
			<td></td>
		</tr>
		<tr>
			<td>Methanol</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Transfer buffer (10&#215;)&#160;</td>
			<td></td>
			<td></td>
			<td>250 mM of Tris-Base, 1,920 mM of Glycine</td>
		</tr>
		<tr>
			<td>Transfer buffer (1&#215;)</td>
			<td></td>
			<td></td>
			<td>10% 10&#215; buffer, 20% methanol&#160;</td>
		</tr>
		<tr>
			<td>0.05% PBS/Tween 20 (PBST)&#160;</td>
			<td></td>
			<td></td>
			<td>2,000 mL&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; 
			3&#215; 200 mL for washing</td>
		</tr>
		<tr>
			<td>PBST/5% milk powder&#160;</td>
			<td></td>
			<td></td>
			<td>100 mL</td>
		</tr>
		<tr>
			<td>Protein Assay Kit</td>
			<td>BCA</td>
			<td>T9650</td>
			<td></td>
		</tr>
		<tr>
			<td>Tween 20&#160;</td>
			<td>Sigma&#160;</td>
			<td>P5927</td>
			<td></td>
		</tr>
		<tr>
			<td>Urea</td>
			<td>Sigma&#160;</td>
			<td>U5378</td>
			<td></td>
		</tr>
		<tr>
			<td>Beta Mercaptoethanol&#160;</td>
			<td>Millipore</td>
			<td>ES-007-E</td>
			<td></td>
		</tr>
		<tr>
			<td>SDS</td>
			<td>Sigma</td>
			<td>L3771</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-Acetate</td>
			<td>Sigma</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Tris HCL</td>
			<td>Sigma</td>
			<td>T3253</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>Sigma</td>
			<td>G8773</td>
			<td></td>
		</tr>
		<tr>
			<td>Loading/sample buffer for Western blotting</td>
			<td>NuPage Invitrogen</td>
			<td>NP007</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Sigma</td>
			<td>S3014</td>
			<td></td>
		</tr>
		<tr>
			<td>PMSF</td>
			<td>Sigma</td>
			<td>P7626</td>
			<td></td>
		</tr>
		<tr>
			<td>Protease cocktail inhibitor&#160;</td>
			<td>Roche</td>
			<td>11836153001</td>
			<td></td>
		</tr>
		<tr>
			<td>Cathode Buffer</td>
			<td></td>
			<td></td>
			<td>.025 M Tris base + 40 mM 6-aminocaproic acid + 20% Methanol</td>
		</tr>
		<tr>
			<td>Anode Buffer</td>
			<td></td>
			<td></td>
			<td>0.03 M Tris Base + 20% Methanol</td>
		</tr>
		<tr>
			<td>Concentred Anode Buffer</td>
			<td></td>
			<td></td>
			<td>0.3 M Tris base + 20 % Methanol</td>
		</tr>
		<tr>
			<td>desmin antibody&#160;</td>
			<td>Abcam</td>
			<td>ab8592</td>
			<td></td>
		</tr>
		<tr>
			<td>DYS1&#160;</td>
			<td>Novocastra&#160;</td>
			<td>NCL-DYS1&#160;</td>
			<td>1:150 dilutions&#160;</td>
		</tr>
		<tr>
			<td>Image J Software</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

multi-exon skipping using cocktail antisense oligonucleotides in the canine x-linked muscular dystrophy

Duchenne muscular dystrophy (DMD) is one of the most common lethal genetic diseases worldwide, caused by mutations in the dystrophin (DMD) gene. Exon skipping employs short DNA/RNA-like molecules called antisense oligonucleotides (AONs) that restore the reading frame and produce shorter but functional proteins. However, exon skipping therapy faces two major hurdles: limited applicability (up to only 13% of patients can be treated with a single AON drug), and uncertain function of truncated proteins. These issues were addressed with a cocktail AON approach. While approximately 70% of DMD patients can be treated by single exon skipping (all exons combined), one could potentially treat more than 90% of DMD patients if multiple exon skipping using cocktail antisense drugs can be realized. The canine X-linked muscular dystrophy (CXMD) dog model, whose phenotype&#160;is&#160;more similar to human DMD patients, was&#160;used to test the systemic efficacy and safety of multi-exon skipping of exons 6 and 8. The CXMD dog model harbors a splice site mutation in intron 6, leading to a lack of exon 7 in dystrophin mRNA. To restore the reading frame in CXMD requires multi-exon skipping of exons 6 and 8; therefore, CXMD is a good middle-sized animal model for testing the efficacy and safety of multi-exon skipping. In the current study, a cocktail of antisense morpholinos targeting exon 6 and exon 8 was designed and it restored dystrophin expression in body-wide skeletal muscles. Methods for transfection/injection of cocktail oligos and evaluation of the efficacy and safety of multi-exon skipping in the CXMD dog model are presented.

In Vitro Experiments
Myoblasts were transfected with various 2&#39;OMePS treatment conditions in order to compare the effectiveness of each AON. Single AON treatments with 600 nM each of Ex6A, Ex6B, Ex8A, or&#160;Ex8B were done, as well as a cocktail treatment with 600 nM each of all 4 AON sequences. RNA samples were collected four days after transfection. After RT-PCR, samples for each treatment were run on a gel along with non-treated (NT) samples. Bands higher on the gel represent out-of-frame DMD products; these bands were seen in NT, Ex8A, and Ex8B treated myoblasts. Ex6A, Ex6B, Ex8A, and the cocktail-treated myoblasts showed in-frame products. The cocktail and Ex6A/B showed 100% in-frame products, while Ex8A showed only 30% in-frame products (Figure 7). To confirm exon skipping and restoration of the reading frame, cDNA sequencing was performed; the results indicated that exons 6 - 9 had indeed been skipped (Figure 7). Immunohistochemistry showed that AON-treated dogs&#160;had increased dystrophin-positive fibers compared to NT samples (Figure 8).
In Vivo Experiments
To compare the efficiency of various AON treatment conditions, CXMD dogs (0.5 - 5&#160;years&#160;old) were injected once with 1.2 mg Ex6A or a cocktail of Ex6A, Ex6B, and Ex8A at various dosages. Two weeks after the injection, muscle samples were collected and stained with DYS-1 to compare the number of dystrophin-positive fibers. All cocktail-treated samples showed increased dystrophin expression compared to NT samples. Dystrophin-positive fibers increased with AON dosage (Figure 9). Following systemic injection, wild-type (WT), NT, and cocktail-treated CXMD muscle samples were stained with DYS-1 (Figure 10). Cocktail-treated CXMD dogs showed increased dystrophin expression compared to NT CXMD dogs, both in CT and heart muscle samples. However, AON-treated skeletal muscle (CT) showed much higher expression of dystrophin compared to treated cardiac muscle. An immunoblot comparing WT, NT, and various morpholino cocktail-treated muscles led to the same conclusion. There was also a large range of dystrophin expression in the treated skeletal muscle samples (Figure 10). Hematoxylin and eosin (HE) staining revealed that treated CXMD dogs showed improved histopathology, with a significant decrease in centrally-nucleated fibers (CNF) in comparison to NT CXMD dogs (Figure 11). This indicates there is more degeneration/regeneration occurring in the NT dog, a sign of dystrophic muscle pathology. Additionally, treated dogs had faster running times and improved scores on the clinical grading scale. Treated CXMD dogs showed better scores than NT CXMD dogs in all categories (Figure 12).
<img alt="Figure 1" src="/files/ftp_upload/53776/53776fig1.jpg" /> 
Figure 1. Mutation Pattern of the CXMD Dog and Exons 6 - 8 Skipping Strategies Using an Antisense Cocktail. CXMD dogs have a point mutation in exon 6 leading to a loss of exon 7 in dystrophic dog mRNA. This results in the mRNA being out-of-frame and dystrophin protein production is lost. Short AON sequences are designed to bind to exon 6 and 8, which results in mRNA splicing effectively skipping exons 6 - 8. The gray bar in the AON cocktail-treated dogs represents short AON sequences. Exon 9 encodes a hinge domain and is sometimes spontaneously spliced out with AONs against exon 6 and 8. The resulting mRNA codes for dystrophin proteins that are shorter&#160;but functional. <a href="https://www.jove.com/files/ftp_upload/53776/53776fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/53776/53776fig2.jpg" /> 
Figure 2. Major Clinical Symptoms of a 1-year-old Canine X-linked Muscular Dystrophy (CXMD) Animal. A 1-year-old wild-type beagle and a CXMD dog are shown. The involvement of proximal, limb, and temporal muscles are typically observed from 2 months of age. Joint contracture and a shifting of the pelvis are overt from 4 months of age. <a href="https://www.jove.com/files/ftp_upload/53776/53776fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/53776/53776fig3.jpg" /> 
Figure 3. General Anesthesia for a Dog. A) Intramuscular injections and muscle biopsies are performed under general anesthesia with isoflurane. B) Holding of the animal for systemic injections. <a href="https://www.jove.com/files/ftp_upload/53776/53776fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/53776/53776fig4.jpg" /> 
Figure 4. Magnetic Resonance Imaging (MRI) of Wild-type, Non-treated CXMD, and Treated CXMD. MRI scans of the hind limb at 3 months and 5 months in WT and NT CXMD dogs. Two&#160;sample images of treated CXMD hind limb MRIs pre- (1 week before the first injection) and post-injection of AON are shown. 2703MA was treated 7x&#160;weekly with 200 mg/kg cocktail morpholinos. 2001MA was treated with 5x&#160;weekly IV injection of 120 mg/kg cocktail morpholinos. Control and treated dogs were age-matched. Treated dogs show decreased T2 signals. Images are adapted with permission from Yokota et al. (copyright 2009, John Wiley &#38; Sons) 40 <a href="https://www.jove.com/files/ftp_upload/53776/53776fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" src="/files/ftp_upload/53776/53776fig5.jpg" /> 
Figure 5. Muscle Biopsy Procedure for a Dog. A) A lower limb is fixed for muscle biopsy. B) With the help of forceps, the lower limb is held. C) The CT muscle is exposed. Open biopsy technique is used to obtain muscle samples of injected sites. Threads are used to hold biopsy samples. D) Muscle samples on tragacanth gum after dissection. <a href="https://www.jove.com/files/ftp_upload/53776/53776fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" src="/files/ftp_upload/53776/53776fig6.jpg" /> 
Figure 6. Semi-dry Transfer Method. A representation of the semi-dry transfer method for Western blotting is presented. Three papers soaked in concentrated anode buffer are laid down at the negative terminal; 3 papers soaked in anode buffer are stacked on top of this. The Mb PVDF paper is soaked in methanol and then anode buffer before being laid on top of the 6 papers. The gel, which has been soaked in cathode buffer, is laid gently over the PVDF paper. Finally, 3 papers soaked in cathode buffer are laid on top of the gel. The positive terminal is set on top. For 1 hr, 400 mA is run through the system. <a href="https://www.jove.com/files/ftp_upload/53776/53776fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 7" src="/files/ftp_upload/53776/53776fig7.jpg" /> 
Figure 7. Exon Skipping in CXMD Myoblasts. CXMD myoblasts were transfected with Ex6A, Ex6B, Ex8A, or Ex8B alone, or a cocktail of all four. A total of 600 nM was used for the individual sequences and for the cocktail 600 nM of each sequence was used. A) 2&#39;OMePS treatment in CXMD dog myoblasts. Ex6A, Ex6B, and the cocktail-treated samples show strong bands at the expected position of in-frame exon-skipped transcripts. Ex8A shows an intermediate band, Ex8B shows a weak band, and NT does not show a band at the in-frame position. B) cDNA sequencing from Ex6A alone, 4 days after transfection. Images are adapted with permission from Yokota et al. (copyright 2009, John Wiley &#38; Sons) 40. <a href="https://www.jove.com/files/ftp_upload/53776/53776fig7large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 8" src="/files/ftp_upload/53776/53776fig8.jpg" /> 
Figure 8. Increased Dystrophin Expression in 2&#39;O-methylated Phosphorothioate (2&#39;OMePS) Transfected CXMD Myoblasts. CXMD myoblasts were transfected with Ex6A alone or with cocktail 2&#39;OMePS. DYS-2 (red) and DAPI (blue) staining are shown. The treated myoblasts are compared to wild-type (WT) and non-treated (NT) myoblasts. Images are adapted with permission from Yokota et al. (copyright 2009, John Wiley &#38; Sons) 40. Bar = 50 &#181;m. <a href="https://www.jove.com/files/ftp_upload/53776/53776fig8large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 9" src="/files/ftp_upload/53776/53776fig9.jpg" /> 
Figure 9. Rescue of Dystrophin Expression with Intramuscular Injections of Morpholinos in CXMD Dogs. Either Ex6A alone or a cocktail of Ex6A, Ex6B, and Ex8A were injected into the CT muscles of CXMD dogs. Dystrophin (DSY-1) staining of wild-type (WT), non-treated (NT), and treated CXMD dogs are shown. Dogs were either treated with 1.2 mg Ex6A alone or 1.2 mg cocktail. Images are adapted with permission from Yokota et al. (copyright 2009, John Wiley &#38; Sons) 40. Bar = 100 &#181;m. <a href="https://www.jove.com/files/ftp_upload/53776/53776fig9large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 10" src="/files/ftp_upload/53776/53776fig10.jpg" /> 
Figure 10. Increased Dystrophin Expression After Systemic Cocktail Morpholino Treatment in CXMD Dogs. Dystrophin (DYS-1) staining was used to compare dystrophin expression in wild type (WT) (positive control), non-treated (NT)&#160;(negative control), and CXMD dogs treated with 120 mg/kg morpholino cocktail (40 mg/kg of each AON). The morpholino cocktail contained Ex6A, Ex6B, and Ex8A. Dogs were injected intravenously 5 times weekly with this cocktail. A) A comparison of dystrophin expression in cranial tibial (CT) muscles of WT, NT, and treated dogs. B) A comparison of dystrophin expression in heart tissue between NT and morpholino cocktail-treated dogs. C) Immunoblot for dystrophin with desmin as a loading control is shown for WT, NT, and morpholino cocktail-treated dogs. The following muscles are shown for treated dogs: triceps brachii (TB), biceps brachii (BB), diaphragm (DIA), esophagus (ESO), CT, adductor (ADD), extensor digitorum longus (EDL), masseter (MAS), and heart. Images are adapted with permission from Yokota et al. (copyright 2009, John Wiley &#38; Sons) 40. Bar = 200 &#181;m. <a href="https://www.jove.com/files/ftp_upload/53776/53776fig10large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 11" src="/files/ftp_upload/53776/53776fig11.jpg" /> 
Figure 11. Improved Histopathology in CXMD Dogs Treated For 7 Weeks&#160;with 240 mg/kg Morpholino Cocktail. CXMD dogs ranging from half a year to five years old were injected intravenously with 240 mg/kg morpholino cocktail (Ex6A, Ex6B, and Ex8A) once a week for 7 weeks. Fourteen days after the last injection, esophagus muscles were taken and hematoxylin and eosin (HE) staining was done. HE staining of esophagus muscles from non-treated (NT) and morpholino cocktail-treated (Treated) CXMD dogs&#160;(40X objective lens). <a href="https://www.jove.com/files/ftp_upload/53776/53776fig11large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 12" src="/files/ftp_upload/53776/53776fig12.jpg" /> 
Figure 12. Improved Scores on Clinical Grading and 15 m Running Time After Morpholino Treatment. Morpholino-treated dogs were compared to non-treated (NT) littermates. Error bars in the graph indicate SEM. A) Total score on the clinical grading exam was calculated before and after treatment and treated animals were compared with NT littermates. B) A comparison of 15 m running times of treated and NT dogs. C) Similar to B;&#160;however, younger dogs were used. Images are adapted with permission from Yokota et al. (copyright 2009, John Wiley &#38; Sons) 40. <a href="https://www.jove.com/files/ftp_upload/53776/53776fig12large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Antisense Oligonucleotide&#160;</td>
			<td>Nucleotide Sequence&#160;</td>
		</tr>
		<tr>
			<td>Ex6A&#160;</td>
			<td>GTTGATTGTCGGACCCAGCTCAGG</td>
		</tr>
		<tr>
			<td>Ex6B</td>
			<td>ACCTATGACTGTGGATGAGAGCGTT</td>
		</tr>
		<tr>
			<td>Ex8A</td>
			<td>CTTCCTGGATGGCTTCAATGCTCAC</td>
		</tr>
	</tbody>
</table>
Table 1.&#160;Antisense Oligonucleotide Design.

Watch this Scientific Journal Video about Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy at JoVE.com

Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy

Exon skipping is currently a&#160;most promising therapeutic option for Duchenne muscular dystrophy (DMD). To expand the applicability for DMD patients and to optimize the stability/function of the resulting truncated dystrophin proteins, a multi-exon skipping approach using cocktail antisense oligonucleotides was developed and we demonstrated systemic dystrophin rescue in a dog model.

Duchenne muscular dystrophy (DMD) is one of the most common lethal genetic diseases worldwide, caused by mutations in the dystrophin (DMD) gene. Exon ...

Research

JoVE Journal

Medicine

In Vivo Canine Muscle Function Assay

In Vivo Canine Muscle Function Assay

We describe a minimally-invasive and reproducible method to measure canine pelvic limb muscle strength and muscle response to repeated eccentric 
...

Cell-based Assay Protocol for the Prognostic Prediction of Idiopathic Scoliosis Using Cellular Dielectric Spectroscopy

This protocol details the experimental and analytical procedure for a cell-based assay developed in our laboratory as a functional test to predict the ...

Generation of Induced Pluripotent Stem Cells from Muscular Dystrophy Patients: Efficient Integration-free Reprogramming of Urine Derived Cells

Dystrophic cardiomyopathy is a poorly understood consequence of muscular dystrophy. Generating induced Pluripotent Stem Cells (iPSCs) from patients with ...

Modeling Myotonic Dystrophy 1 in C2C12 Myoblast Cells

Myotonic dystrophy 1 (DM1) is a common form of muscular dystrophy. Although several animal models have been established for DM1, myoblast cell models are ...

Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study ...

Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts

Spinal muscular atrophy (SMA), a lethal neurological disease caused by the loss of SMN1, presents a unique case in the field of antisense oligonucleotide ...

Ferric Chloride-induced Canine Carotid Artery Thrombosis: A Large Animal Model of Vascular Injury

Occlusive arterial thrombosis leading to cerebral ischemic stroke and myocardial infarction contributes to ~13 million deaths every year globally. Here, ...

Measurements of Motor Function and Other Clinical Outcome Parameters in Ambulant Children with Duchenne Muscular Dystrophy

While the number of new treatment options tested in patients with Duchenne muscular dystrophy (DMD) is increasing, there is still no defining of the most ...

Characterizing Exon Skipping Efficiency in DMD Patient Samples in Clinical Trials of Antisense Oligonucleotides

Duchenne muscular dystrophy (DMD) is a degenerative muscle disease that causes progressive loss of muscle mass, leading to premature death. The mutations ...

Using a Chemical Biopsy for Graft Quality Assessment

Kidney transplantation is a life-saving treatment for a large number of people with end-stage renal dysfunction worldwide. The procedure is associated ...