Name: retroviral scanning: mapping mlv integration sites to define cell-specific regulatory regions
Uploaded: 2017-05-28T14:00:00
Description: Watch this Scientific Journal Video about Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions at JoVE.com

Ce travail a été soutenu par des subventions du Conseil européen de la recherche (ERC-2010-AdG, GT-SKIN), du Ministère italien de l&#39;éducation, des universités et de la recherche (FIRB-Futuro in Ricerca 2010-RBFR10OS4G, FIRB-Futuro in Ricerca 2012-RBFR126B8I_003 , EPIGEN Epigenomics Flagship Project), le ministère italien de la Santé (Jeunes chercheurs appelle 2011 GR-2011-02352026) et la Fondation Imagine Institute (Paris, France).

1. Transduction MLV des cellules humaines <ol><li> Isoler les cellules cibles et les transduire avec un vecteur retroviral dérivé de mLV hébergeant le gène rapporteur eGFP et pseudotypé avec le virus de la stomatite vésiculaire G (VSV-G) ou la glycoprotéine de l&#39;enveloppe amphotrope 16 . <ol><li> Gardez les cellules transduites par défaut comme un contrôle négatif pour les analyses suivantes. Puisque les vecteurs rétroviraux à base de mLV peuvent transduire effi...

<ol>
	<li>Ernst, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+and+analysis+of+chromatin+state+dynamics+in+nine+human+cell+types.">Mapping and analysis of chromatin state dynamics in nine human cell types.</a> Nature. 473 (7345), 43-49 (2011).</li><li>Shlyueva, D., Stampfel, G., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+enhancers:+from+properties+to+genome-wide+predictions.">Transcriptional enhancers: from properties to genome-wide predictions.</a> Nat Rev Genet. 15 (4), 272-286 (2014).</li><li>Roadmap Epigenomics Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+111+reference+human+epigenomes.">Integrative analysis of 111 reference human epigenomes.</a> Nature. 518 (7539), 317-330 (2015).</li><li>Heintzman, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+modifications+at+human+enhancers+reflect+global+cell-type-specific+gene+expression.">Histone modifications at human enhancers reflect global cell-type-specific gene expression.</a> Nature. 459 (7243), 108-112 (2009).</li><li>Creyghton, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+H3K27ac+separates+active+from+poised+enhancers+and+predicts+developmental+state.">Histone H3K27ac separates active from poised enhancers and predicts developmental state.</a> Proc Natl Acad Sci U S A. 107 (50), 21931-21936 (2010).</li><li>Hnisz, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Super-enhancers+in+the+control+of+cell+identity+and+disease.">Super-enhancers in the control of cell identity and disease.</a> Cell. 155 (4), 934-947 (2013).</li><li>Cattoglio, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-definition+mapping+of+retroviral+integration+sites+identifies+active+regulatory+elements+in+human+multipotent+hematopoietic+progenitors.">High-definition mapping of retroviral integration sites identifies active regulatory elements in human multipotent hematopoietic progenitors.</a> Blood. 116 (25), 5507-5517 (2010).</li><li>Biasco, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+profile+of+retroviral+vector+in+gene+therapy+treated+patients+is+cell-specific+according+to+gene+expression+and+chromatin+conformation+of+target+cell.">Integration profile of retroviral vector in gene therapy treated patients is cell-specific according to gene expression and chromatin conformation of target cell.</a> EMBO Mol Med. 3 (2), 89-101 (2011).</li><li>De Ravin, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancers+are+major+targets+for+murine+leukemia+virus+vector+integration.">Enhancers are major targets for murine leukemia virus vector integration.</a> J Virol. 88 (8), 4504-4513 (2014).</li><li>LaFave, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mLV+integration+site+selection+is+driven+by+strong+enhancers+and+active+promoters.">mLV integration site selection is driven by strong enhancers and active promoters.</a> Nucleic Acids Res. 42 (7), 4257-4269 (2014).</li><li>Gupta, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bromo-+and+extraterminal+domain+chromatin+regulators+serve+as+cofactors+for+murine+leukemia+virus+integration.">Bromo- and extraterminal domain chromatin regulators serve as cofactors for murine leukemia virus integration.</a> J Virol. 87 (23), 12721-12736 (2013).</li><li>Sharma, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BET+proteins+promote+efficient+murine+leukemia+virus+integration+at+transcription+start+sites.">BET proteins promote efficient murine leukemia virus integration at transcription start sites.</a> Proc Natl Acad Sci U S A. 110 (29), 12036-12041 (2013).</li><li>De Rijck, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BET+family+of+proteins+targets+moloney+murine+leukemia+virus+integration+near+transcription+start+sites.">The BET family of proteins targets moloney murine leukemia virus integration near transcription start sites.</a> Cell reports. 5 (4), 886-894 (2013).</li><li>Romano, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional,+epigenetic+and+retroviral+signatures+identify+regulatory+regions+involved+in+hematopoietic+lineage+commitment.">Transcriptional, epigenetic and retroviral signatures identify regulatory regions involved in hematopoietic lineage commitment.</a> Sci Rep. 6, 24724 (2016).</li><li>Cavazza, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+Transcriptional+and+Epigenetic+Regulation+of+Human+Epidermal+Keratinocyte+Differentiation.">Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation.</a> Stem Cell Reports. 6 (4), 618-632 (2016).</li><li>Miller, A. D., Law, M. F., Verma, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+helper-free+amphotropic+retroviruses+that+transduce+a+dominant-acting,+methotrexate-resistant+dihydrofolate+reductase+gene.">Generation of helper-free amphotropic retroviruses that transduce a dominant-acting, methotrexate-resistant dihydrofolate reductase gene.</a> Mol Cell Biol. 5 (3), 431-437 (1985).</li><li>Cattoglio, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-definition+mapping+of+retroviral+integration+sites+defines+the+fate+of+allogeneic+T+cells+after+donor+lymphocyte+infusion.">High-definition mapping of retroviral integration sites defines the fate of allogeneic T cells after donor lymphocyte infusion.</a> PLoS One. 5 (12), e15688 (2010).</li><li>Aiuti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+hematopoietic+stem+cell+gene+therapy+in+patients+with+Wiskott-Aldrich+syndrome.">Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome.</a> Science. 341 (6148), 1233151 (2013).</li><li>Biffi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+hematopoietic+stem+cell+gene+therapy+benefits+metachromatic+leukodystrophy.">Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy.</a> Science. 341 (6148), 1233158 (2013).</li><li>Gabriel, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+genomic+access+to+vector+integration+in+clinical+gene+therapy.">Comprehensive genomic access to vector integration in clinical gene therapy.</a> Nat Med. 15 (12), 1431-1436 (2009).</li><li>Gillet, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+host+genomic+environment+of+the+provirus+determines+the+abundance+of+HTLV-1-infected+T-cell+clones.">The host genomic environment of the provirus determines the abundance of HTLV-1-infected T-cell clones.</a> Blood. 117 (11), 3113-3122 (2011).</li></ol>

Ici, nous avons décrit un protocole pour la cartographie génomique des sites d&#39;intégration de mLV, un rétrovirus qui cible les régions de chromatine, marquées épigénétiquement en tant que promoteurs et amplificateurs actifs. Les étapes critiques et / ou les limitations du protocole comprennent: (i) la transduction de mLV de la population de cellules cibles; (Ii) l&#39;amplification des jonctions virus-hôte par LM-PCR; (Iii) récupération d&#39;une fraction élevée des sites d&#39;intégration. Les vecte...

L&#39;identité cellulaire est déterminée par l&#39;expression d&#39;ensembles spécifiques de gènes. Le rôle des éléments cis-régulateurs, tels que les promoteurs et les amplificateurs, est crucial pour l&#39;activation de programmes de transcription spécifiques au type cellulaire. Ces régions réglementaires sont caractérisées par des caractéristiques spécifiques de la chromatine, telles que les modifications particulières des histones, les facteurs de transcription et la liaison des co-facteurs, et l&#39;accessibilité à la chromatine, qui ont été largement utilisés pour leur identification à l&#39;échelle du génome dans plusieurs types de cellules 1 , 2 , 3 . En particulier, le profil génomique de l&#39;acétylation de l&#39;histone H3 lysine 27 (H3K27ac) est couramment utilisé pour définir des promoteurs actifs, des amplificateurs et des super-amplificateurs 4 , 5 , 6 . Le virus de la leucémie murine Moloney (MLV) est un retrovirus gamma largement utilisé pour le gèneTransfert dans des cellules de mammifères. Après avoir infecté une cellule cible, le génome d&#39;ARN rétroviral est rétro-transcrit dans une molécule d&#39;ADN double brin qui se lie aux protéines virales et cellulaires pour assembler le complexe de pré-intégration (PIC). La PIC entre dans le noyau et lie la chromatine de la cellule hôte. Ici, l&#39;intégrase virale, un composant clé PIC, sert à faciliter l&#39;intégration de l&#39;ADN proviral dans le génome de la cellule hôte. L&#39;intégration de mLV dans l&#39;ADN génomique n&#39;est pas aléatoire, mais se produit dans des éléments actifs régulateurs cis, tels que des promoteurs et des amplificateurs, de manière spécifique aux cellules 7 , 8 , 9 , 10 . Ce profil d&#39;intégration particulier est médié par une interaction directe entre l&#39;intégrase de mLV et les protéines de domaine de bromodomane cellulaire et de domaine extraterminal (BET) 11 , 12 , 13 . Les protéines BET (BRD2, BRD3 etBRD4) agissent comme un pont entre la chromatine de l&#39;hôte et la PIC de mLV: à travers leurs bromodomains, ils reconnaissent des régions régulatrices cis cisées, fortement acceptées, tandis que le domaine extraterminal interagit avec l&#39;intégrase de mLV 11 , 12 , 13 . Ici, nous décrivons le balayage rétroviral, un nouvel outil pour mapper les régions actives cis-régulatrices en fonction des propriétés d&#39;intégration de mLV. Brièvement, les cellules sont transduites avec un vecteur rétroviral dérivé de mLV exprimant le gène rapporteur de la protéine fluorescente verte améliorée (eGFP). Après l&#39;extraction de l&#39;ADN génomique, les jonctions entre la répétition terminale de 3 &#39;(LTR) du vecteur mLV et l&#39;ADN génomique sont amplifiées par une PCR médiatisée (LM-PCR) et séquencées massivement. Les sites d&#39;intégration mLV sont mappés au génome humain et les régions génomiques hautement ciblées par mLV sont définies comme des grappes de sites d&#39;intégration mLV. Analyse rétroviraleA été utilisé pour définir des éléments régulateurs actifs spécifiques de cellules dans plusieurs cellules primaires humaines 14 , 15 . Les grappes de mLV ont été co-mappées avec des promoteurs et des amplificateurs définis de manière épigénétique, dont la plupart abritaient des marques d&#39;histones actives, telles que H3K27ac, et étaient spécifiques de cellules. Le balayage rétroviral permet l&#39;identification à l&#39;échelle du génome des éléments de régulation de l&#39;ADN dans les populations de cellules prospectivement purifiées 7 , 14 ainsi que dans les populations de cellules rétrospectivement définies, telles que les cellules souches de kératinocytes, qui ne présentent pas de marqueurs efficaces pour l&#39;isolement prospectif 15 .

<table>
	<tbody>
		<tr>
			<td>PBS, pH 7.4</td>
			<td>ThermoScientific</td>
			<td>10010031</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>ThermoScientific</td>
			<td>16000044</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>0.2 ml tubes</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>1.5 ml tubes</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>QIAGEN QIAmp DNA mini Kit&#160;</td>
			<td>QIAGEN</td>
			<td>51306</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>T4 DNA ligase&#160;</td>
			<td>New England BioLabs</td>
			<td>M0202T</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA Ligase Reaction buffer</td>
			<td>New England BioLabs</td>
			<td>M0202T</td>
			<td></td>
		</tr>
		<tr>
			<td>Linker Plus Strand oligonucleotide</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-PO4-TAGTCCCTTAAGCGGAG-3&#8217;&#160; (Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Linker Minus Strand oligonucleotide</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC-3&#8217; (Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Tru9I</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11464825001</td>
			<td></td>
		</tr>
		<tr>
			<td>SuRE/Cut Buffer M</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11417983001</td>
			<td></td>
		</tr>
		<tr>
			<td>PstI&#160;</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>10798991001</td>
			<td></td>
		</tr>
		<tr>
			<td>SuRE/Cut Buffer H</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11417991001</td>
			<td></td>
		</tr>
		<tr>
			<td>Platinum Taq DNA Polimerase High Fidelity&#160;</td>
			<td>Invitrogen</td>
			<td>11304011</td>
			<td></td>
		</tr>
		<tr>
			<td>10mM dNTP Mix</td>
			<td>Invitrogen</td>
			<td>18427013</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>PCR grade water</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>96-well thermal cycler (with heated lid)</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>linker primer</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GTAATACGACTCACTATAGGGC-3&#8217; (Purification grade: PCR grade)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR primer</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GACTTGTGGTCTCGCTGTTCCTTGG-3&#8217; (Purification grade: PCR grade)</td>
		</tr>
		<tr>
			<td>linker nested primer 454</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GCCTTGCCAGCCCGCTCAG[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR nested primer 454</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GCCTCCCTCGCGCCATCAGTAGC[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>linker nested primer Illumina</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#39;-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR nested primer Illumina</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#39;-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Sodium Acetate Solution (3M) pH 5.2</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol (absolute) for molecular biology</td>
			<td>Sigma-Aldrich</td>
			<td>E7023</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Topo TA Cloning kit (with pCR2.1-TOPO vector)</td>
			<td>Invitrogen</td>
			<td>K4500-01</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction kit</td>
			<td>QIAGEN</td>
			<td>28704</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Sigma-Aldrich</td>
			<td>A9539</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Ethidium bromide&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>E1510</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>100 bp DNA ladder</td>
			<td>Invitrogen</td>
			<td>15628019</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>6X Loading Buffer</td>
			<td>ThermoScientific</td>
			<td>R0611</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>NanoDrop 2000 UV-Vis Spectrophotometer</td>
			<td>ThermoScientific</td>
			<td>ND-2000</td>
			<td></td>
		</tr>
		<tr>
			<td>Nextera XT Index kit</td>
			<td>Illumina</td>
			<td>FC-131-1001 or FC-131-1002</td>
			<td></td>
		</tr>
		<tr>
			<td>2x KAPA HiFi Hot Start Ready Mix&#160;</td>
			<td>KAPA Biosystems</td>
			<td>KK2601</td>
			<td></td>
		</tr>
		<tr>
			<td>Dynal magnetic stand for 2 ml tubes</td>
			<td>Invitrogen</td>
			<td>12321D</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Agencourt AMPure XP 60 ml kit</td>
			<td>Beckman Coulter Genomics</td>
			<td>A63881</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl 10 mM, pH 8.5</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2200 TapeStation system</td>
			<td>Agilent Technologies</td>
			<td>G2964AA</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>D1000 ScreenTape</td>
			<td>Agilent Technologies</td>
			<td>5067-5582</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>D1000 Reagents</td>
			<td>Agilent Technologies</td>
			<td>5067-5583</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>KAPA Library Quantification Kit for Illumina platforms (ABI Prism)</td>
			<td>KAPA Biosystems</td>
			<td>KK4835</td>
			<td></td>
		</tr>
		<tr>
			<td>ABI Prism 7900HT Fast Real-Time PCR System</td>
			<td>Applied Biosystems</td>
			<td>4329003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaOH 1.0 N, molecular biology-grade</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HT1 (Hybridization Buffer)</td>
			<td>Illumina&#160;</td>
			<td>Provided in the MiSeq Reagent Kit</td>
			<td></td>
		</tr>
		<tr>
			<td>MiSeq Reagent Kit v3 (150 cycles)</td>
			<td>Illumina</td>
			<td>MS-102-3001</td>
			<td></td>
		</tr>
		<tr>
			<td>MiSeq System</td>
			<td>Illumina</td>
			<td>SY-410-1003</td>
			<td></td>
		</tr>
		<tr>
			<td>PhiX Control v3</td>
			<td>Illumina</td>
			<td>FC-110-3001</td>
			<td></td>
		</tr>
	</tbody>
</table>

retroviral scanning: mapping mlv integration sites to define cell-specific regulatory regions

Les vecteurs rétroviraux à base de virus de la leucémie murine Moloney (MLV) s&#39;intègrent principalement dans les agents améliorant et promoteurs acétylés. Pour cette raison, les sites d&#39;intégration mLV peuvent être utilisés comme marqueurs fonctionnels des éléments réglementaires actifs. Ici, nous présentons un outil de balayage rétroviral, qui permet l&#39;identification du génome des amplificateurs et des promoteurs spécifiques de cellules. En bref, la population de cellules cibles est transduit avec un vecteur dérivé de mLV et l&#39;ADN génomique est digéré avec une enzyme de restriction souvent coupante. Après ligature de fragments génomiques avec un lieur d&#39;ADN compatible, la réaction en chaîne par polymérase (LM-PCR) médiée par un lieur permet l&#39;amplification des jonctions génome virus-hôte. Un séquençage massif des amplicons est utilisé pour définir le profil d&#39;intégration de mLV en fonction du génome. Enfin, des grappes d&#39;intégrations récurrentes sont définies pour identifier les régions réglementaires spécifiques aux cellules, responsables de l&#39;activation des programmes de transcription spécifiques aux cellules. <p class= &quot;Jove_content&quot;&gt; L&#39;outil de balayage rétroviral permet l&#39;identification à l&#39;échelle du génome de promoteurs et d&#39;amplificateurs spécifiques de cellules dans des populations de cellules cibles prospectivement isolées. Notamment, le balayage rétroviral représente une technique instrumentale pour l&#39;identification rétrospective de populations rares ( p. Ex. Cellules souches somatiques) qui manquent de marqueurs robustes pour l&#39;isolement prospectif.

Flux de travail de la procédure de balayage rétroviral Le flux de travail de la procédure de balayage rétroviral est schématisé à la figure 1 . La population de cellules cibles est purifiée et transduit avec un vecteur rétroviral dérivé de mLV exprimant un gène rapporteur d&#39;eGFP. Le transgène est flanqué par les deux répétitions terminales longues identiques (LTR 5 &#39;et 3&#39;)...

Watch this Scientific Journal Video about Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions at JoVE.com

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

Nous décrivons ici un protocole pour la cartographie génomique des sites d&#39;intégration des vecteurs rétroviraux à base de virus de la leucémie murine Moloney dans les cellules humaines.

Numérisation Retroviral: Mapping des sites d&#39;intégration MLV pour définir des régions réglementaires spécifiques à une cellule

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

Research

JoVE Journal

Genetics

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

Mapping QTL et édition CRISPR / Cas9 pour identifier un gène de résistance aux médicaments<em&gt; Toxoplasma gondii</em

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the ...

Recherche

Génétique

Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen

Cartographie des interactions ARN-ARN à l&#39;échelle mondiale à l&#39;aide de psoralène biotinylé

Knowing how RNAs interact with themselves and with others is key to understanding RNA based gene regulation in the cell. While examples of RNA-RNA ...

Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow

Site d&#39;intégration bidirectionnel Retroviral Méthodologie PCR et analyse de données quantitatives Workflow

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral ...

G2-seq: A High Throughput Sequencing-based Technique for Identifying Late Replicating Regions of the Genome

G2-seq : Une haut débit basée sur le séquençage Technique d’identification tard reproduisant des régions du génome

Numerous techniques have been developed to follow the progress of DNA replication through the S phase of the cell cycle. Most of these techniques have ...

Formaldehyde-assisted Isolation of Regulatory Elements to Measure Chromatin Accessibility in Mammalian Cells

Formaldéhyde-assisted isolement des éléments régulateurs à mesure accessibilité de la chromatine dans les cellules de mammifères

Appropriate gene expression in response to extracellular cues, that is, tissue- and lineage-specific gene transcription, critically depends on highly ...

A Fast and Quantitative Method for Post-translational Modification and Variant Enabled Mapping of Peptides to Genomes

Une méthode rapide et Quantitative pour Modification post-traductionnelle et variante compatible cartographie des Peptides aux génomes

Cross-talk between genes, transcripts, and proteins is the key to cellular responses; hence, analysis of molecular levels as distinct entities is slowly ...

A Novel Saturation Mutagenesis Approach: Single Step Characterization of Regulatory Protein Binding Sites in RNA Using Phosphorothioates

Une approche de mutagenèse roman Saturation : Seule étape caractérisation des protéines régulatrices accepteurs en ARN utilisant Phosphorothioates

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to ...

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

High-throughput Identification des séquences régulatrices du gène à l’aide de prochaine génération séquençage du Chromosome circulaire Conformation Capture (4C-seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

Seule goutte numérique PCR pour la détection complète et simultanée des Mutations dans les régions de Hotspot

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation ...

Exploring Sequence Space to Identify Binding Sites for Regulatory RNA-Binding Proteins

Explorer l'espace de séquence pour identifier les sites de liaison pour les protéines de liaison de l'ARN réglementaires

Gene regulation plays an important role in all cells. Transcriptional, post-transcriptional (or RNA processing), translational, and post-translational ...