Name: mapping rna-rna interactions globally using biotinylated psoralen
Uploaded: 2017-05-24T13:00:00
Description: Watch this Scientific Journal Video about Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen at JoVE.com

Ringraziamo i membri del laboratorio di Wan e il laboratorio di Nagarajan per le discussioni informative. N.Nagarajan è supportato da finanziamenti da A * STAR. Y.Wan è sostenuto da finanziamenti da A * STAR e dalla Società in borsa Science-Branco Weiss.

1. Trattamento delle cellule HeLa con estrazione di Psoralen e RNA biotinilata <ol><li> Coltivano le cellule HeLa nel mezzo di Eagle di Dulbecco (DMEM) integrato con 10% di siero fetale fetale (FBS) e 1% di penicillina streptomicina (PS) in una piastra di 10 cm. </li><li> Lavare le cellule HeLa due volte con 5 ml di 1x PBS. Scaricare completamente il PBS dal piatto posando il piatto verticalmente per 1 minuto. </li><li> Aggiungere 1 ml di PBS contenente 200 μM di psoralene biotinilato e 0,01% w / v digitonin, alle ce...

<ol>
	<li>Wan, Y., Kertesz, M., Spitale, R. C., Segal, E., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Understanding+the+transcriptome+through+RNA+structure.">Understanding the transcriptome through RNA structure.</a> Nat.Rev.Genet. 12 (9), 641-655 (2011).</li><li>Kertesz, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+measurement+of+RNA+secondary+structure+in+yeast.">Genome-wide measurement of RNA secondary structure in yeast.</a> Nature. 467 (7311), 103-107 (2010).</li><li>Wan, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+Measurement+of+RNA+Folding+Energies.">Genome-wide Measurement of RNA Folding Energies.</a> Mol.Cell. 48 (2), 169-181 (2012).</li><li>Wan, Y., Qu, K., Ouyang, Z., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+mapping+of+RNA+structure+using+nuclease+digestion+and+high-throughput+sequencing.">Genome-wide mapping of RNA structure using nuclease digestion and high-throughput sequencing.</a> Nat.Protoc. 8 (5), 849-869 (2013).</li><li>Wan, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Landscape+and+variation+of+RNA+secondary+structure+across+the+human+transcriptome.">Landscape and variation of RNA secondary structure across the human transcriptome.</a> Nature. 505 (7485), 706-709 (2014).</li><li>Spitale, R. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+imprints+in+vivo+decode+RNA+regulatory+mechanisms.">Structural imprints in vivo decode RNA regulatory mechanisms.</a> Nature. 519 (7544), 486-490 (2015).</li><li>Ding, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+genome-wide+profiling+of+RNA+secondary+structure+reveals+novel+regulatory+features.">In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features.</a> Nature. 505 (7485), 696-700 (2014).</li><li>Rouskin, S., Zubradt, M., Washietl, S., Kellis, M., Weissman, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+probing+of+RNA+structure+reveals+active+unfolding+of+mRNA+structures+in+vivo.">Genome-wide probing of RNA structure reveals active unfolding of mRNA structures in vivo.</a> Nature. 505 (7485), 701-705 (2014).</li><li>Kudla, G., Granneman, S., Hahn, D., Beggs, J. D., Tollervey, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-linking,+ligation,+and+sequencing+of+hybrids+reveals+RNA-RNA+interactions+in+yeast.">Cross-linking, ligation, and sequencing of hybrids reveals RNA-RNA interactions in yeast.</a> Proc.Natl.Acad.Sci.U.S.A. 108 (24), 10010-10015 (2011).</li><li>Sugimoto, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=hiCLIP+reveals+the+in+vivo+atlas+of+mRNA+secondary+structures+recognized+by+Staufen+1.">hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1.</a> Nature. 519 (7544), 491-494 (2015).</li><li>Engreitz, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-RNA+interactions+enable+specific+targeting+of+noncoding+RNAs+to+nascent+Pre-mRNAs+and+chromatin+sites.">RNA-RNA interactions enable specific targeting of noncoding RNAs to nascent Pre-mRNAs and chromatin sites.</a> Cell. 159 (1), 188-199 (2014).</li><li>Ramani, V., Qiu, R., Shendure, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+determination+of+RNA+structure+by+proximity+ligation.">High-throughput determination of RNA structure by proximity ligation.</a> Nat.Biotechnol. , (2015).</li><li>Lu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+Duplex+Map+in+Living+Cells+Reveals+Higher-Order+Transcriptome+Structure.">RNA Duplex Map in Living Cells Reveals Higher-Order Transcriptome Structure.</a> Cell. 165 (5), 1267-1279 (2016).</li><li>Sharma, E., Sterne-Weiler, T., O'Hanlon, D., Blencowe, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+Mapping+of+Human+RNA-RNA+Interactions.">Global Mapping of Human RNA-RNA Interactions.</a> Mol.Cell. 62 (4), 618-626 (2016).</li><li>Aw, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vivo+Mapping+of+Eukaryotic+RNA+Interactomes+Reveals+Principles+of+Higher-Order+Organization+and+Regulation.">In Vivo Mapping of Eukaryotic RNA Interactomes Reveals Principles of Higher-Order Organization and Regulation.</a> Mol.Cell. 62 (4), 603-617 (2016).</li></ol>

Qui descriviamo in dettaglio il flusso di lavoro sperimentale e computazionale per SPLASH, un metodo che ci permette di identificare le interazioni RNA a due mani in modo genico-wide. Abbiamo utilizzato con successo SPLASH nelle colture batteriche, lieviti e umane e anticipo che la strategia possa essere ampiamente applicata a organismi diversi in diversi stati cellulari. Uno dei passaggi critici del protocollo è quello di iniziare con almeno 20 μg di RNA reticolato per avere materiale adeguato per i processi a valle....

Studiare come macromolecole si piegano e interagiscono tra loro è la chiave per comprendere la regolazione del gene nella cellula. Mentre molti sforzi sono stati focalizzati nell&#39;ultimo decennio per comprendere come il DNA e le proteine ​​contribuiscono alla regolazione del gene, è relativamente meno noto circa la regolazione post-trascrizionale dell&#39;espressione genica. L&#39;RNA trasporta informazioni sia nella sequenza lineare che nella struttura secondaria e terziaria 1 . La sua capacità di fondare la coppia con se stessa e con gli altri è importante per la sua funzione in vivo . I progressi recenti nel sondaggio della struttura secondaria RNA a elevata produttività hanno fornito preziosi approfondimenti sulle posizioni delle regioni a doppia e singola banda nel transcriptoma 2 , 3 , 4 , 5 , 6 , 7 , 8 , howeVer le informazioni sui partner di interazione di coppia sono ancora in gran parte mancanti. Per determinare quale sequenza RNA interagisce con un&#39;altra regione RNA nel trascrittoma, abbiamo bisogno di informazioni globali a livello di coppia. La mappatura delle interazioni RNA in coppia in maniera globale e imparziale è stata tradizionalmente una grande sfida. Mentre gli approcci precedenti, come CLASH 9 , hiCLIP 10 e RAP 11 , vengono utilizzati per identificare le interazioni RNA in modo scalare, queste tecniche tipicamente mappano l&#39;accoppiamento base di RNA per un sottoinsieme di RNA che interagiscono con una particolare specie di proteine ​​o RNA. Gli sviluppi recenti nello studio delle interazioni globali di RNA includono il metodo RPL 12 , che non stabilizza le interazioni RNA in vivo e quindi può solo catturare un sottoinsieme di interazioni in vivo . Per superare queste sfide, noi e gli altri abbiamo sviluppato strategie prive di genoma e maestoseP interazioni di RNA in vivo , utilizzando versioni modificate del psoralen 13 , 14 , 15 del reticolatore. In questo protocollo, descriviamo i dettagli per eseguire l&#39;equilibrio di S di P soralen incrociato, L igato e S eligibriti (SPLASH), che utilizza il psoralene biotinilato in RNA in accoppiamento a base di collegamento in vivo in seguito alla legatura di prossimità e ad alta sequenza di throughput a Individuare i partner RNA base-pairing in tutto il genoma ( Figura 1 ) 15 . In questo manoscritto descriviamo i passaggi per eseguire SPLASH utilizzando cellule aderenti colte, in questo caso le cellule HeLa. Lo stesso protocollo può essere facilmente adattato alle cellule di mammiferi di sospensione e alle cellule di lievito e batteri. In breve, le cellule HeLa vengono trattate con psoralene biotinilato e irradiati a 365 nm per incrociare in coppia le coppie di RNA interattive in vivo. I RNA vengono quindi estratti dalle cellule, frammentati e arricchiti per le regioni di reticolazione usando perline di streptavidina. I frammenti RNA interattivi vengono quindi legati insieme usando la legatura di prossimità e fatti in una libreria di cDNA per la sequenza profonda. Al sequenziamento, gli RNA chimerici vengono mappati sul transcriptome / genoma per identificare le regioni interagenti RNA che sono accoppiate tra loro. Abbiamo utilizzato con successo SPLASH per identificare migliaia di interazioni RNA in vivo in lieviti e diverse cellule umane, tra cui l&#39;accoppiamento base di RNA intramolecolare e intermolecolare in diverse classi di RNA, come snoRNA, lncRNA e mRNA, per intravedere nell&#39;organizzazione strutturale e nei modelli di interazione Di RNA nella cella.

<table border="0" cellpadding="0" cellspacing="0" width="1136">
	<colgroup>
		<col />
		<col span="3" />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:284px;">1 Kb Plus DNA Ladder</td>
			<td style="width:284px;">Life Technologies Holdings Pte Ltd</td>
			<td style="width:284px;">10787026</td>
			<td style="width:284px;">DNA ladder</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10 bp DNA ladder</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>10821-015</td>
			<td>DNA ladder</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">20 % SDS solution</td>
			<td>First BASE</td>
			<td>BUF-2052-1L&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">20x SSC</td>
			<td>First BASE</td>
			<td>BUF-3050-20X1L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">3.0 M Sodium Acetate Solution</td>
			<td>First BASE</td>
			<td>BUF-1151-1L-pH5.2&#160;&#160;</td>
			<td>Required for nucleic acid precipitation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">40% Acrylamide/Bis Solution, 19:1</td>
			<td>Bio-Rad</td>
			<td>1610145</td>
			<td>TBE Urea gel component</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ambion Buffer Kit</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>AM9010</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ammonium Persulfate, Molecular Grade&#160;&#160;</td>
			<td>Promega</td>
			<td>V3131&#160;</td>
			<td>TBE Urea gel component</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Bromophenol Blue</td>
			<td>Sigma-Aldrich</td>
			<td>B0126-25G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Chloroform</td>
			<td>Merck</td>
			<td>1.02445.1000</td>
			<td>RNA extraction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Single strand DNA ligase</td>
			<td>Epicentre</td>
			<td>CL9025K</td>
			<td>CircLigase II ssDNA Ligase</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Centrifuge tube filters</td>
			<td>Sigma-Aldrich</td>
			<td>CLS8160-96EA</td>
			<td>Costar Spin-X centrifuge tube filters</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">D5628-1G DIGITONIN CRYSTALLINE</td>
			<td>Sigma-Aldrich</td>
			<td>D5628-1G</td>
			<td>For cell treatment</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dark Reader Transilluminator&#160;</td>
			<td>Clare Chemical Research</td>
			<td>Dark Reader DR89X Transilluminator</td>
			<td>Blue light transilluminator</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA Gel Loading Dye (6X)</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>R0611</td>
			<td>Required for agarose gel electroporation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Dulbecco&#39;s Modified Eagle Medium</td>
			<td>Pan BioTech</td>
			<td>P04-03500</td>
			<td>For Hela cell culture</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Streptavidin magnetic beads</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>65002</td>
			<td>Dynabeads MyOne Streptavidin C1&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Magnetic stand for 15ml tubes</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>12301D</td>
			<td>DynaMag-15</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Magnetic stand for 15ml tubes</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>&#160;12321D</td>
			<td>DynaMag-2</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">ThermoMixer</td>
			<td>Eppendorf</td>
			<td>5382 000.015</td>
			<td>Eppendorf ThermoMixer&#160;C</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Biotinylated psoralen</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>29986</td>
			<td>EZ-Link Psoralen-PEG3-Biotin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">F8T5/BL&#160;</td>
			<td>Hitachi</td>
			<td>F8T5/BL&#160;</td>
			<td>365 nm UV bulb</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Fetal Bovine Serum</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>10270106&#160;&#160;</td>
			<td>Components of Hela medium</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Formamide</td>
			<td>Promega</td>
			<td>H5052&#160;&#160;</td>
			<td>Component in hybridization buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">G8T5</td>
			<td>Sankyo-Denki</td>
			<td>G8T5</td>
			<td>254 nm UV bulb</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Glycogen&#160;</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>10814010</td>
			<td>Required for nucleic acid precipitation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nanodrop</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>Nanodrop 2000</td>
			<td>Spectrophotometer for nucleic acidquantification</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Nuclease free water&#160;</td>
			<td>First BASE</td>
			<td>BUF-1180-500ml&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Penicillin Streptomycin&#160;&#160;</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>15140122&#160;&#160;</td>
			<td>Components of Hela medium</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">High-Fidelity DNA polymerase (2x)</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>F531L&#160;</td>
			<td>Phusion High-Fidelity PCR Master Mix with HF Buffer (2x)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Primers Set 1</td>
			<td>New England Biolabs</td>
			<td>E7335L&#160;</td>
			<td>PCR primers</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA Gel Extraction Kit</td>
			<td>QIAgen</td>
			<td>28106</td>
			<td>QIAquick Gel Extraction Kit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fluorometric Quantification kit</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>Q32854</td>
			<td>Qubit dsDNA HS Assay Kit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA clean up kit</td>
			<td>Qiagen</td>
			<td>74106</td>
			<td>RNeasy Mini Kit Silica-membrane column</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Rnase Inhibitor</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>AM2696</td>
			<td>SUPERase In</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Reverse transcriptase</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>18080400</td>
			<td>SuperScript III First-Strand Synthesis SuperMix</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Nucleic Acid Gel Stain</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>S11494</td>
			<td>SYBR GOLD NUCLEIC ACID 500 UL</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">T4 Polynucleotide Kinase</td>
			<td>New England Biolabs</td>
			<td>M0201L</td>
			<td>End repair enzyme</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">T4 RNA Ligase 1</td>
			<td>New England Biolabs</td>
			<td>M0204L</td>
			<td>Enzyme for proximity ligation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">T4 RNA Ligase 2, truncated KQ</td>
			<td>New England Biolabs</td>
			<td>M0373L</td>
			<td>Enzyme for adaptor ligation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Temed</td>
			<td>Bio-Rad</td>
			<td>1610801</td>
			<td>TBE Urea gel component</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Guanidinium thiocyanate-phenol-chloroform</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>15596018</td>
			<td>TRIzol&#174; Reagent for RNA extraction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Urea</td>
			<td>First BASE</td>
			<td>BIO-2070-5kg&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">UV crosslinker</td>
			<td>Stratagene</td>
			<td>400072</td>
			<td>UV Stratalinker 1800</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">UV Transilluminator</td>
			<td>UVP</td>
			<td>95-0417-01</td>
			<td>For visualizing of bands</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Xylene Cyanol FF</td>
			<td>Sigma-Aldrich</td>
			<td>X4126-10G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA cleanup it</td>
			<td>Zymo Research&#160;</td>
			<td>D4004</td>
			<td>Zymo DNA concentrator-5&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">List of software required</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastQC software</td>
			<td>0.11.4</td>
			<td>http://www.bioinformatics.babraham.ac.uk/projects/fastqc/</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SeqPrep software</td>
			<td>1.0.7</td>
			<td>https://github.com/jstjohn/SeqPrep</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BWA software</td>
			<td>0.7.12</td>
			<td>http://bio-bwa.sourceforge.net/</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SAMTOOLS software</td>
			<td>1.2.1</td>
			<td>http://www.htslib.org/</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PULLSEQ software</td>
			<td>1.0.2</td>
			<td>https://github.com/bcthomas/pullseq</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">STAR software</td>
			<td>2.5.0c</td>
			<td>https://github.com/alexdobin/STAR</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">rem_dups.py PYTHON script</td>
			<td>PYTHON 2.7.11</td>
			<td>https://github.com/CSB5/splash/tree/master/src</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">find_chimeras.py PYTHON script</td>
			<td>PYTHON 2.7.11</td>
			<td>https://github.com/CSB5/splash/tree/master/src</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pickJunctionReads.awk AWK script</td>
			<td>AWK GNU 4.1.2</td>
			<td>https://github.com/CSB5/splash/tree/master/src</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Buffer composition</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Elution buffer:&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.3 M sodium acetate</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Lysis Buffer:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50 mM Tris-Cl pH 7.0</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10 mM EDTA</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Always add Superase-in fresh before use except when washing beads</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Proteinase K Buffer&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">100 mM NaCl</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10 mM TrisCl pH 7.0</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM EDTA</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hybridization Buffer</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">750 mM NaCl</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50 mM Tris-Cl pH 7.0</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM EDTA</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15% formamide (store in the dark at 4 &#176;C)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Always add Superase-in fresh before use</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2x SSC Wash Buffer</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2x NaCl and Sodium citrate (SSC) (diluted from 20x SSC Invitrogen stock)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2X RNA fragmentation buffer</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">18mM MgCl2</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">450mM KCl</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">300mM Tris-CL pH 8.3</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2x RNA loading Dye:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">95% Formamide</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.02% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.02% bromophenol blue</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.01% Xylene Cyanol</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1mM EDTA&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">3&#39; RNA adapter sequence</td>
			<td>5rAppCTGTAGGCACCATCAAT/3ddC</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RT primer sequence</td>
			<td>AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC/iSp18/CACTCA/iSp18/TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

mapping rna-rna interactions globally using biotinylated psoralen

Sapere come i RNA interagiscono con se stessi e con gli altri è fondamentale per capire la regolazione del gene basato su RNA nella cellula. Mentre esempi di interazioni RNA-RNA come le interazioni di microRNA-mRNA sono state dimostrate per regolare l&#39;espressione genica, l&#39;intero grado in cui si verificano interazioni RNA nella cella è ancora sconosciuto. I metodi precedenti per studiare le interazioni di RNA si sono concentrati principalmente su subsets di RNA che interagiscono con una particolare proteina o specie di RNA. Qui, abbiamo dettagliato un metodo denominato S equencing di P soralen crosslinked, L igated, e S eletti H ybrids (SPLASH) che consente la cattura genoma di interazioni RNA in vivo in modo imparziale. SPLASH utilizza la reticolazione in vivo , la legatura di prossimità e il sequenziamento ad alta velocità per identificare partner globalmente associati alla base di RNA intramolecolare e intermolecolare. SPLASH può essere applicato a diversi organismi, compresi batteri, lieviti e cellule umane, nonché aS diverse condizioni cellulari per facilitare la comprensione della dinamica dell&#39;organizzazione di RNA in diversi contesti cellulari. L&#39;intero protocollo sperimentale SPLASH richiede circa 5 giorni per completare e il flusso di lavoro computazionale richiede circa 7 giorni per completare.

La figura 1 rappresenta lo schema del flusso di lavoro SPLASH. Dopo l&#39;aggiunta di psoralene biotinilato in presenza di 0,01% di digitonina e di reticolazione UV, viene estratto un totale di RNA dalle cellule e viene eseguita una macchia di punti per assicurare che il collegamento a biotinilato con l&#39;RNA sia accaduto in modo efficace ( Figura 2 ). Utilizziamo oligosini biotinilati 20 come controlli positivi per titolare l...

Watch this Scientific Journal Video about Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen at JoVE.com

Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen

Qui, abbiamo dettagliato il metodo di equilibrio di P soralen crosslinked, L igated e S elected H ybrids (SPLASH), che consente mapping a livello genomico delle interazioni RNA-RNA intramolecolari e intermolecolari in vivo . SPLASH può essere applicato per studiare interagenti RNA di organismi compresi lieviti, batteri e umani.

Mappatura delle interazioni RNA-RNA globalmente utilizzando Psoralen biotinilato

Knowing how RNAs interact with themselves and with others is key to understanding RNA based gene regulation in the cell. While examples of RNA-RNA ...

Research

JoVE Journal

Genetics

Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation

Coniugazione saggi di accoppiamento per l&#39;analisi specifica per sequenza di proteine ​​di trasferimento relativi coniugazione batterica

The transfer of genetic material by bacterial conjugation is a process that takes place via complexes formed by specific transfer proteins. In Escherichia ...

Ricerca

Genetica

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

Mapping QTL e modifica CRISPR / Cas9 per identificare un gene di resistenza alla droga in<em&gt; Toxoplasma gondii</em

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the ...

Single Molecule Analysis of Laser Localized Psoralen Adducts

Singolo Analisi Molecola di laser localizzati psoraleni addotti

The DNA Damage Response (DDR) has been extensively characterized in studies of double strand breaks (DSBs) induced by laser micro beam irradiation in live ...

Genome-wide Mapping of Protein-DNA Interactions with ChEC-seq in Saccharomyces cerevisiae

Genome-wide Mapping of Protein-DNA Interactions with ChEC-seq in Saccharomyces cerevisiae

Mappatura di interazioni proteine-DNA con ChEC-seq nel gene-wide<em&gt; Saccharomyces cerevisiae</em

Genome-wide mapping of protein-DNA interactions is critical for understanding gene regulation, chromatin remodeling, and other chromatin-resident ...

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

Scansione retrovirale: Mappatura dei siti di integrazione MLV per definire regioni regolatori specifiche per le cellule

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

Mapping Genome-wide Accessible Chromatin in Primary Human T Lymphocytes by ATAC-Seq

Mappatura del genoma della cromatina accessibile in linfociti T umani primari da ATAC-Seq

Assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-seq) is a method used for the identification of open (accessible) regions ...

Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions

Promotore cattura Ciao-c: Ad alta risoluzione, Genome-wide profilatura delle interazioni del promotore

The three-dimensional organization of the genome is linked to its function. For example, regulatory elements such as transcriptional enhancers control the ...

A Fast and Quantitative Method for Post-translational Modification and Variant Enabled Mapping of Peptides to Genomes

Un metodo veloce e quantitativo per la modificazione post-traduzionale e variante attivato Mapping dei peptidi di genomi

Cross-talk between genes, transcripts, and proteins is the key to cellular responses; hence, analysis of molecular levels as distinct entities is slowly ...

Transcription Start Site Mapping Using Super-low Input Carrier-CAGE

Trascrizione Inizio mapping del sito utilizzando vettore-CAGE di input super-basso

Cap analysis of gene expression (CAGE) is a method used for single-nucleotide resolution detection of RNA polymerase II transcription start sites (TSSs). ...

In Vitro Biochemical Assays using Biotin Labels to Study Protein-Nucleic Acid Interactions

Analisi biochimiche in Vitro che utilizzano etichette di biotina per studiare le interazioni proteina-nucleica dell'acido

Protein-nucleic acid interactions play important roles in biological processes such as transcription, recombination, and RNA metabolism. Experimental ...