Name: mapping rna-rna interactions globally using biotinylated psoralen
Uploaded: 2017-05-24T13:00:00
Description: Watch this Scientific Journal Video about Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen at JoVE.com

Agradecemos aos membros do laboratório Wan e do laboratório Nagarajan por discussões informativas. N.Nagarajan é apoiado pelo financiamento de A * STAR. Y.Wan é apoiado pelo financiamento de A * STAR e Sociedade em Ciência-Branco Weiss Fellowship.

1. Tratamento de Células HeLa com Extracção de Psoraleno e ARN Biotinilados <ol><li> Células HeLa de cultura em meio Eagle modificado por Dulbecco (DMEM) suplementado com 10% de soro fetal bovino (FBS) e 1% de penicilina estreptomicina (PS) numa placa de 10 cm. </li><li> Lavar as células HeLa duas vezes com 5 mL de 1x PBS. Drene excesso de PBS completamente do prato, colocando o prato verticalmente por 1 min. </li><li> Adicionar 1 mL de PBS contendo 200 μM de psoraleno biotinilado e 0,01% p / v de digitonina, à...

<ol>
	<li>Wan, Y., Kertesz, M., Spitale, R. C., Segal, E., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Understanding+the+transcriptome+through+RNA+structure.">Understanding the transcriptome through RNA structure.</a> Nat.Rev.Genet. 12 (9), 641-655 (2011).</li><li>Kertesz, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+measurement+of+RNA+secondary+structure+in+yeast.">Genome-wide measurement of RNA secondary structure in yeast.</a> Nature. 467 (7311), 103-107 (2010).</li><li>Wan, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+Measurement+of+RNA+Folding+Energies.">Genome-wide Measurement of RNA Folding Energies.</a> Mol.Cell. 48 (2), 169-181 (2012).</li><li>Wan, Y., Qu, K., Ouyang, Z., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+mapping+of+RNA+structure+using+nuclease+digestion+and+high-throughput+sequencing.">Genome-wide mapping of RNA structure using nuclease digestion and high-throughput sequencing.</a> Nat.Protoc. 8 (5), 849-869 (2013).</li><li>Wan, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Landscape+and+variation+of+RNA+secondary+structure+across+the+human+transcriptome.">Landscape and variation of RNA secondary structure across the human transcriptome.</a> Nature. 505 (7485), 706-709 (2014).</li><li>Spitale, R. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+imprints+in+vivo+decode+RNA+regulatory+mechanisms.">Structural imprints in vivo decode RNA regulatory mechanisms.</a> Nature. 519 (7544), 486-490 (2015).</li><li>Ding, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+genome-wide+profiling+of+RNA+secondary+structure+reveals+novel+regulatory+features.">In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features.</a> Nature. 505 (7485), 696-700 (2014).</li><li>Rouskin, S., Zubradt, M., Washietl, S., Kellis, M., Weissman, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+probing+of+RNA+structure+reveals+active+unfolding+of+mRNA+structures+in+vivo.">Genome-wide probing of RNA structure reveals active unfolding of mRNA structures in vivo.</a> Nature. 505 (7485), 701-705 (2014).</li><li>Kudla, G., Granneman, S., Hahn, D., Beggs, J. D., Tollervey, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-linking,+ligation,+and+sequencing+of+hybrids+reveals+RNA-RNA+interactions+in+yeast.">Cross-linking, ligation, and sequencing of hybrids reveals RNA-RNA interactions in yeast.</a> Proc.Natl.Acad.Sci.U.S.A. 108 (24), 10010-10015 (2011).</li><li>Sugimoto, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=hiCLIP+reveals+the+in+vivo+atlas+of+mRNA+secondary+structures+recognized+by+Staufen+1.">hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1.</a> Nature. 519 (7544), 491-494 (2015).</li><li>Engreitz, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-RNA+interactions+enable+specific+targeting+of+noncoding+RNAs+to+nascent+Pre-mRNAs+and+chromatin+sites.">RNA-RNA interactions enable specific targeting of noncoding RNAs to nascent Pre-mRNAs and chromatin sites.</a> Cell. 159 (1), 188-199 (2014).</li><li>Ramani, V., Qiu, R., Shendure, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+determination+of+RNA+structure+by+proximity+ligation.">High-throughput determination of RNA structure by proximity ligation.</a> Nat.Biotechnol. , (2015).</li><li>Lu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+Duplex+Map+in+Living+Cells+Reveals+Higher-Order+Transcriptome+Structure.">RNA Duplex Map in Living Cells Reveals Higher-Order Transcriptome Structure.</a> Cell. 165 (5), 1267-1279 (2016).</li><li>Sharma, E., Sterne-Weiler, T., O'Hanlon, D., Blencowe, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+Mapping+of+Human+RNA-RNA+Interactions.">Global Mapping of Human RNA-RNA Interactions.</a> Mol.Cell. 62 (4), 618-626 (2016).</li><li>Aw, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vivo+Mapping+of+Eukaryotic+RNA+Interactomes+Reveals+Principles+of+Higher-Order+Organization+and+Regulation.">In Vivo Mapping of Eukaryotic RNA Interactomes Reveals Principles of Higher-Order Organization and Regulation.</a> Mol.Cell. 62 (4), 603-617 (2016).</li></ol>

Aqui, descrevemos em detalhes o fluxo de trabalho experimental e computacional para SPLASH, um método que nos permite identificar par-sábio RNA interações em um genoma-wide maneira. Utilizamos com sucesso SPLASH em bactérias, leveduras e culturas humanas e antecipamos que a estratégia pode ser amplamente aplicada a diversos organismos em diferentes estados celulares. Uma das etapas críticas no protocolo é começar com pelo menos 20 μg de RNA reticulado para ter material adequado para processos a jusante. O ARN ...

Estudar como as macromoléculas se dobram e interagem entre si é a chave para a compreensão da regulação genética na célula. Embora muitos esforços tenham sido focados na década passada na compreensão de como o DNA e as proteínas contribuem para a regulação genética, relativamente menos se sabe sobre a regulação pós-transcricional da expressão gênica. O ARN contém informação tanto na sua sequência linear como na sua estrutura secundária e terciária 1 . Sua capacidade de basear o par com si e com os outros é importante para a sua função in vivo . Os avanços recentes na sondagem de estrutura secundária de RNA de alto rendimento proporcionaram informações valiosas sobre as localizações de regiões duplas e de cadeia simples no transcriptoma 2 , 3 , 4 , 5 , 6 , 7 , 8 , howeVer informações sobre o emparelhamento interação parceiros ainda está em grande parte ausente. Para determinar qual a sequï¿½cia de ARN que interage com outra regiï¿½ de ARN no transcriptoma, necessitamos de informaï¿½o global de pares. Mapear par-sábio RNA interações em um global, imparcial forma tem sido tradicionalmente um grande desafio. Embora as abordagens anteriores, tais como CLASH 9 , hiCLIP 10 e RAP 11 , sejam usadas para identificar as interações de RNA em uma maneira de grande escala, essas técnicas tipicamente mapeiam o par de bases de RNA para um subconjunto de RNAs que interagem com uma determinada proteína ou espécies de RNA. Os desenvolvimentos recentes no estudo de interacções de ARN globais incluem o método RPL 12 , que não estabiliza as interacções de ARN in vivo e, portanto, só pode capturar um subconjunto de interacções in vivo . Para superar esses desafios, nós e outros desenvolvemos estratégias genéticas, semP ARN interacional in vivo , utilizando versões modificadas do reticulador psoraleno 13 , 14 , 15 . Neste protocolo, descrevemos os pormenores para realizar a equalização de S de Hélidos H reticulados, S igated e S elegidos por P soralen (SPLASH), que utiliza psoraleno biotinilado para reticular ARNs de emparelhamento de bases in vivo , seguido por ligação de proximidade e sequenciação de alto rendimento a Identificar parceiros de ARN-base de ligação genoma-wide ( Figura 1 ] 15 . Neste manuscrito, descrevemos as etapas para realizar SPLASH usando células aderentes cultivadas, neste caso células HeLa. O mesmo protocolo pode ser facilmente adaptado a células de mamífero de suspensão e a células de levedura e bactérias. Resumidamente, as células HeLa são tratadas com psoraleno biotinilado e irradiadas a 365 nm para interligar os pares de bases de ARN em interacção in vivo. Os RNAs são então extraídos das células, fragmentados e enriquecidos para regiões de reticulação usando esferas de estreptavidina. Os fragmentos de ARN que interagem são então ligados em conjunto utilizando ligadura de proximidade e transformados numa biblioteca de cDNA para sequenciação profunda. Após sequenciação, os ARN quiméricos são mapeados no transcriptoma / genoma para identificar as regiões que interagem com o ARN que estão emparelhadas entre si. Utilizamos com sucesso SPLASH para identificar milhares de interações de RNA in vivo em leveduras e diferentes células humanas, incluindo emparelhamento de ARN intramolecular e intermolecular em diversas classes de RNAs, como snoRNAs, lncRNAs e mRNAs, vislumbrando os padrões de organização estrutural e interação De RNAs na célula.

<table border="0" cellpadding="0" cellspacing="0" width="1136">
	<colgroup>
		<col />
		<col span="3" />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:284px;">1 Kb Plus DNA Ladder</td>
			<td style="width:284px;">Life Technologies Holdings Pte Ltd</td>
			<td style="width:284px;">10787026</td>
			<td style="width:284px;">DNA ladder</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10 bp DNA ladder</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>10821-015</td>
			<td>DNA ladder</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">20 % SDS solution</td>
			<td>First BASE</td>
			<td>BUF-2052-1L&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">20x SSC</td>
			<td>First BASE</td>
			<td>BUF-3050-20X1L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">3.0 M Sodium Acetate Solution</td>
			<td>First BASE</td>
			<td>BUF-1151-1L-pH5.2&#160;&#160;</td>
			<td>Required for nucleic acid precipitation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">40% Acrylamide/Bis Solution, 19:1</td>
			<td>Bio-Rad</td>
			<td>1610145</td>
			<td>TBE Urea gel component</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ambion Buffer Kit</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>AM9010</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ammonium Persulfate, Molecular Grade&#160;&#160;</td>
			<td>Promega</td>
			<td>V3131&#160;</td>
			<td>TBE Urea gel component</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Bromophenol Blue</td>
			<td>Sigma-Aldrich</td>
			<td>B0126-25G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Chloroform</td>
			<td>Merck</td>
			<td>1.02445.1000</td>
			<td>RNA extraction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Single strand DNA ligase</td>
			<td>Epicentre</td>
			<td>CL9025K</td>
			<td>CircLigase II ssDNA Ligase</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Centrifuge tube filters</td>
			<td>Sigma-Aldrich</td>
			<td>CLS8160-96EA</td>
			<td>Costar Spin-X centrifuge tube filters</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">D5628-1G DIGITONIN CRYSTALLINE</td>
			<td>Sigma-Aldrich</td>
			<td>D5628-1G</td>
			<td>For cell treatment</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dark Reader Transilluminator&#160;</td>
			<td>Clare Chemical Research</td>
			<td>Dark Reader DR89X Transilluminator</td>
			<td>Blue light transilluminator</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA Gel Loading Dye (6X)</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>R0611</td>
			<td>Required for agarose gel electroporation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Dulbecco&#39;s Modified Eagle Medium</td>
			<td>Pan BioTech</td>
			<td>P04-03500</td>
			<td>For Hela cell culture</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Streptavidin magnetic beads</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>65002</td>
			<td>Dynabeads MyOne Streptavidin C1&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Magnetic stand for 15ml tubes</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>12301D</td>
			<td>DynaMag-15</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Magnetic stand for 15ml tubes</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>&#160;12321D</td>
			<td>DynaMag-2</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">ThermoMixer</td>
			<td>Eppendorf</td>
			<td>5382 000.015</td>
			<td>Eppendorf ThermoMixer&#160;C</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Biotinylated psoralen</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>29986</td>
			<td>EZ-Link Psoralen-PEG3-Biotin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">F8T5/BL&#160;</td>
			<td>Hitachi</td>
			<td>F8T5/BL&#160;</td>
			<td>365 nm UV bulb</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Fetal Bovine Serum</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>10270106&#160;&#160;</td>
			<td>Components of Hela medium</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Formamide</td>
			<td>Promega</td>
			<td>H5052&#160;&#160;</td>
			<td>Component in hybridization buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">G8T5</td>
			<td>Sankyo-Denki</td>
			<td>G8T5</td>
			<td>254 nm UV bulb</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Glycogen&#160;</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>10814010</td>
			<td>Required for nucleic acid precipitation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nanodrop</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>Nanodrop 2000</td>
			<td>Spectrophotometer for nucleic acidquantification</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Nuclease free water&#160;</td>
			<td>First BASE</td>
			<td>BUF-1180-500ml&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Penicillin Streptomycin&#160;&#160;</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>15140122&#160;&#160;</td>
			<td>Components of Hela medium</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">High-Fidelity DNA polymerase (2x)</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>F531L&#160;</td>
			<td>Phusion High-Fidelity PCR Master Mix with HF Buffer (2x)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Primers Set 1</td>
			<td>New England Biolabs</td>
			<td>E7335L&#160;</td>
			<td>PCR primers</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA Gel Extraction Kit</td>
			<td>QIAgen</td>
			<td>28106</td>
			<td>QIAquick Gel Extraction Kit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fluorometric Quantification kit</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>Q32854</td>
			<td>Qubit dsDNA HS Assay Kit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA clean up kit</td>
			<td>Qiagen</td>
			<td>74106</td>
			<td>RNeasy Mini Kit Silica-membrane column</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Rnase Inhibitor</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>AM2696</td>
			<td>SUPERase In</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Reverse transcriptase</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>18080400</td>
			<td>SuperScript III First-Strand Synthesis SuperMix</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Nucleic Acid Gel Stain</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>S11494</td>
			<td>SYBR GOLD NUCLEIC ACID 500 UL</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">T4 Polynucleotide Kinase</td>
			<td>New England Biolabs</td>
			<td>M0201L</td>
			<td>End repair enzyme</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">T4 RNA Ligase 1</td>
			<td>New England Biolabs</td>
			<td>M0204L</td>
			<td>Enzyme for proximity ligation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">T4 RNA Ligase 2, truncated KQ</td>
			<td>New England Biolabs</td>
			<td>M0373L</td>
			<td>Enzyme for adaptor ligation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Temed</td>
			<td>Bio-Rad</td>
			<td>1610801</td>
			<td>TBE Urea gel component</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Guanidinium thiocyanate-phenol-chloroform</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>15596018</td>
			<td>TRIzol&#174; Reagent for RNA extraction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Urea</td>
			<td>First BASE</td>
			<td>BIO-2070-5kg&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">UV crosslinker</td>
			<td>Stratagene</td>
			<td>400072</td>
			<td>UV Stratalinker 1800</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">UV Transilluminator</td>
			<td>UVP</td>
			<td>95-0417-01</td>
			<td>For visualizing of bands</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Xylene Cyanol FF</td>
			<td>Sigma-Aldrich</td>
			<td>X4126-10G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA cleanup it</td>
			<td>Zymo Research&#160;</td>
			<td>D4004</td>
			<td>Zymo DNA concentrator-5&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">List of software required</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastQC software</td>
			<td>0.11.4</td>
			<td>http://www.bioinformatics.babraham.ac.uk/projects/fastqc/</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SeqPrep software</td>
			<td>1.0.7</td>
			<td>https://github.com/jstjohn/SeqPrep</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BWA software</td>
			<td>0.7.12</td>
			<td>http://bio-bwa.sourceforge.net/</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SAMTOOLS software</td>
			<td>1.2.1</td>
			<td>http://www.htslib.org/</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PULLSEQ software</td>
			<td>1.0.2</td>
			<td>https://github.com/bcthomas/pullseq</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">STAR software</td>
			<td>2.5.0c</td>
			<td>https://github.com/alexdobin/STAR</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">rem_dups.py PYTHON script</td>
			<td>PYTHON 2.7.11</td>
			<td>https://github.com/CSB5/splash/tree/master/src</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">find_chimeras.py PYTHON script</td>
			<td>PYTHON 2.7.11</td>
			<td>https://github.com/CSB5/splash/tree/master/src</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pickJunctionReads.awk AWK script</td>
			<td>AWK GNU 4.1.2</td>
			<td>https://github.com/CSB5/splash/tree/master/src</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Buffer composition</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Elution buffer:&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.3 M sodium acetate</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Lysis Buffer:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50 mM Tris-Cl pH 7.0</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10 mM EDTA</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Always add Superase-in fresh before use except when washing beads</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Proteinase K Buffer&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">100 mM NaCl</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10 mM TrisCl pH 7.0</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM EDTA</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hybridization Buffer</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">750 mM NaCl</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50 mM Tris-Cl pH 7.0</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM EDTA</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15% formamide (store in the dark at 4 &#176;C)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Always add Superase-in fresh before use</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2x SSC Wash Buffer</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2x NaCl and Sodium citrate (SSC) (diluted from 20x SSC Invitrogen stock)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2X RNA fragmentation buffer</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">18mM MgCl2</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">450mM KCl</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">300mM Tris-CL pH 8.3</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2x RNA loading Dye:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">95% Formamide</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.02% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.02% bromophenol blue</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.01% Xylene Cyanol</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1mM EDTA&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">3&#39; RNA adapter sequence</td>
			<td>5rAppCTGTAGGCACCATCAAT/3ddC</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RT primer sequence</td>
			<td>AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC/iSp18/CACTCA/iSp18/TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

mapping rna-rna interactions globally using biotinylated psoralen

Saber como os RNAs interagem entre si e com os outros é fundamental para entender a regulação genética baseada no RNA na célula. Embora existam exemplos de interacções ARN-ARN, tais como interacções ARNm-ARNm, mostrou-se que regulam a expressão genética, a extensão total em que as interacções ARN ocorrem na célula é ainda desconhecida. Métodos anteriores para estudar as interações de RNA focaram principalmente em subconjuntos de RNAs que estão interagindo com uma determinada proteína ou espécies de RNA. Aqui, detalhamos um método chamado S equenciamento de P soralen reticulado, L igated, e S elegido H ybrids (SPLASH) que permite a captura do genoma de ARN interações in vivo de forma imparcial. SPLASH utiliza reticulação in vivo , ligação de proximidade e sequenciação de alto rendimento para identificar parceiros de ligação de bases de ARN intramoleculares e intermoleculares globalmente. SPLASH pode ser aplicado a diferentes organismos, incluindo bactérias, leveduras e células humanas, bemS diversas condições celulares para facilitar a compreensão da dinâmica da organização do RNA sob diversos contextos celulares. Todo o protocolo SPLASH experimental leva cerca de 5 dias para ser concluído eo fluxo de trabalho computacional leva aproximadamente 7 dias para ser concluído.

A Figura 1 ilustra o esquema do fluxo de trabalho SPLASH. Após a adição de psoraleno biotinilado na presença de 0,01% de digitonina e reticulação UV, o ARN total é extraído das células e é efectuada uma transferência de pontos para assegurar que a reticulação do biotinilado com o ARN tenha ocorrido eficientemente ( Figura 2 ). Utilizamos oligos biotinilados de 20 bases como controlos positivos para titular a quantid...

Watch this Scientific Journal Video about Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen at JoVE.com

Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen

Aqui, detalhamos o método de equação de S de sorgo de P soralen reticulado, L igado e Híbridos H elegidos (SPLASH), que permite o mapeamento genômico de interações intramoleculares e intermoleculares RNA-RNA in vivo . SPLASH pode ser aplicado para estudar os interactomas de RNA de organismos, incluindo leveduras, bactérias e seres humanos.

Mapeando as Interações RNA-ARN Globalmente Usando Psoraleno Biotinilado

Knowing how RNAs interact with themselves and with others is key to understanding RNA based gene regulation in the cell. While examples of RNA-RNA ...

Research

JoVE Journal

Genetics

Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation

Conjugadas acasalamento Os ensaios para a análise específica da sequência de proteínas de transferência envolvidos na conjugação bacteriana

The transfer of genetic material by bacterial conjugation is a process that takes place via complexes formed by specific transfer proteins. In Escherichia ...

Genética

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

Mapeamento QTL e edição CRISPR / Cas9 para identificar um gene de resistência a medicamentos em<em&gt; Toxoplasma gondii</em

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the ...

Single Molecule Analysis of Laser Localized Psoralen Adducts

Único Análise Molécula do laser localizadas psoralênica adutos

The DNA Damage Response (DDR) has been extensively characterized in studies of double strand breaks (DSBs) induced by laser micro beam irradiation in live ...

Genome-wide Mapping of Protein-DNA Interactions with ChEC-seq in Saccharomyces cerevisiae

Genome-wide Mapping of Protein-DNA Interactions with ChEC-seq in Saccharomyces cerevisiae

Mapeamento genômico de interações proteína-DNA com ChEC-seq em<em&gt; Saccharomyces cerevisiae</em

Genome-wide mapping of protein-DNA interactions is critical for understanding gene regulation, chromatin remodeling, and other chromatin-resident ...

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

Varredura Retroviral: Mapeamento de sites de integração MLV para definir regiões reguladoras específicas de células

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

Mapping Genome-wide Accessible Chromatin in Primary Human T Lymphocytes by ATAC-Seq

Mapeamento de genoma-larga acessível cromatina em linfócitos T humana primária pela ATAC-Seq

Assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-seq) is a method used for the identification of open (accessible) regions ...

Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions

Promotor captura Oi-c: Alta resolução, todo o genoma caracterização das interações do promotor

The three-dimensional organization of the genome is linked to its function. For example, regulatory elements such as transcriptional enhancers control the ...

A Fast and Quantitative Method for Post-translational Modification and Variant Enabled Mapping of Peptides to Genomes

Um método rápido e quantitativo para a modificação pós-traducional e variante habilitado para mapeamento de peptídeos de genomas

Cross-talk between genes, transcripts, and proteins is the key to cellular responses; hence, analysis of molecular levels as distinct entities is slowly ...

Transcription Start Site Mapping Using Super-low Input Carrier-CAGE

Transcrição iniciar o mapeamento do site usando super-baixa entrada Carrier-CAGE

Cap analysis of gene expression (CAGE) is a method used for single-nucleotide resolution detection of RNA polymerase II transcription start sites (TSSs). ...

In Vitro Biochemical Assays using Biotin Labels to Study Protein-Nucleic Acid Interactions

Ensaios bioquímicos in vitro utilizando rótulos de biotina para estudar interações ácido proteína-nucleico

Protein-nucleic acid interactions play important roles in biological processes such as transcription, recombination, and RNA metabolism. Experimental ...