Name: microscopy-based assays for high-throughput screening of host factors involved in brucella infection of hela cells
Uploaded: 2016-08-05T14:00:00
Description: Watch this Scientific Journal Video about Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells at JoVE.com

This work was supported by grants 51RT 0_126008 and 51RTP0_151029 for the Research and Technology Development (RTD) project InfectX and TargetInfectX, respectively, in the frame of SystemsX.ch, the Swiss Initiative for Systems Biology. We acknowledge grant 310030B_149886 from the Swiss National Science Foundation (SNSF). Work of S.H.L and A.C. was supported by the International PhD Program "Fellowships for Excellence" of the Biozentrum. Simone Muntwiler is acknowledged for technical assistance. We would like to thank Dirk Bumann for providing pNF106 and Jean Celli for pJC43 and pJC44.

Nota: Tutti i lavori con Live Brucella abortus ceppi deve essere eseguita all&#39;interno di un laboratorio di biosicurezza di livello 3 (BSL3) considerando tutte le normative richieste e le precauzioni di sicurezza. 1. Preparazione delle lastre di screening e la coltura di batteri e cellule <ol><li> Preparazione di Brucella abortus colture starter <ol><li> Streak Brucella abortus 2308 (B. abortus) da -80 ° C latte magazzino su un piatto Tryptic Soy Aga...

<ol>
	<li>Pappas, G., Papadimitriou, P., Akritidis, N., Christou, L., Tsianos, E. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+new+global+map+of+human+brucellosis.">The new global map of human brucellosis.</a> Lancet Infect Dis. 6, 91-99 (2006).</li><li>Atluri, V. L., Xavier, M. N., de Jong, M. F., den Hartigh, A. B., Tsolis, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+of+the+human+pathogenic+Brucella+species+with+their+hosts.">Interactions of the human pathogenic Brucella species with their hosts.</a> Annu Rev Microbiol. 65, 523-541 (2011).</li><li>Guzman-Verri, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GTPases+of+the+Rho+subfamily+are+required+for+Brucella+abortus+internalization+in+nonprofessional+phagocytes:+direct+activation+of+Cdc42.">GTPases of the Rho subfamily are required for Brucella abortus internalization in nonprofessional phagocytes: direct activation of Cdc42.</a> J Biol Chem. 276, 44435-44443 (2001).</li><li>Starr, T., Ng, T. W., Wehrly, T. D., Knodler, L. A., Celli, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brucella+intracellular+replication+requires+trafficking+through+the+late+endosomal/lysosomal+compartment.">Brucella intracellular replication requires trafficking through the late endosomal/lysosomal compartment.</a> Traffic. 9, 678-694 (2008).</li><li>Boschiroli, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Brucella+suis+virB+operon+is+induced+intracellularly+in+macrophages.">The Brucella suis virB operon is induced intracellularly in macrophages.</a> Proc Natl Acad Sci U S A. 99, 1544-1549 (2002).</li><li>Celli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brucella+evades+macrophage+killing+via+VirB-dependent+sustained+interactions+with+the+endoplasmic+reticulum.">Brucella evades macrophage killing via VirB-dependent sustained interactions with the endoplasmic reticulum.</a> J Exp Med. 198, 545-556 (2003).</li><li>Porte, F., Liautard, J. P., Kohler, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+acidification+of+phagosomes+containing+Brucella+suis+is+essential+for+intracellular+survival+in+murine+macrophages.">Early acidification of phagosomes containing Brucella suis is essential for intracellular survival in murine macrophages.</a> Infect Immun. 67, 4041-4047 (1999).</li><li>Anderson, T. D., Cheville, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructural+morphometric+analysis+of+Brucella+abortus-infected+trophoblasts+in+experimental+placentitis.+Bacterial+replication+occurs+in+rough+endoplasmic+reticulum.">Ultrastructural morphometric analysis of Brucella abortus-infected trophoblasts in experimental placentitis. Bacterial replication occurs in rough endoplasmic reticulum.</a> Am J Pathol. 124, 226-237 (1986).</li><li>Qin, Q. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+screen+of+endoplasmic+reticulum-associated+host+factors+reveals+a+role+for+IRE1alpha+in+supporting+Brucella+replication.">RNAi screen of endoplasmic reticulum-associated host factors reveals a role for IRE1alpha in supporting Brucella replication.</a> PLoS Pathog. 4, e1000110 (2008).</li><li>Ramo, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+analysis+of+large-scale+RNAi+screens+for+pathogen+entry.">Simultaneous analysis of large-scale RNAi screens for pathogen entry.</a> BMC genomics. 15, 1162 (2014).</li><li>Kuhbacher, A., Gouin, E., Cossart, P., Pizarro-Cerda, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+InlC+secretion+to+investigate+cellular+infection+by+the+bacterial+pathogen+Listeria+monocytogenes.">Imaging InlC secretion to investigate cellular infection by the bacterial pathogen Listeria monocytogenes.</a> J Vis Exp. , e51043 (2013).</li><li>Kentner, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shigella+reroutes+host+cell+central+metabolism+to+obtain+high-flux+nutrient+supply+for+vigorous+intracellular+growth.">Shigella reroutes host cell central metabolism to obtain high-flux nutrient supply for vigorous intracellular growth.</a> Proc Natl Acad Sci U S A. 111, 9929-9934 (2014).</li><li>Celli, J., Salcedo, S. P., Gorvel, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brucella+coopts+the+small+GTPase+Sar1+for+intracellular+replication.">Brucella coopts the small GTPase Sar1 for intracellular replication.</a> Proc Natl Acad Sci U S A. 102, 1673-1678 (2005).</li><li>von Bargen, K., Gorvel, J. P., Salcedo, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Internal+affairs:+investigating+the+Brucella+intracellular+lifestyle.">Internal affairs: investigating the Brucella intracellular lifestyle.</a> FEMS microbiology reviews. 36, 533-562 (2012).</li><li>Kamentsky, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+structure,+function+and+compatibility+for+CellProfiler:+modular+high-throughput+image+analysis+software.">Improved structure, function and compatibility for CellProfiler: modular high-throughput image analysis software.</a> Bioinformatics. 27, 1179-1180 (2011).</li></ol>

Bacterial pathogens have evolved numerous strategies to manipulate eukaryotic host cells to their benefit. Pathogens causing acute infections often show rapid proliferation which is accompanied by significant alarming of the immune system and loss of viability of infected cells. In contrast, Brucella and other pathogens that cause chronic infections manage to establish long-lasting interactions within host cells. Therefore, bacteria need to fine tune host cell functions to their benefit without disrupting cellul...

Specie Brucella sono gram-negativi, patogeni intracellulari facoltativi appartenenti alla classe di α-Proteobacteria. Sono causa di aborti e sterilità nei loro ospiti naturali come bovini, capre, pecore o causando gravi perdite economiche in aree endemiche. La brucellosi è una delle più importanti malattie zoonotiche in tutto il mondo causando oltre mezzo milione di nuovi casi di infezione umana ogni anno 1. Trasmissione a umano è più comunemente causata dal contatto diretto con animali infetti o per ingestione di alimenti contaminati come il latte non pastorizzato. I sintomi della malattia febbrile sono aspecifici, che provoca difficoltà nella diagnosi di brucellosi. Se non trattata, i pazienti possono sviluppare una infezione cronica con i sintomi più gravi come l&#39;artrite, endocardite, e neuropatia 2. Al livello cellulare Brucella è in grado di invadere le cellule fagocitiche e non fagocitiche e replica all&#39;interno di un intracellulareVano conosciuta come la Brucella -aventi tenore vacuolo (BCV). L&#39;internalizzazione dei batteri richiede riarrangiamenti actina citoscheletro da Rac, Rho, e l&#39;attivazione diretta di Cdc42 3. All&#39;interno della cellula ospite eucariotica, la BCV traffici lungo il percorso endocytic e nonostante l&#39;interazione con i lisosomi, i batteri riescono a evitare il degrado 4. L&#39;acidificazione della BCV dal vescicolare ATPasi è necessario per indurre l&#39;espressione di tipo batterico sistema di secrezione IV (T4SS) 5. Si ritiene che effettori batterici secreti dal T4SS sono essenziali per Brucella stabilire la sua nicchia replicativa, poiché l&#39;eliminazione del T4SS 6 o inibizione del piombo ATPasi vescicolare difetti della costituzione della nicchia intracellulare 7. I batteri non replicano durante la fase di traffico fino a quando non raggiungere un comparto vacuolare ER-derivato 8. Una volta che si verifica la proliferazione intracellulare, la BCV si trova in classociazione ose con marcatori ER quali calnexin e glucosio-6-fosfatasi 6. I meccanismi molecolari con cui Brucella entra nelle cellule, evita la degradazione lisosomiale, e, infine, replica in un vano ER-come rimangono in gran parte sconosciuti. Fattori di accoglienza che partecipano diverse fasi di infezione sono stati principalmente identificata da approcci mirati o uno schermo di piccole dimensioni small interfering RNA (siRNA) eseguita in cellule di Drosophila 9. Questi hanno fatto luce sul contributo dei singoli fattori dell&#39;ospite durante l&#39;infezione da brucella, ma siamo ancora lontani da una comprensione globale di tutto il processo. Qui, i protocolli che permettono l&#39;identificazione dei fattori dell&#39;ospite umani utilizzano su larga scala RNA interference (RNAi) di screening, in combinazione con automatizzato grande campo microscopia a fluorescenza e l&#39;analisi automatica delle immagini sono presentati. Reverse siRNA trasfezione di cellule HeLa viene eseguita come describEd in precedenza 10,11 con piccole modifiche. Il test endpoint copre gran parte del ciclo di vita intracellulare Brucella tranne l&#39;uscita e l&#39;infezione di cellule vicine. Per caratterizzare ulteriormente i risultati individuati nel test endpoint, un protocollo modificato per identificare fattori coinvolti nelle prime fasi di infezione viene utilizzato. Un ceppo abortus Brucella che esprime costitutivamente GFP è usato per il saggio finale in cui i batteri possono infettare le cellule per due giorni. Durante questo tempo, i batteri entrano nelle cellule, il traffico alla nicchia replicativa ER-derivato, e replicare nello spazio peri-nucleare. Gli alti livelli di segnale GFP possono poi essere utilizzati per rilevare in modo affidabile singole celle che contengono i batteri replicare. Per studiare voce Brucella in un saggio ad elevata prestazione, è importante essere in grado di distinguere tra batteri intracellulari ed extracellulari. Il metodo presentato qui circumvEnt anticorpi differenziale colorazione di batteri intracellulari ed extracellulari. Si basa su un ceppo Brucella esprime un GFP tetraciclina-inducibile in combinazione con espressione costitutiva DsRed. La presenza di un marcatore costitutiva DsRed consente l&#39;identificazione di tutti i batteri che sono presenti nel campione. GFP è indotta dall&#39;aggiunta del anhydrotetracycline atossico tetraciclina analogico (ATC) simultaneamente con inattivazione dei batteri extracellulari da gentamicina (Gm). Mentre la cellula-impermeabile antibiotico Gm uccide i batteri extracellulari, Atc può entrare nella cellula ospite e indurre l&#39;espressione della GFP selettivamente nei batteri intracellulari. Questa doppia giornalista permette la separazione solido di batteri intracellulari singoli (GFP e di segnale DsRed) da batteri extracellulari (solo segnale DsRed) usando la microscopia a grande campo. Al fine di raggiungere l&#39;espressione della GFP rilevabile con intracellulare Brucella abbiamo trovato che 4 ore di induzione da ATC si traduce in un reliil segnale in grado. Sistemi di induzione simili per esprimere selettivamente GFP nei batteri intracellulari è stato utilizzato in precedenza per studiare intracellulare Shigella 12.

<table border="0" cellpadding="0" cellspacing="0" width="573">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tryptic Soy Agar (TSA)</td>
			<td style="width:71px;">BD</td>
			<td style="width:119px;">236950</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tryptic Soy Broth (TSB)</td>
			<td style="width:71px;">Fluka</td>
			<td style="width:119px;">22092</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Kanamycin sulfate</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">60615</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Skim milk</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">250 ml screw cap bottle</td>
			<td style="width:71px;">Corning</td>
			<td style="width:119px;">8396</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">DMEM</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">D5796</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fetal Calf Serum (FCS)</td>
			<td style="width:71px;">Gibco</td>
			<td style="width:119px;">10270</td>
			<td style="width:167px;">Heat-inactivated</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Trypsin-EDTA (0.5%)</td>
			<td style="width:71px;">Gibco</td>
			<td style="width:119px;">15400-054</td>
			<td style="width:167px;">10x stock solution, dilute 1:10 in PBS</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Scepte 2.0 Cell Counter</td>
			<td style="width:71px;">Merck Milipore</td>
			<td style="width:119px;">PHCC20060</td>
			<td style="width:167px;">Alternative cell counting devices can be used.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Greiner CELLSTAR 384-well plate</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">M2062</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Peelable aluminum foil</td>
			<td style="width:71px;">Costar</td>
			<td style="width:119px;">6570</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Reagent dispenser: &#34;Multidrop 384 Reagent Dispenser&#34;</td>
			<td style="width:71px;">Thermo Scientific</td>
			<td style="width:119px;">5840150</td>
			<td style="width:167px;">Alternative reagent dispenser can be used.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Transfection reagent: &#34;Lipofectamine RNAiMAX</td>
			<td style="width:71px;">Invitrogen</td>
			<td style="width:119px;">13778-150</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="252">
			<td height="252" style="height:252px;width:216px;">Automated plate washer: &#34;Plate washer ELx50-16&#34;</td>
			<td style="width:71px;">BioTek</td>
			<td style="width:119px;">ELX5016</td>
			<td style="width:167px;">This plate washer contains a 16-channel manifold suitable for 384-well plates. It fits into a biosafety cabinet and has a lid covering the plate during washing which reduces the risk of aerosol production. Alternative plate washers with similar features could be used.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Gentamicin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">G1397</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Anhydrotetracycline hydrochloride</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">37919</td>
			<td style="width:167px;">100 ug/ml solution in 100% ethanol is kept at -20&#176;C protected from light in aluminum-foil</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PBS</td>
			<td style="width:71px;">Gibco</td>
			<td style="width:119px;">20012</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="168">
			<td height="168" style="height:168px;width:216px;">Paraformaldehyde</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">P6148</td>
			<td style="width:167px;">Dissolve in 0.2 M HEPES buffer, pH 7.4. Store at -20&#176;C and thaw freshly the day before use. Caution, PFA is toxic by inhalation, in contact with skin and if swallowed.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">HEPES</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">H3375</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Triton X-100</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">T9284</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DAPI</td>
			<td style="width:71px;">Roche</td>
			<td style="width:119px;">10236276001</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Scrambled siRNA</td>
			<td style="width:71px;">Dharmacon</td>
			<td style="width:119px;">D-001810-10</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Kif11 siRNA</td>
			<td style="width:71px;">Dharmacon</td>
			<td style="width:119px;">L-003317-00</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">ARPC3 siRNA</td>
			<td style="width:71px;">Dharmacon</td>
			<td style="width:119px;">L-005284-00</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Brucella abortus 2308</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:216px;">pJC43 (apHT::GFP)</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:167px;">Celli et al.12</td>
		</tr>
		<tr height="277">
			<td height="277" style="height:277px;width:216px;">pAC042.08 (apht::dsRed, tetO::tetR-GFP)</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:167px;">Construction: pJC44 4 was digested with EcoRI followed by generation of blunt ends with Klenov enzyme and subsequent digestion with SalI. TetR-GFP was amplified from pNF106 using primer prAC090 and prAC092. Following digestion with SalI, the TetR-GFP product was ligated to the digested pJC44 vector.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Primer prAC090</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;"></td>
			<td style="width:167px;">TTTTTGAATTCTGGCAATTCCGACGTCTAAGAAACC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Primer prAC092</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;"></td>
			<td style="width:167px;">TTTTTGTCGACTTTGTCCTACTCAGGAGAGCGTTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">HeLa CCL-2</td>
			<td style="width:71px;">ATCC</td>
			<td style="width:119px;">CCL-2</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="231">
			<td height="231" style="height:231px;width:216px;">ImageXpress Micro</td>
			<td style="width:71px;">Molecular Devices&#160;</td>
			<td style="width:119px;">IXM IMAGING MSCOPE</td>
			<td style="width:167px;">Automated cellular imaging microscope equipped with a precision motorized Z-stage. Alternative systems for automated microscopy and alternative components for hard- and software specified below can be employed.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">High-Speed Laser Auto-Focus</td>
			<td style="width:71px;">Molecular Devices&#160;</td>
			<td style="width:119px;">1-2300-1037</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">CFI Super Fluor 10x objective</td>
			<td style="width:71px;">Nikon&#160;</td>
			<td style="width:119px;">MRF00100</td>
			<td style="width:167px;">N.A 0.50, W.D 1.20mm, DIC Prism: 10x, Spring loaded</td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Photometrics CoolSNAP HQ Monochrome CCD Camera</td>
			<td style="width:71px;">Molecular Devices&#160;</td>
			<td style="width:119px;">1-2300-1060</td>
			<td style="width:167px;">1392 x 1040 imaging pixels, 6.45 x 6.45-&#181;m pixels, 12 bits digitization</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">MetaXpress software</td>
			<td style="width:71px;">Molecular Devices&#160;</td>
			<td style="width:119px;">9500-0100</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:216px;">LUI-Spectra-X-7</td>
			<td style="width:71px;">Lumencor</td>
			<td style="width:119px;">SPECTRA X V-XXX-YZ</td>
			<td style="width:167px;">Light engine. The following light sources are used: violet (DAPI), cyan (GFP), green/yellow (RFP)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Single Band Exciter for DAPI</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF01-377/50-25</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Single Band Emitter for DAPI</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF02-447/60-25</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Single Band Dichroic for DAPI</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF409-Di03-25x36</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Single Band Exciter for GFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF02-472/30-25</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Single Band Emitter for GFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF01-520/35-25</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Single Band Dichroic for GFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF495-Di03-25x36</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Single Band Exciter for RFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF01-562/40-25</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Single Band Emitter for RFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF01-624/40-25</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Single Band Dichroic for RFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF593-Di03-25x36</td>
			<td></td>
		</tr>
	</tbody>
</table>

microscopy-based assays for high-throughput screening of host factors involved in brucella infection of hela cells

Specie Brucella sono facoltativi patogeni intracellulari che infettano gli animali come i loro ospiti naturali. Trasmissione all&#39;uomo è più comunemente causata dal contatto diretto con animali infetti o per ingestione di alimenti contaminati e può portare a infezioni croniche gravi. Brucella può invadere fagociti professionali e non professionali e replica nel reticolo endoplasmatico (ER) vacuoli -derived. I fattori dell&#39;ospite richiesti per Brucella entrata in cellule ospiti, evitare la degradazione lisosomiale, e la replica nel vano ER-come rimangono in gran parte sconosciuti. Qui si descrivono due metodi per identificare i fattori di accoglienza che partecipano ingresso Brucella e replicazione in cellule HeLa. I protocolli descrivono l&#39;uso di RNA interferenza, mentre potrebbero essere applicati metodi di screening alternative. I saggi si basano sulla rilevazione di batteri fluorescente in cellule ospiti fluorescente con modalità automatizzatea livello di microscopia in campo. Le immagini fluorescenti vengono analizzati utilizzando un standardizzato di analisi di immagine pipeline in CellProfiler che permette singola infezione punteggio cell-based. Nel saggio finale, replica intracellulare è misurato due giorni dopo l&#39;infezione. Questo permette ai batteri di traffico al loro nicchia replicativa in cui viene avviata la proliferazione circa 12 ore dopo l&#39;entrata batterica. Brucella, che hanno stabilito con successo una nicchia intracellulare avranno così fortemente proliferato all&#39;interno delle cellule ospiti. Dal momento che i batteri intracellulari notevolmente più numerosi singoli batteri non replicativi extracellulari o intracellulari, un ceppo che esprime costitutivamente GFP può essere utilizzato. Il segnale GFP forte viene poi utilizzato per identificare le cellule infette. Al contrario, per il saggio voce è essenziale distinguere tra intracellulare e batteri extracellulari. Qui, si usa una codifica ceppo per un GFP tetraciclina-inducibile. Induzionedi GFP con inattivazione simultanea di batteri extracellulari dalla gentamicina consente la differenziazione tra intracellulare e batteri extracellulari basati sul segnale GFP, con solo batteri intracellulari poter esprimere GFP. Questo consente il rilevamento affidabile di singoli batteri intracellulari prima dell&#39;avvio proliferazione intracellulare.

La figura 1A mostra un esempio di analisi di immagini utilizzato per identificare automaticamente le cellule infettate nella prova endpoint. Nuclei di cellule HeLa colorati con DAPI sono stati identificati, sono stati calcolati un peri-nucleo di larghezza 8 pixel che circonda il nucleo, e un corpo di celle Voronoi per estensione del nucleo di 25 pixel. Poiché i batteri proliferano principalmente nello spazio peri-nucleare, l&#39;intensità GFP in questa zona della cella...

Watch this Scientific Journal Video about Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells at JoVE.com

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Two assays for microscopy-based high-throughput screening of host factors involved in Brucella infection are described. The entry assay detects host factors required for Brucella entry and the endpoint assay those required for intracellular replication. While applicable for alternative approaches, siRNA screening in HeLa cells is used to illustrate the protocols.

Saggi Microscopia-based per high-throughput screening dei fattori di accoglienza che partecipano<em&gt; Brucella</em&gt; L&#39;infezione di cellule HeLa

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by ...

Research

JoVE Journal

Immunology and Infection

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Lo screening RNAi per fattori di accoglienza che partecipano Vaccinia Infezione da virus utilizzando Drosophila Celle

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in ...

Ricerca

Immunologia e infezioni

VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

VIGS-Mediated Forward Genetica screening per la identificazione di geni coinvolti nella resistenza Nonhost


	Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important ...

A Microscopic Phenotypic Assay for the Quantification of Intracellular Mycobacteria Adapted for High-throughput/High-content Screening

Un test fenotipico microscopico per la quantificazione dei micobatteri intracellulari adattati per lo screening ad alta produttività / alto contenuto

Despite the availability of therapy and vaccine, tuberculosis (TB) remains one of the most deadly and widespread bacterial infections in the world. Since ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

High-throughput screening per largo spettro chimico inibitori di RNA virus

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

A Fluorescence-based Lymphocyte Assay Suitable for High-throughput Screening of Small Molecules

Una fluorescenza a base di linfociti Assay Adatto per high-throughput screening di piccole molecole

High-throughput screening (HTS) is currently the mainstay for the identification of chemical entities capable of modulating biochemical reactions or ...

Screening Assays to Characterize Novel Endothelial Regulators Involved in the Inflammatory Response

Saggi per caratterizzare nuovi endoteliale regolatori coinvolti nella risposta infiammatoria di screening

The endothelial layer is essential for maintaining homeostasis in the body by controlling many different functions. Regulation of the inflammatory ...

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Una piattaforma di High-throughput per lo Screening della Salmonella spp /Shigella spp.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella ...

Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

Infezioni da arbovirus come strumenti di Screening per l'identificazione di fattori virali immunomodulatori e Host antivirale

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. ...

High-throughput Measurement of Plasma Membrane Resealing Efficiency in Mammalian Cells

Misurazione di High-throughput di membrana plasmatica risigillazione efficienza in cellule di mammifero

In their physiological environment, mammalian cells are often subjected to mechanical and biochemical stresses that result in plasma membrane damage. In ...