Name: microscopy-based assays for high-throughput screening of host factors involved in brucella infection of hela cells
Uploaded: 2016-08-05T14:00:00
Description: Watch this Scientific Journal Video about Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells at JoVE.com

This work was supported by grants 51RT 0_126008 and 51RTP0_151029 for the Research and Technology Development (RTD) project InfectX and TargetInfectX, respectively, in the frame of SystemsX.ch, the Swiss Initiative for Systems Biology. We acknowledge grant 310030B_149886 from the Swiss National Science Foundation (SNSF). Work of S.H.L and A.C. was supported by the International PhD Program "Fellowships for Excellence" of the Biozentrum. Simone Muntwiler is acknowledged for technical assistance. We would like to thank Dirk Bumann for providing pNF106 and Jean Celli for pJC43 and pJC44.

Merk: Alt arbeid med live Brucella abortus stammer må utføres innenfor et biosikkerhetsnivå 3 (BSL3) laboratorium vurderer alle nødvendige forskrifter og sikkerhetsregler. 1. Utarbeidelse av innretningen og dyrking av bakterier og celler <ol><li> Utarbeidelse av Brucella abortus startkulturer <ol><li> Serie Brucella abortus 2308 (B. abortus) fra -80 ° C melk lager på et tryptisk soya-agar (TSA) plate inneholdende 50 ug / ml kanamycin (TSA / Km). In...

<ol>
	<li>Pappas, G., Papadimitriou, P., Akritidis, N., Christou, L., Tsianos, E. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+new+global+map+of+human+brucellosis.">The new global map of human brucellosis.</a> Lancet Infect Dis. 6, 91-99 (2006).</li><li>Atluri, V. L., Xavier, M. N., de Jong, M. F., den Hartigh, A. B., Tsolis, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+of+the+human+pathogenic+Brucella+species+with+their+hosts.">Interactions of the human pathogenic Brucella species with their hosts.</a> Annu Rev Microbiol. 65, 523-541 (2011).</li><li>Guzman-Verri, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GTPases+of+the+Rho+subfamily+are+required+for+Brucella+abortus+internalization+in+nonprofessional+phagocytes:+direct+activation+of+Cdc42.">GTPases of the Rho subfamily are required for Brucella abortus internalization in nonprofessional phagocytes: direct activation of Cdc42.</a> J Biol Chem. 276, 44435-44443 (2001).</li><li>Starr, T., Ng, T. W., Wehrly, T. D., Knodler, L. A., Celli, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brucella+intracellular+replication+requires+trafficking+through+the+late+endosomal/lysosomal+compartment.">Brucella intracellular replication requires trafficking through the late endosomal/lysosomal compartment.</a> Traffic. 9, 678-694 (2008).</li><li>Boschiroli, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Brucella+suis+virB+operon+is+induced+intracellularly+in+macrophages.">The Brucella suis virB operon is induced intracellularly in macrophages.</a> Proc Natl Acad Sci U S A. 99, 1544-1549 (2002).</li><li>Celli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brucella+evades+macrophage+killing+via+VirB-dependent+sustained+interactions+with+the+endoplasmic+reticulum.">Brucella evades macrophage killing via VirB-dependent sustained interactions with the endoplasmic reticulum.</a> J Exp Med. 198, 545-556 (2003).</li><li>Porte, F., Liautard, J. P., Kohler, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+acidification+of+phagosomes+containing+Brucella+suis+is+essential+for+intracellular+survival+in+murine+macrophages.">Early acidification of phagosomes containing Brucella suis is essential for intracellular survival in murine macrophages.</a> Infect Immun. 67, 4041-4047 (1999).</li><li>Anderson, T. D., Cheville, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructural+morphometric+analysis+of+Brucella+abortus-infected+trophoblasts+in+experimental+placentitis.+Bacterial+replication+occurs+in+rough+endoplasmic+reticulum.">Ultrastructural morphometric analysis of Brucella abortus-infected trophoblasts in experimental placentitis. Bacterial replication occurs in rough endoplasmic reticulum.</a> Am J Pathol. 124, 226-237 (1986).</li><li>Qin, Q. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+screen+of+endoplasmic+reticulum-associated+host+factors+reveals+a+role+for+IRE1alpha+in+supporting+Brucella+replication.">RNAi screen of endoplasmic reticulum-associated host factors reveals a role for IRE1alpha in supporting Brucella replication.</a> PLoS Pathog. 4, e1000110 (2008).</li><li>Ramo, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+analysis+of+large-scale+RNAi+screens+for+pathogen+entry.">Simultaneous analysis of large-scale RNAi screens for pathogen entry.</a> BMC genomics. 15, 1162 (2014).</li><li>Kuhbacher, A., Gouin, E., Cossart, P., Pizarro-Cerda, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+InlC+secretion+to+investigate+cellular+infection+by+the+bacterial+pathogen+Listeria+monocytogenes.">Imaging InlC secretion to investigate cellular infection by the bacterial pathogen Listeria monocytogenes.</a> J Vis Exp. , e51043 (2013).</li><li>Kentner, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shigella+reroutes+host+cell+central+metabolism+to+obtain+high-flux+nutrient+supply+for+vigorous+intracellular+growth.">Shigella reroutes host cell central metabolism to obtain high-flux nutrient supply for vigorous intracellular growth.</a> Proc Natl Acad Sci U S A. 111, 9929-9934 (2014).</li><li>Celli, J., Salcedo, S. P., Gorvel, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brucella+coopts+the+small+GTPase+Sar1+for+intracellular+replication.">Brucella coopts the small GTPase Sar1 for intracellular replication.</a> Proc Natl Acad Sci U S A. 102, 1673-1678 (2005).</li><li>von Bargen, K., Gorvel, J. P., Salcedo, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Internal+affairs:+investigating+the+Brucella+intracellular+lifestyle.">Internal affairs: investigating the Brucella intracellular lifestyle.</a> FEMS microbiology reviews. 36, 533-562 (2012).</li><li>Kamentsky, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+structure,+function+and+compatibility+for+CellProfiler:+modular+high-throughput+image+analysis+software.">Improved structure, function and compatibility for CellProfiler: modular high-throughput image analysis software.</a> Bioinformatics. 27, 1179-1180 (2011).</li></ol>

Bacterial pathogens have evolved numerous strategies to manipulate eukaryotic host cells to their benefit. Pathogens causing acute infections often show rapid proliferation which is accompanied by significant alarming of the immune system and loss of viability of infected cells. In contrast, Brucella and other pathogens that cause chronic infections manage to establish long-lasting interactions within host cells. Therefore, bacteria need to fine tune host cell functions to their benefit without disrupting cellul...

Brucella-arter er gram-negative, fakultative intracellulære patogener som tilhører klassen av α-Proteobacteria. De forårsaker abort og infertilitet i deres naturlige verter som storfe, geiter, eller sauer som resulterer i alvorlige økonomiske tap i endemiske områder. Brucellose er en av de viktigste zoonotiske sykdommer på verdensbasis forårsaker over en halv million nye infeksjoner hos mennesker årlig 1. Overføring til menneske er som oftest forårsaket av direkte kontakt med infiserte dyr eller ved inntak av forurenset mat som upasteurisert melk. Symptomer på febril sykdom er uspesifikke, noe som fører til vanskeligheter i diagnostisering av brucellose. Ubehandlet kan pasienter utvikle en kronisk infeksjon med mer alvorlige symptomer som leddgikt, endokarditt, og nevropati 2. På cellenivå Brucella er i stand til å invadere fagocyterende og ikke-fagocyttiske celler og replikerer i et intracellulærtrommet kjent som Brucella-holdige vakuolen (BCV). Internalisering av bakterier krever aktin cytoskjelett rearrangements av Rac, Rho, og direkte aktivering av Cdc42 tre. Inne i eukaryot vertscelle, den BCV traffics langs endocytoseveien og til tross for interaksjon med lysosomer, bakterier klarer å unngå degradering 4. Surgjøring av BCV av vesikulær ATPase er nødvendig for å indusere ekspresjon av IV sekresjon systemet (T4SS) 5-bakteriell type. Det antas at bakterie effektorer utskilles av den T4SS er avgjørende for Brucella å etablere sin replicative nisje, siden sletting av T4SS 6 eller hemming av vesikulær ATPase fører til defekter i etableringen av den intracellulære nisje 7. Bakterier ikke gjenskape i den fasen av menneskehandel til de nå en ER-avledet vacuolar rommet 8. Når intracellulær spredning oppstår, er det BCV funnet i close forbindelse med ER-markører som calnexin og glukose-6-fosfatase-6. De molekylære mekanismer som Brucella kommer inn celler, unngår lysosomal degradering, og til slutt replikerer i en ER-lignende kupé fortsatt i stor grad ukjent. Vertsfaktorer som er involvert i ulike trinn av infeksjonen har i hovedsak blitt identifisert av målrettede metoder eller en liten skala liten interfering RNA (siRNA) skjerm utført i Drosophila celler 9. Disse har belyse bidrag av individuelle vertsfaktorer i løpet av Brucella infeksjon, men vi er fortsatt langt fra en helhetlig forståelse av hele prosessen. Her er protokoller som gjør det mulig å identifisere menneskelige vertsfaktorer ved bruk av storskala RNA interferens (RNAi) screening i kombinasjon med automatiserte bredt felt fluorescens mikroskopi og automatisert bildeanalyse presentert. Omvendt siRNA transfeksjon av HeLa-celler utføres som described tidligere 10,11 med mindre modifikasjoner. Endepunktet assay dekker en stor del av Brucella intracellulære livssyklus unntatt utgang og infeksjon av naboceller. For ytterligere å karakterisere treff identifisert i endepunktet analysen, er en modifisert protokoll for å identifisere faktorer som er involvert i tidlige stadier av infeksjonen anvendes. En Brucella abortus stamme som konstitutivt uttrykker GFP brukes for endepunktet assay hvor bakterien får lov til å infisere cellene i to dager. I løpet av denne tiden, bakterier inn celler, trafikk til ER-avledet replicative nisje, og gjenskape i peri-atom plass. De høye nivåene av GFP signal kan deretter brukes til å pålitelig påvise enkeltceller som inneholder replikerende bakterier. For å studere Brucella oppføring i en high-throughput-analysen, er det viktig å være i stand til å skille mellom de intracellulære og ekstracellulære bakterier. Metoden som presenteres her circumventene differensial antistoff farging av intracellulære og ekstracellulære bakterier. Den er basert på en Brucella-stamme som uttrykker en tetracyklin-induserbar GFP i kombinasjon med konstitutiv ekspresjon av DsRed. Tilstedeværelsen av en konstitutiv DsRed markør tillater identifikasjon av alle bakterier som er til stede i prøven. GFP-ekspresjon indusert ved tilsetting av den ikke-giftig tetracyklin-analog anhydrotetracycline (ATC) samtidig med inaktivering av ekstracellulære bakterier av gentamicin (Gm). Mens celle-ugjennomtrengelig antibiotika Gm dreper ekstracellulære bakterier, kan ATC gå inn i vertscellen og indusere GFP uttrykk selektivt i intracellulære bakterier. Denne doble reporter gjør den robuste separasjon av enkelt intracellulære bakterier (GFP og DsRed signal) fra ekstracellulære bakterier (bare DsRed signal) ved hjelp av bredt felt mikroskopi. For å nå påvisbart GFP-ekspresjon av intracellulær Brucella har man funnet at fire timer med induksjon ved ATC resulterer i et relistand signal. Lignende induksjons ordninger for å selektivt uttrykker GFP i intracellulære bakterier har blitt brukt tidligere for å studere intracellulær Shigella 12.

<table border="0" cellpadding="0" cellspacing="0" width="573">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tryptic Soy Agar (TSA)</td>
			<td style="width:71px;">BD</td>
			<td style="width:119px;">236950</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tryptic Soy Broth (TSB)</td>
			<td style="width:71px;">Fluka</td>
			<td style="width:119px;">22092</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Kanamycin sulfate</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">60615</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Skim milk</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">250 ml screw cap bottle</td>
			<td style="width:71px;">Corning</td>
			<td style="width:119px;">8396</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">DMEM</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">D5796</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fetal Calf Serum (FCS)</td>
			<td style="width:71px;">Gibco</td>
			<td style="width:119px;">10270</td>
			<td style="width:167px;">Heat-inactivated</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Trypsin-EDTA (0.5%)</td>
			<td style="width:71px;">Gibco</td>
			<td style="width:119px;">15400-054</td>
			<td style="width:167px;">10x stock solution, dilute 1:10 in PBS</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Scepte 2.0 Cell Counter</td>
			<td style="width:71px;">Merck Milipore</td>
			<td style="width:119px;">PHCC20060</td>
			<td style="width:167px;">Alternative cell counting devices can be used.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Greiner CELLSTAR 384-well plate</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">M2062</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Peelable aluminum foil</td>
			<td style="width:71px;">Costar</td>
			<td style="width:119px;">6570</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Reagent dispenser: &#34;Multidrop 384 Reagent Dispenser&#34;</td>
			<td style="width:71px;">Thermo Scientific</td>
			<td style="width:119px;">5840150</td>
			<td style="width:167px;">Alternative reagent dispenser can be used.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Transfection reagent: &#34;Lipofectamine RNAiMAX</td>
			<td style="width:71px;">Invitrogen</td>
			<td style="width:119px;">13778-150</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="252">
			<td height="252" style="height:252px;width:216px;">Automated plate washer: &#34;Plate washer ELx50-16&#34;</td>
			<td style="width:71px;">BioTek</td>
			<td style="width:119px;">ELX5016</td>
			<td style="width:167px;">This plate washer contains a 16-channel manifold suitable for 384-well plates. It fits into a biosafety cabinet and has a lid covering the plate during washing which reduces the risk of aerosol production. Alternative plate washers with similar features could be used.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Gentamicin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">G1397</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Anhydrotetracycline hydrochloride</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">37919</td>
			<td style="width:167px;">100 ug/ml solution in 100% ethanol is kept at -20&#176;C protected from light in aluminum-foil</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PBS</td>
			<td style="width:71px;">Gibco</td>
			<td style="width:119px;">20012</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="168">
			<td height="168" style="height:168px;width:216px;">Paraformaldehyde</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">P6148</td>
			<td style="width:167px;">Dissolve in 0.2 M HEPES buffer, pH 7.4. Store at -20&#176;C and thaw freshly the day before use. Caution, PFA is toxic by inhalation, in contact with skin and if swallowed.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">HEPES</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">H3375</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Triton X-100</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">T9284</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DAPI</td>
			<td style="width:71px;">Roche</td>
			<td style="width:119px;">10236276001</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Scrambled siRNA</td>
			<td style="width:71px;">Dharmacon</td>
			<td style="width:119px;">D-001810-10</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Kif11 siRNA</td>
			<td style="width:71px;">Dharmacon</td>
			<td style="width:119px;">L-003317-00</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">ARPC3 siRNA</td>
			<td style="width:71px;">Dharmacon</td>
			<td style="width:119px;">L-005284-00</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Brucella abortus 2308</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:216px;">pJC43 (apHT::GFP)</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:167px;">Celli et al.12</td>
		</tr>
		<tr height="277">
			<td height="277" style="height:277px;width:216px;">pAC042.08 (apht::dsRed, tetO::tetR-GFP)</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:167px;">Construction: pJC44 4 was digested with EcoRI followed by generation of blunt ends with Klenov enzyme and subsequent digestion with SalI. TetR-GFP was amplified from pNF106 using primer prAC090 and prAC092. Following digestion with SalI, the TetR-GFP product was ligated to the digested pJC44 vector.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Primer prAC090</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;"></td>
			<td style="width:167px;">TTTTTGAATTCTGGCAATTCCGACGTCTAAGAAACC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Primer prAC092</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;"></td>
			<td style="width:167px;">TTTTTGTCGACTTTGTCCTACTCAGGAGAGCGTTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">HeLa CCL-2</td>
			<td style="width:71px;">ATCC</td>
			<td style="width:119px;">CCL-2</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="231">
			<td height="231" style="height:231px;width:216px;">ImageXpress Micro</td>
			<td style="width:71px;">Molecular Devices&#160;</td>
			<td style="width:119px;">IXM IMAGING MSCOPE</td>
			<td style="width:167px;">Automated cellular imaging microscope equipped with a precision motorized Z-stage. Alternative systems for automated microscopy and alternative components for hard- and software specified below can be employed.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">High-Speed Laser Auto-Focus</td>
			<td style="width:71px;">Molecular Devices&#160;</td>
			<td style="width:119px;">1-2300-1037</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">CFI Super Fluor 10x objective</td>
			<td style="width:71px;">Nikon&#160;</td>
			<td style="width:119px;">MRF00100</td>
			<td style="width:167px;">N.A 0.50, W.D 1.20mm, DIC Prism: 10x, Spring loaded</td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Photometrics CoolSNAP HQ Monochrome CCD Camera</td>
			<td style="width:71px;">Molecular Devices&#160;</td>
			<td style="width:119px;">1-2300-1060</td>
			<td style="width:167px;">1392 x 1040 imaging pixels, 6.45 x 6.45-&#181;m pixels, 12 bits digitization</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">MetaXpress software</td>
			<td style="width:71px;">Molecular Devices&#160;</td>
			<td style="width:119px;">9500-0100</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:216px;">LUI-Spectra-X-7</td>
			<td style="width:71px;">Lumencor</td>
			<td style="width:119px;">SPECTRA X V-XXX-YZ</td>
			<td style="width:167px;">Light engine. The following light sources are used: violet (DAPI), cyan (GFP), green/yellow (RFP)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Single Band Exciter for DAPI</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF01-377/50-25</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Single Band Emitter for DAPI</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF02-447/60-25</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Single Band Dichroic for DAPI</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF409-Di03-25x36</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Single Band Exciter for GFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF02-472/30-25</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Single Band Emitter for GFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF01-520/35-25</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Single Band Dichroic for GFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF495-Di03-25x36</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Single Band Exciter for RFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF01-562/40-25</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Single Band Emitter for RFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF01-624/40-25</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Single Band Dichroic for RFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF593-Di03-25x36</td>
			<td></td>
		</tr>
	</tbody>
</table>

microscopy-based assays for high-throughput screening of host factors involved in brucella infection of hela cells

Brucella arter er fakultative intracellulære patogener som infiserer dyr som deres naturlige verter. Overføring til mennesker er oftest forårsaket av direkte kontakt med infiserte dyr eller ved inntak av forurenset mat og kan føre til alvorlige kroniske infeksjoner. Brucella kan invadere profesjonelle og ikke-profesjonelle fagocyterende celler og replikerer i endoplasmatisk retikulum (ER) avledede vakuoler. Verts faktorer som kreves for Brucella oppføring i vertsceller, unngåelse av lysosomal degradering, og replikering i ER-lignende kupé fortsatt i stor grad ukjent. Her beskriver vi to analyser for å identifisere vertsfaktorer som er involvert i Brucella oppføring og replikering i HeLa celler. Protokollene beskriver bruken av RNA-interferens, mens alternative screeningsmetoder kan anvendes. Analysene er basert på påvisning av fluorescerende merkede bakterier i fluorescensmerkede vertsceller ved hjelp av automatisertbredt felt mikroskopi. De fluoriserende bildene ble analysert ved hjelp av en standardisert bildeanalyse rørledning i CellProfiler som lar enkeltcelle-baserte infeksjon scoring. Ved endepunktet analysen, er intracellulær replikasjon målt to dager etter infisering. Dette gjør at bakterier til trafikk til deres replicative nisje hvor spredning er initiert rundt 12 timer etter bakterie innreise. Brucella som har opprettet en intracellulær nisje vil dermed ha sterkt proliferated inne vertsceller. Siden intracellulære bakterier vil i stor grad flere enn individuelle ekstracellulære eller intracellulære ikke-replikative bakterier, kan en belastning konstitutivt uttrykker GFP brukes. Den sterke GFP-signalet blir så brukt for å identifisere infiserte celler. I motsetning til dette, etter oppføringen analysen er det viktig å skille mellom intracellulære og ekstracellulære bakterier. Her blir en påkjenning som koder for en tetracyklin-induserbar GFP anvendt. induksjonav GFP med samtidig inaktivering av ekstracellulære bakterier av gentamicin muliggjør differensiering mellom intracellulære og ekstracellulære bakterier basert på den GFP signal, med bare intracellulære bakterier å være i stand til å uttrykke GFP. Dette gjør den robuste påvisning av enkelt intracellulære bakterier før intracellulær spredning er igangsatt.

Figur 1A viser et eksempel på en bildeanalyse brukes til automatisk å identifisere infiserte celler i endepunktet analysen. Nuclei fra HeLa-celler farget med DAPI ble identifisert, ble en peri-kjerne av 8 bildeelementer bredde som omgir kjernen, og et Voronoi-celle legeme ved forlengelse av kjernen med 25 bildeelementer beregnet. Siden bakterier hovedsakelig proliferere i peri-atom plass, GFP intensitet i dette område av cellen er den mest robuste måling for å skjel...

Watch this Scientific Journal Video about Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells at JoVE.com

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Two assays for microscopy-based high-throughput screening of host factors involved in Brucella infection are described. The entry assay detects host factors required for Brucella entry and the endpoint assay those required for intracellular replication. While applicable for alternative approaches, siRNA screening in HeLa cells is used to illustrate the protocols.

Mikroskopi-baserte analyser for High-throughput screening av Host faktorer involvert i<em&gt; Brucella</em&gt; Infeksjon av HeLa-celler

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by ...

Research

JoVE Journal

Immunology and Infection

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in ...

VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance


	Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important ...

A Microscopic Phenotypic Assay for the Quantification of Intracellular Mycobacteria Adapted for High-throughput/High-content Screening

En mikroskopisk fenotypisk analyse for kvantifisering av intracellulær mykobakterier tilpasset høygjennomstrømning / screening av høyt innhold

Despite the availability of therapy and vaccine, tuberculosis (TB) remains one of the most deadly and widespread bacterial infections in the world. Since ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

Høy gjennomstrømming Screening for Bredspektret Chemical hemmere av RNA-virus

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

A Fluorescence-based Lymphocyte Assay Suitable for High-throughput Screening of Small Molecules

En fluorescens-basert lymfocyttkontroll analyse Egnet for høy gjennomstrømming screening av små molekyler

High-throughput screening (HTS) is currently the mainstay for the identification of chemical entities capable of modulating biochemical reactions or ...

Screening Assays to Characterize Novel Endothelial Regulators Involved in the Inflammatory Response

Screening analyser betegner romanen Endothelial regulatorer involvert i inflammatorisk respons

The endothelial layer is essential for maintaining homeostasis in the body by controlling many different functions. Regulation of the inflammatory ...

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

En høy gjennomstrømming plattform for Screening av Salmonella spp. /Shigella spp.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella ...

Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

Arbovirus infeksjoner som Screening verktøy for identifikasjon av Viral Immunomodulators og vert Antiviral faktorer

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. ...

High-throughput Measurement of Plasma Membrane Resealing Efficiency in Mammalian Cells

Høy gjennomstrømming-måling av Plasma membran Resealing effektivitet i pattedyrceller

In their physiological environment, mammalian cells are often subjected to mechanical and biochemical stresses that result in plasma membrane damage. In ...