Name: retroviral scanning: mapping mlv integration sites to define cell-specific regulatory regions
Uploaded: 2017-05-28T14:00:00
Description: Watch this Scientific Journal Video about Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions at JoVE.com

Diese Arbeit wurde durch Stipendien des Europäischen Forschungsrates (ERC-2010-AdG, GT-SKIN), des italienischen Ministeriums für Bildung, Universitäten und Forschung (FIRB-Futuro in Ricerca 2010-RBFR10OS4G, FIRB-Futuro in Ricerca 2012-RBFR126B8I_003) unterstützt , EPIGEN Epigenomics Flagship Project), das italienische Gesundheitsministerium (Young Researchers Call 2011 GR-2011-02352026) und die Imagine Institute Foundation (Paris, Frankreich).

1. MLV-Transduktion von menschlichen Zellen <ol><li> Isolieren Sie die Zielzellen und transduzieren sie mit einem mVV-abgeleiteten retroviralen Vektor, der das eGFP-Reportergen beherbergt und mit dem vesikulären Stomatitisvirus G (VSV-G) oder dem amphotropen Hüllglykoprotein 16 pseudotypisiert ist. <ol><li> Halten Sie mock-transduzierte Zellen als Negativkontrolle für die folgenden Analysen. Da mVV-basierte retrovirale Vektoren effizient transduzierende Zellen transduzieren ...

<ol>
	<li>Ernst, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+and+analysis+of+chromatin+state+dynamics+in+nine+human+cell+types.">Mapping and analysis of chromatin state dynamics in nine human cell types.</a> Nature. 473 (7345), 43-49 (2011).</li><li>Shlyueva, D., Stampfel, G., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+enhancers:+from+properties+to+genome-wide+predictions.">Transcriptional enhancers: from properties to genome-wide predictions.</a> Nat Rev Genet. 15 (4), 272-286 (2014).</li><li>Roadmap Epigenomics Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+111+reference+human+epigenomes.">Integrative analysis of 111 reference human epigenomes.</a> Nature. 518 (7539), 317-330 (2015).</li><li>Heintzman, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+modifications+at+human+enhancers+reflect+global+cell-type-specific+gene+expression.">Histone modifications at human enhancers reflect global cell-type-specific gene expression.</a> Nature. 459 (7243), 108-112 (2009).</li><li>Creyghton, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+H3K27ac+separates+active+from+poised+enhancers+and+predicts+developmental+state.">Histone H3K27ac separates active from poised enhancers and predicts developmental state.</a> Proc Natl Acad Sci U S A. 107 (50), 21931-21936 (2010).</li><li>Hnisz, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Super-enhancers+in+the+control+of+cell+identity+and+disease.">Super-enhancers in the control of cell identity and disease.</a> Cell. 155 (4), 934-947 (2013).</li><li>Cattoglio, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-definition+mapping+of+retroviral+integration+sites+identifies+active+regulatory+elements+in+human+multipotent+hematopoietic+progenitors.">High-definition mapping of retroviral integration sites identifies active regulatory elements in human multipotent hematopoietic progenitors.</a> Blood. 116 (25), 5507-5517 (2010).</li><li>Biasco, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+profile+of+retroviral+vector+in+gene+therapy+treated+patients+is+cell-specific+according+to+gene+expression+and+chromatin+conformation+of+target+cell.">Integration profile of retroviral vector in gene therapy treated patients is cell-specific according to gene expression and chromatin conformation of target cell.</a> EMBO Mol Med. 3 (2), 89-101 (2011).</li><li>De Ravin, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancers+are+major+targets+for+murine+leukemia+virus+vector+integration.">Enhancers are major targets for murine leukemia virus vector integration.</a> J Virol. 88 (8), 4504-4513 (2014).</li><li>LaFave, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mLV+integration+site+selection+is+driven+by+strong+enhancers+and+active+promoters.">mLV integration site selection is driven by strong enhancers and active promoters.</a> Nucleic Acids Res. 42 (7), 4257-4269 (2014).</li><li>Gupta, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bromo-+and+extraterminal+domain+chromatin+regulators+serve+as+cofactors+for+murine+leukemia+virus+integration.">Bromo- and extraterminal domain chromatin regulators serve as cofactors for murine leukemia virus integration.</a> J Virol. 87 (23), 12721-12736 (2013).</li><li>Sharma, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BET+proteins+promote+efficient+murine+leukemia+virus+integration+at+transcription+start+sites.">BET proteins promote efficient murine leukemia virus integration at transcription start sites.</a> Proc Natl Acad Sci U S A. 110 (29), 12036-12041 (2013).</li><li>De Rijck, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BET+family+of+proteins+targets+moloney+murine+leukemia+virus+integration+near+transcription+start+sites.">The BET family of proteins targets moloney murine leukemia virus integration near transcription start sites.</a> Cell reports. 5 (4), 886-894 (2013).</li><li>Romano, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional,+epigenetic+and+retroviral+signatures+identify+regulatory+regions+involved+in+hematopoietic+lineage+commitment.">Transcriptional, epigenetic and retroviral signatures identify regulatory regions involved in hematopoietic lineage commitment.</a> Sci Rep. 6, 24724 (2016).</li><li>Cavazza, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+Transcriptional+and+Epigenetic+Regulation+of+Human+Epidermal+Keratinocyte+Differentiation.">Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation.</a> Stem Cell Reports. 6 (4), 618-632 (2016).</li><li>Miller, A. D., Law, M. F., Verma, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+helper-free+amphotropic+retroviruses+that+transduce+a+dominant-acting,+methotrexate-resistant+dihydrofolate+reductase+gene.">Generation of helper-free amphotropic retroviruses that transduce a dominant-acting, methotrexate-resistant dihydrofolate reductase gene.</a> Mol Cell Biol. 5 (3), 431-437 (1985).</li><li>Cattoglio, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-definition+mapping+of+retroviral+integration+sites+defines+the+fate+of+allogeneic+T+cells+after+donor+lymphocyte+infusion.">High-definition mapping of retroviral integration sites defines the fate of allogeneic T cells after donor lymphocyte infusion.</a> PLoS One. 5 (12), e15688 (2010).</li><li>Aiuti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+hematopoietic+stem+cell+gene+therapy+in+patients+with+Wiskott-Aldrich+syndrome.">Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome.</a> Science. 341 (6148), 1233151 (2013).</li><li>Biffi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+hematopoietic+stem+cell+gene+therapy+benefits+metachromatic+leukodystrophy.">Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy.</a> Science. 341 (6148), 1233158 (2013).</li><li>Gabriel, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+genomic+access+to+vector+integration+in+clinical+gene+therapy.">Comprehensive genomic access to vector integration in clinical gene therapy.</a> Nat Med. 15 (12), 1431-1436 (2009).</li><li>Gillet, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+host+genomic+environment+of+the+provirus+determines+the+abundance+of+HTLV-1-infected+T-cell+clones.">The host genomic environment of the provirus determines the abundance of HTLV-1-infected T-cell clones.</a> Blood. 117 (11), 3113-3122 (2011).</li></ol>

Hier haben wir ein Protokoll zur genomweiten Kartierung der Integrationsstellen von mLV beschrieben, ein Retrovirus, das Chromatinregionen anspricht, epigenetisch als aktive Promotoren und Enhancer markiert. Kritische Schritte und / oder Einschränkungen des Protokolls umfassen: (i) mLV-Transduktion der Zielzellpopulation; (Ii) Amplifikation von Virus-Host-Übergängen durch LM-PCR; (Iii) Abrufen eines hohen Anteils an Integrationsstellen. MLV-basierte retrovirale Vektoren effizient transduzierende Zellen. Die geringe E...

Die Zellidentität wird durch die Expression spezifischer Gene bestimmt. Die Rolle von cis-regulatorischen Elementen wie Promotoren und Enhancern ist entscheidend für die Aktivierung von zelltypspezifischen Transkriptionsprogrammen. Diese regulatorischen Regionen zeichnen sich durch spezifische Chromatin-Merkmale aus, wie z. B. eigenartige Histon-Modifikationen, Transkriptionsfaktoren und Co-Faktoren-Bindung und Chromatin-Zugänglichkeit, die für ihre genomweite Identifizierung in mehreren Zelltypen 1 , 2 , 3 weit verbreitet sind. Insbesondere wird das genomweite Profil der Acetylierung von Histon H3-Lysin 27 (H3K27ac) üblicherweise zur Definition von aktiven Promotoren, Enhancern und Super-Enhancern 4 , 5 , 6 verwendet. Moloney murine Leukämie-Virus (MLV) ist ein Gamma-Retrovirus, das weit verbreitet für Gen verwendet wirdTransfer in Säugetierzellen. Nach der Infektion einer Zielzelle wird das retrovirale RNA-Genom in einem doppelsträngigen DNA-Molekül retro-transkribiert, das virale und zelluläre Proteine ​​bindet, um den Vorintegrationskomplex (PIC) zu bilden. Der PIC tritt in den Kern ein und bindet das Wirtszellchromatin. Hier vermittelt die virale Integrase, eine Schlüssel-PIC-Komponente, die Integration der proviralen DNA in das Wirtszellgenom. Die mLV-Integration in die genomische DNA ist nicht zufällig, sondern tritt in aktiven cis-regulatorischen Elementen wie Promotoren und Enhancern in zellspezifischer Weise 7 , 8 , 9 , 10 auf . Dieses eigenartige Integrationsprofil wird durch eine direkte Wechselwirkung zwischen der mLV-Integrase und den zellulären Bromodomain- und extraterminalen Domänen (BET) -Proteinen 11 , 12 , 13 vermittelt. BET - Proteine ​​(BRD2, BRD3 undBRD4) als Brücke zwischen Wirtschromatin und mLV PIC: Durch ihre Bromodomänen erkennen sie hoch acetylierte cis-regulatorische Regionen, während die extraterminalen Domäne mit der mLV-Integrase 11 , 12 , 13 wechselwirkt. Hier beschreiben wir das retrovirale Scannen, ein neuartiges Werkzeug, um aktive cis-regulatorische Regionen auf der Basis der Integrationseigenschaften von mLV abzubilden. Kurz gesagt werden die Zellen mit einem mLV-abgeleiteten retroviralen Vektor transduziert, der das verstärkte rekonstruierte Gen (EGFP) -Reporter-Gen des grünen fluoreszierenden Proteins exprimiert. Nach der genomischen DNA-Extraktion werden die Übergänge zwischen der 3&#39;-langen terminalen Wiederholung (LTR) des mLV-Vektors und der genomischen DNA durch Linker-vermittelte PCR (LM-PCR) amplifiziert und massiv sequenziert. MLV-Integrationsstandorte werden dem menschlichen Genom zugeordnet, und genomische Regionen, die stark von mLV gezielt sind, werden als Cluster von mLV-Integrationsstellen definiert. Retroviraler ScanNing wurde verwendet, um zellspezifische aktive regulatorische Elemente in mehreren menschlichen Primärzellen 14 , 15 zu definieren. MLV-Cluster, die mit epigenetisch definierten Promotoren und Enhancern co-mapped waren, von denen die meisten aktive Histonmarken wie H3K27ac enthielten und zellspezifisch waren. Das retrovirale Scannen ermöglicht die genomweite Identifizierung von DNA-regulatorischen Elementen in prospektiv gereinigten Zellpopulationen 7 , 14 sowie in retrospektiv definierten Zellpopulationen wie Keratinozyten-Stammzellen, die keine wirksamen Marker für die prospektive Isolation fehlen 15 .

<table>
	<tbody>
		<tr>
			<td>PBS, pH 7.4</td>
			<td>ThermoScientific</td>
			<td>10010031</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>ThermoScientific</td>
			<td>16000044</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>0.2 ml tubes</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>1.5 ml tubes</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>QIAGEN QIAmp DNA mini Kit&#160;</td>
			<td>QIAGEN</td>
			<td>51306</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>T4 DNA ligase&#160;</td>
			<td>New England BioLabs</td>
			<td>M0202T</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA Ligase Reaction buffer</td>
			<td>New England BioLabs</td>
			<td>M0202T</td>
			<td></td>
		</tr>
		<tr>
			<td>Linker Plus Strand oligonucleotide</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-PO4-TAGTCCCTTAAGCGGAG-3&#8217;&#160; (Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Linker Minus Strand oligonucleotide</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC-3&#8217; (Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Tru9I</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11464825001</td>
			<td></td>
		</tr>
		<tr>
			<td>SuRE/Cut Buffer M</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11417983001</td>
			<td></td>
		</tr>
		<tr>
			<td>PstI&#160;</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>10798991001</td>
			<td></td>
		</tr>
		<tr>
			<td>SuRE/Cut Buffer H</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11417991001</td>
			<td></td>
		</tr>
		<tr>
			<td>Platinum Taq DNA Polimerase High Fidelity&#160;</td>
			<td>Invitrogen</td>
			<td>11304011</td>
			<td></td>
		</tr>
		<tr>
			<td>10mM dNTP Mix</td>
			<td>Invitrogen</td>
			<td>18427013</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>PCR grade water</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>96-well thermal cycler (with heated lid)</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>linker primer</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GTAATACGACTCACTATAGGGC-3&#8217; (Purification grade: PCR grade)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR primer</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GACTTGTGGTCTCGCTGTTCCTTGG-3&#8217; (Purification grade: PCR grade)</td>
		</tr>
		<tr>
			<td>linker nested primer 454</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GCCTTGCCAGCCCGCTCAG[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR nested primer 454</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GCCTCCCTCGCGCCATCAGTAGC[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>linker nested primer Illumina</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#39;-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR nested primer Illumina</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#39;-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Sodium Acetate Solution (3M) pH 5.2</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol (absolute) for molecular biology</td>
			<td>Sigma-Aldrich</td>
			<td>E7023</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Topo TA Cloning kit (with pCR2.1-TOPO vector)</td>
			<td>Invitrogen</td>
			<td>K4500-01</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction kit</td>
			<td>QIAGEN</td>
			<td>28704</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Sigma-Aldrich</td>
			<td>A9539</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Ethidium bromide&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>E1510</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>100 bp DNA ladder</td>
			<td>Invitrogen</td>
			<td>15628019</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>6X Loading Buffer</td>
			<td>ThermoScientific</td>
			<td>R0611</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>NanoDrop 2000 UV-Vis Spectrophotometer</td>
			<td>ThermoScientific</td>
			<td>ND-2000</td>
			<td></td>
		</tr>
		<tr>
			<td>Nextera XT Index kit</td>
			<td>Illumina</td>
			<td>FC-131-1001 or FC-131-1002</td>
			<td></td>
		</tr>
		<tr>
			<td>2x KAPA HiFi Hot Start Ready Mix&#160;</td>
			<td>KAPA Biosystems</td>
			<td>KK2601</td>
			<td></td>
		</tr>
		<tr>
			<td>Dynal magnetic stand for 2 ml tubes</td>
			<td>Invitrogen</td>
			<td>12321D</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Agencourt AMPure XP 60 ml kit</td>
			<td>Beckman Coulter Genomics</td>
			<td>A63881</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl 10 mM, pH 8.5</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2200 TapeStation system</td>
			<td>Agilent Technologies</td>
			<td>G2964AA</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>D1000 ScreenTape</td>
			<td>Agilent Technologies</td>
			<td>5067-5582</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>D1000 Reagents</td>
			<td>Agilent Technologies</td>
			<td>5067-5583</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>KAPA Library Quantification Kit for Illumina platforms (ABI Prism)</td>
			<td>KAPA Biosystems</td>
			<td>KK4835</td>
			<td></td>
		</tr>
		<tr>
			<td>ABI Prism 7900HT Fast Real-Time PCR System</td>
			<td>Applied Biosystems</td>
			<td>4329003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaOH 1.0 N, molecular biology-grade</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HT1 (Hybridization Buffer)</td>
			<td>Illumina&#160;</td>
			<td>Provided in the MiSeq Reagent Kit</td>
			<td></td>
		</tr>
		<tr>
			<td>MiSeq Reagent Kit v3 (150 cycles)</td>
			<td>Illumina</td>
			<td>MS-102-3001</td>
			<td></td>
		</tr>
		<tr>
			<td>MiSeq System</td>
			<td>Illumina</td>
			<td>SY-410-1003</td>
			<td></td>
		</tr>
		<tr>
			<td>PhiX Control v3</td>
			<td>Illumina</td>
			<td>FC-110-3001</td>
			<td></td>
		</tr>
	</tbody>
</table>

retroviral scanning: mapping mlv integration sites to define cell-specific regulatory regions

Moloney murine Leukämie (MLV) Virus-basierte retrovirale Vektoren integrieren sich überwiegend in acetylierte Enhancer und Promotoren. Aus diesem Grund können mLV-Integrationsorte als funktionale Marker aktiver regulatorischer Elemente verwendet werden. Hier präsentieren wir ein retrovirales Scan-Tool, das die genomweite Identifizierung von zellspezifischen Enhancern und Promotoren ermöglicht. Kurz gesagt wird die Zielzellpopulation mit einem mLV-abgeleiteten Vektor transduziert und genomische DNA wird mit einem häufig schneidenden Restriktionsenzym verdaut. Nach der Ligation von genomischen Fragmenten mit einem kompatiblen DNA-Linker ermöglicht die Linker-vermittelte Polymerase-Kettenreaktion (LM-PCR) die Amplifikation der Virus-Host-Genom-Übergänge. Die massive Sequenzierung der Ampullen wird verwendet, um das mLV-Integrationsprofil genomweit zu definieren. Schließlich werden Cluster von wiederkehrenden Integrationen definiert, um zellspezifische regulatorische Regionen zu identifizieren, die für die Aktivierung von zelltypspezifischen Transkriptionsprogrammen verantwortlich sind. <p class= &quot;Jove_content&quot;&gt; Das retrovirale Scan-Tool ermöglicht die genomweite Identifizierung von zellspezifischen Promotoren und Enhancern in prospektiv isolierten Zielzellpopulationen. Bemerkenswerterweise stellt das retrovirale Scannen eine instrumentelle Technik für die retrospektive Identifizierung von seltenen Populationen ( z. B. somatische Stammzellen) dar, die keine robusten Marker für eine prospektive Isolation aufweisen.

Arbeitsablauf des retroviralen Scanvorgangs Der Arbeitsablauf des retroviralen Abtastvorgangs ist in Abbildung 1 schematisiert. Die Zielzellpopulation wird gereinigt und mit einem mLV-abgeleiteten retroviralen Vektor transduziert, der ein eGFP-Reportergen exprimiert. Das Transgen wird von den beiden identischen langen terminalen Wiederholungen (5 &#39;und 3&#39; LTR) flankiert, was die Synthese, die ...

Watch this Scientific Journal Video about Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions at JoVE.com

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

Hier beschreiben wir ein Protokoll zur genomweiten Kartierung der Integrationsorte von Moloney murinen Leukämie-Virus-basierten retroviralen Vektoren in menschlichen Zellen.

Retroviral Scanning: Mapping MLV Integration Sites zur Definition zellspezifischer Regulierungsregionen

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

Research

JoVE Journal

Genetics

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

QTL Mapping und CRISPR / Cas9 Bearbeitung zur Identifizierung eines Drug Resistance Gen in<em&gt; Toxoplasma gondii</em

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the ...

Forschung

Genetik

Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen

Zuordnung von RNA-RNA-Wechselwirkungen unter Verwendung von biotinyliertem Psoralen

Knowing how RNAs interact with themselves and with others is key to understanding RNA based gene regulation in the cell. While examples of RNA-RNA ...

Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow

Bidirektionale Retrovirale Integrationsstelle PCR Methodik und quantitative Datenanalyse Workflow

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral ...

G2-seq: A High Throughput Sequencing-based Technique for Identifying Late Replicating Regions of the Genome

G2-Seq: Ein hoher Durchsatz Sequenzierung-basierten Methode zur Identifizierung von spät repliziert Regionen des Genoms

Numerous techniques have been developed to follow the progress of DNA replication through the S phase of the cell cycle. Most of these techniques have ...

Formaldehyde-assisted Isolation of Regulatory Elements to Measure Chromatin Accessibility in Mammalian Cells

Formaldehyd-gestützte Isolation regulatorischer Elemente auf die Maßnahme Chromatin Barrierefreiheit in Säugerzellen

Appropriate gene expression in response to extracellular cues, that is, tissue- and lineage-specific gene transcription, critically depends on highly ...

A Fast and Quantitative Method for Post-translational Modification and Variant Enabled Mapping of Peptides to Genomes

Eine schnelle und Quantitative Methode für Post-translationale Modifikation und Variante aktiviert Mapping von Peptiden mit Genomen

Cross-talk between genes, transcripts, and proteins is the key to cellular responses; hence, analysis of molecular levels as distinct entities is slowly ...

A Novel Saturation Mutagenesis Approach: Single Step Characterization of Regulatory Protein Binding Sites in RNA Using Phosphorothioates

Ein neuartiger Sättigung Mutagenese Ansatz: Einzelschritt Charakterisierung der regulatorischen Protein Bindungsstellen im RNA mit Phosphorthioate

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to ...

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

Hochdurchsatz-Identifizierung des Gens regulatorischen Sequenzen mit Next-Generation Sequenzierung der kreisförmigen Chromosom Konformation erfassen (4C-Seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

Einzelne Tropfen digitale Polymerase-Kettenreaktion für umfassende und gleichzeitigen Nachweis von Mutationen im Hotspot-Regionen

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation ...

Exploring Sequence Space to Identify Binding Sites for Regulatory RNA-Binding Proteins

Erkundung des Sequenzraums zur Identifizierung von Bindungsstellen für regulatorische RNA-bindende Proteine

Gene regulation plays an important role in all cells. Transcriptional, post-transcriptional (or RNA processing), translational, and post-translational ...