Name: retroviral scanning: mapping mlv integration sites to define cell-specific regulatory regions
Uploaded: 2017-05-28T14:00:00
Description: Watch this Scientific Journal Video about Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions at JoVE.com

עבודה זו נתמכה על ידי מענקים של המועצה האירופית למחקר (ERC-2010-AdG, GT-SKIN), משרד החינוך האיטלקי, אוניברסיטאות ומחקרים (FIRB-Futuro ב- Ricerca 2010-RBFR10OS4G, FIRB-Futuro ב- Ricerca 2012-RBFR126B8I_003 , EPIGEN Epigenomics Flagship Project), משרד הבריאות האיטלקי (חוקרים צעירים קוראים 2011 GR-2011-02352026) ואת קרן מכון Imagine (פריז, צרפת).

1. MLV התמרה של תאים אנושיים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לבודד תאים היעד transduce אותם עם וקטור mLV הנגזר retroviral מחסה את הגן הכתב eGFP ו pseudotyped עם Vesicular Stomatitis Virus (VSV-G) או המעטפה גליקופרוטין amphotropic 16 . <ol style=";text-align:right;direction:rtl"><li style=";text-align:r...

<ol>
	<li>Ernst, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+and+analysis+of+chromatin+state+dynamics+in+nine+human+cell+types.">Mapping and analysis of chromatin state dynamics in nine human cell types.</a> Nature. 473 (7345), 43-49 (2011).</li><li>Shlyueva, D., Stampfel, G., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+enhancers:+from+properties+to+genome-wide+predictions.">Transcriptional enhancers: from properties to genome-wide predictions.</a> Nat Rev Genet. 15 (4), 272-286 (2014).</li><li>Roadmap Epigenomics Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+111+reference+human+epigenomes.">Integrative analysis of 111 reference human epigenomes.</a> Nature. 518 (7539), 317-330 (2015).</li><li>Heintzman, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+modifications+at+human+enhancers+reflect+global+cell-type-specific+gene+expression.">Histone modifications at human enhancers reflect global cell-type-specific gene expression.</a> Nature. 459 (7243), 108-112 (2009).</li><li>Creyghton, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+H3K27ac+separates+active+from+poised+enhancers+and+predicts+developmental+state.">Histone H3K27ac separates active from poised enhancers and predicts developmental state.</a> Proc Natl Acad Sci U S A. 107 (50), 21931-21936 (2010).</li><li>Hnisz, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Super-enhancers+in+the+control+of+cell+identity+and+disease.">Super-enhancers in the control of cell identity and disease.</a> Cell. 155 (4), 934-947 (2013).</li><li>Cattoglio, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-definition+mapping+of+retroviral+integration+sites+identifies+active+regulatory+elements+in+human+multipotent+hematopoietic+progenitors.">High-definition mapping of retroviral integration sites identifies active regulatory elements in human multipotent hematopoietic progenitors.</a> Blood. 116 (25), 5507-5517 (2010).</li><li>Biasco, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+profile+of+retroviral+vector+in+gene+therapy+treated+patients+is+cell-specific+according+to+gene+expression+and+chromatin+conformation+of+target+cell.">Integration profile of retroviral vector in gene therapy treated patients is cell-specific according to gene expression and chromatin conformation of target cell.</a> EMBO Mol Med. 3 (2), 89-101 (2011).</li><li>De Ravin, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancers+are+major+targets+for+murine+leukemia+virus+vector+integration.">Enhancers are major targets for murine leukemia virus vector integration.</a> J Virol. 88 (8), 4504-4513 (2014).</li><li>LaFave, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mLV+integration+site+selection+is+driven+by+strong+enhancers+and+active+promoters.">mLV integration site selection is driven by strong enhancers and active promoters.</a> Nucleic Acids Res. 42 (7), 4257-4269 (2014).</li><li>Gupta, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bromo-+and+extraterminal+domain+chromatin+regulators+serve+as+cofactors+for+murine+leukemia+virus+integration.">Bromo- and extraterminal domain chromatin regulators serve as cofactors for murine leukemia virus integration.</a> J Virol. 87 (23), 12721-12736 (2013).</li><li>Sharma, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BET+proteins+promote+efficient+murine+leukemia+virus+integration+at+transcription+start+sites.">BET proteins promote efficient murine leukemia virus integration at transcription start sites.</a> Proc Natl Acad Sci U S A. 110 (29), 12036-12041 (2013).</li><li>De Rijck, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BET+family+of+proteins+targets+moloney+murine+leukemia+virus+integration+near+transcription+start+sites.">The BET family of proteins targets moloney murine leukemia virus integration near transcription start sites.</a> Cell reports. 5 (4), 886-894 (2013).</li><li>Romano, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional,+epigenetic+and+retroviral+signatures+identify+regulatory+regions+involved+in+hematopoietic+lineage+commitment.">Transcriptional, epigenetic and retroviral signatures identify regulatory regions involved in hematopoietic lineage commitment.</a> Sci Rep. 6, 24724 (2016).</li><li>Cavazza, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+Transcriptional+and+Epigenetic+Regulation+of+Human+Epidermal+Keratinocyte+Differentiation.">Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation.</a> Stem Cell Reports. 6 (4), 618-632 (2016).</li><li>Miller, A. D., Law, M. F., Verma, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+helper-free+amphotropic+retroviruses+that+transduce+a+dominant-acting,+methotrexate-resistant+dihydrofolate+reductase+gene.">Generation of helper-free amphotropic retroviruses that transduce a dominant-acting, methotrexate-resistant dihydrofolate reductase gene.</a> Mol Cell Biol. 5 (3), 431-437 (1985).</li><li>Cattoglio, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-definition+mapping+of+retroviral+integration+sites+defines+the+fate+of+allogeneic+T+cells+after+donor+lymphocyte+infusion.">High-definition mapping of retroviral integration sites defines the fate of allogeneic T cells after donor lymphocyte infusion.</a> PLoS One. 5 (12), e15688 (2010).</li><li>Aiuti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+hematopoietic+stem+cell+gene+therapy+in+patients+with+Wiskott-Aldrich+syndrome.">Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome.</a> Science. 341 (6148), 1233151 (2013).</li><li>Biffi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+hematopoietic+stem+cell+gene+therapy+benefits+metachromatic+leukodystrophy.">Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy.</a> Science. 341 (6148), 1233158 (2013).</li><li>Gabriel, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+genomic+access+to+vector+integration+in+clinical+gene+therapy.">Comprehensive genomic access to vector integration in clinical gene therapy.</a> Nat Med. 15 (12), 1431-1436 (2009).</li><li>Gillet, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+host+genomic+environment+of+the+provirus+determines+the+abundance+of+HTLV-1-infected+T-cell+clones.">The host genomic environment of the provirus determines the abundance of HTLV-1-infected T-cell clones.</a> Blood. 117 (11), 3113-3122 (2011).</li></ol>

כאן, תיארנו פרוטוקול מיפוי רחב הגנום של אתרי אינטגרציה של mLV, רטרווירוס כי מטרות אזורי הכרומטין, מסומנים epigenetically כמו יזמים פעיל ומשפר. צעדים קריטיים ו / או מגבלות של הפרוטוקול כוללים: (i) התמרה mLV של אוכלוסיית תאים היעד; (Ii) הגברה של צומת המארח וירוס על ידי LM-PCR; (Iii) אחזור של...

זהות התא נקבעת על ידי ביטוי של קבוצות ספציפיות של גנים. תפקידם של אלמנטים רגולטוריים של CIS, כגון יזמים ומשפרים, הוא קריטי להפעלת תוכניות תמליל ספציפיות מסוג תאים. אזורים רגולטוריים אלה מאופיינים בתכונות כרומטיות ספציפיות, כגון שינויים היסטוניים מוזרים, גורמי תעתיק ושיתוף גורמי שיתוף, וגישה לכרומטין, אשר שימשו באופן נרחב להגדרת הגנום שלהם במספר סוגי תאים 1 , 2 , 3 . בפרט, פרופיל הגנום רחב של אצטילציה של היסטון H3 ליזין 27 (H3K27ac) משמש בדרך כלל להגדיר היזמים פעיל, משפרי ומשפר סופר 4 , 5 , 6 . Moloney Murine וירוס לוקמיה (MLV) הוא גמא רטרווירוס כי הוא בשימוש נרחב עבור הגןהעברה בתאי יונקים. לאחר הדבקה של תא מטרה, הגנום רטרובייראלי RNA הוא retro- transcribed במולקולה דנ&quot;א כפול תקועים המחייבת חלבונים ויראליים וסלולריים להרכיב את מורכבות מראש אינטגרציה (PIC). PIC נכנס הגרעין וקושרת את הכרומטין התא המארח. כאן, אינטגרז ויראלי, מרכיב PIC מפתח, מתווך את האינטגרציה של ה- DNA פרובייר לתוך הגנום תא המארח. אינטגרציה של mLV בדנ&quot;א הגנומי אינה אקראית, אלא מתרחשת במרכיבים פעילים של cis-regulation, כגון מקדמי ומשפר, בתא ספציפי 7 , 8 , 9 , 10 . פרופיל אינטגרציה מוזר זה מתווכת על ידי אינטראקציה ישירה בין אינטגרז mLV לבין חלבונים Bromodomain הסלולר ו extrerminal תחום (BET) חלבונים 11 , 12 , 13 . חלבונים BET (BRD2, BRD3, וBRD4) לשמש גשר בין הכרומטין המארח ל mLV PIC: דרך bromodomains שלהם הם מכירים מאוד cety- רגולציה אזורים, ואילו תחום extrerminal אינטראקציה עם אינטגרציה mLV 11 , 12 , 13 . כאן, אנו מתארים את הסריקה רטרו-ויראלי, כלי חדש למפות אזורים פעילים cis- רגולציה מבוסס על תכונות שילוב של mLV. בקצרה, תאים transduced עם וקטור mLV הנגזר retroviral להביע את חלבון פלואורסצנטי ירוק משופרת (eGFP) גן הכתב. לאחר החילוץ הדנ&quot;א הגנומי, הצמתים בין ה - LTR של ה - LTR של ה - LTR של וקטור ה - mLV לבין הדנ&quot;א הגנומי מתוגברים על ידי PCR בתיווך מקושר (LM-PCR) ו רצף מאסיבי. אתרי אינטגרציה של mLV ממופים לגנום האנושי ולאזורים הגנומיים הממוקדים על ידי mLV מוגדרים כאשכולות של אתרי אינטגרציה mLV. סריקת רטרו - ויראליNing שימש כדי להגדיר תא ספציפי אלמנטים רגולטוריים פעילים כמה תאים ראשוניים האנושי 14 , 15 . מקבצים mLV במשותף עם יזמים מוגדרים epigenetically ו משפרי, אשר רובם טמון סימני היסטון פעיל, כגון H3K27ac, היו ספציפיים תא. סריקה רטרו-ויראלית מאפשרת זיהוי גנום רחב של אלמנטים רגולטוריים של דנ&quot;א באוכלוסיות תאים מטופלות פרוספקטיבית , 7 , 14 , כמו גם באוכלוסיות תאים מוגדרות רטרוספקטיבית, כגון תאי גזע קרטינוציטים, חסרים סמנים יעילים לבידוד פוטנציאלי 15 .

<table>
	<tbody>
		<tr>
			<td>PBS, pH 7.4</td>
			<td>ThermoScientific</td>
			<td>10010031</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>ThermoScientific</td>
			<td>16000044</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>0.2 ml tubes</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>1.5 ml tubes</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>QIAGEN QIAmp DNA mini Kit&#160;</td>
			<td>QIAGEN</td>
			<td>51306</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>T4 DNA ligase&#160;</td>
			<td>New England BioLabs</td>
			<td>M0202T</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA Ligase Reaction buffer</td>
			<td>New England BioLabs</td>
			<td>M0202T</td>
			<td></td>
		</tr>
		<tr>
			<td>Linker Plus Strand oligonucleotide</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-PO4-TAGTCCCTTAAGCGGAG-3&#8217;&#160; (Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Linker Minus Strand oligonucleotide</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC-3&#8217; (Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Tru9I</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11464825001</td>
			<td></td>
		</tr>
		<tr>
			<td>SuRE/Cut Buffer M</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11417983001</td>
			<td></td>
		</tr>
		<tr>
			<td>PstI&#160;</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>10798991001</td>
			<td></td>
		</tr>
		<tr>
			<td>SuRE/Cut Buffer H</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11417991001</td>
			<td></td>
		</tr>
		<tr>
			<td>Platinum Taq DNA Polimerase High Fidelity&#160;</td>
			<td>Invitrogen</td>
			<td>11304011</td>
			<td></td>
		</tr>
		<tr>
			<td>10mM dNTP Mix</td>
			<td>Invitrogen</td>
			<td>18427013</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>PCR grade water</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>96-well thermal cycler (with heated lid)</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>linker primer</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GTAATACGACTCACTATAGGGC-3&#8217; (Purification grade: PCR grade)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR primer</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GACTTGTGGTCTCGCTGTTCCTTGG-3&#8217; (Purification grade: PCR grade)</td>
		</tr>
		<tr>
			<td>linker nested primer 454</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GCCTTGCCAGCCCGCTCAG[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR nested primer 454</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GCCTCCCTCGCGCCATCAGTAGC[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>linker nested primer Illumina</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#39;-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR nested primer Illumina</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#39;-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Sodium Acetate Solution (3M) pH 5.2</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol (absolute) for molecular biology</td>
			<td>Sigma-Aldrich</td>
			<td>E7023</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Topo TA Cloning kit (with pCR2.1-TOPO vector)</td>
			<td>Invitrogen</td>
			<td>K4500-01</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction kit</td>
			<td>QIAGEN</td>
			<td>28704</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Sigma-Aldrich</td>
			<td>A9539</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Ethidium bromide&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>E1510</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>100 bp DNA ladder</td>
			<td>Invitrogen</td>
			<td>15628019</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>6X Loading Buffer</td>
			<td>ThermoScientific</td>
			<td>R0611</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>NanoDrop 2000 UV-Vis Spectrophotometer</td>
			<td>ThermoScientific</td>
			<td>ND-2000</td>
			<td></td>
		</tr>
		<tr>
			<td>Nextera XT Index kit</td>
			<td>Illumina</td>
			<td>FC-131-1001 or FC-131-1002</td>
			<td></td>
		</tr>
		<tr>
			<td>2x KAPA HiFi Hot Start Ready Mix&#160;</td>
			<td>KAPA Biosystems</td>
			<td>KK2601</td>
			<td></td>
		</tr>
		<tr>
			<td>Dynal magnetic stand for 2 ml tubes</td>
			<td>Invitrogen</td>
			<td>12321D</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Agencourt AMPure XP 60 ml kit</td>
			<td>Beckman Coulter Genomics</td>
			<td>A63881</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl 10 mM, pH 8.5</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2200 TapeStation system</td>
			<td>Agilent Technologies</td>
			<td>G2964AA</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>D1000 ScreenTape</td>
			<td>Agilent Technologies</td>
			<td>5067-5582</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>D1000 Reagents</td>
			<td>Agilent Technologies</td>
			<td>5067-5583</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>KAPA Library Quantification Kit for Illumina platforms (ABI Prism)</td>
			<td>KAPA Biosystems</td>
			<td>KK4835</td>
			<td></td>
		</tr>
		<tr>
			<td>ABI Prism 7900HT Fast Real-Time PCR System</td>
			<td>Applied Biosystems</td>
			<td>4329003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaOH 1.0 N, molecular biology-grade</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HT1 (Hybridization Buffer)</td>
			<td>Illumina&#160;</td>
			<td>Provided in the MiSeq Reagent Kit</td>
			<td></td>
		</tr>
		<tr>
			<td>MiSeq Reagent Kit v3 (150 cycles)</td>
			<td>Illumina</td>
			<td>MS-102-3001</td>
			<td></td>
		</tr>
		<tr>
			<td>MiSeq System</td>
			<td>Illumina</td>
			<td>SY-410-1003</td>
			<td></td>
		</tr>
		<tr>
			<td>PhiX Control v3</td>
			<td>Illumina</td>
			<td>FC-110-3001</td>
			<td></td>
		</tr>
	</tbody>
</table>

retroviral scanning: mapping mlv integration sites to define cell-specific regulatory regions

<html> Mukoney Murine לוקמיה (MLV) וירוס מבוססי וקטורים retroviral להשתלב בעיקר משפרי acetylated ויזמים. מסיבה זו, אתרי אינטגרציה mLV יכולים לשמש כסמנים פונקציונליים של רכיבים רגולטוריים פעילים. כאן, אנו מציגים כלי סריקה retroviral, אשר מאפשר זיהוי גנום רחב של משפרי תא ספציפי ומקדמים. בקצרה, האוכלוסייה היעד היעד transduced עם וקטור נגזר mLV ו DNA גנומי מתעכל עם אנזים הגבלת חיתוך לעתים קרובות. לאחר קשירת שברי הגנום עם מקשר DNA תואם, linker בתיווך פולימראז התגובה שרשרת (LM-PCR) מאפשר הגברה של צומת הגנום וירוסים המארח. רצף מסיבי של amplicons משמש כדי להגדיר את פרופיל האינטגרציה mLV גנום רחב. לבסוף, אשכולות של אינטגרציות חוזרות מוגדרים לזיהוי אזורים רגולטוריים ספציפיים לתא, האחראים להפעלת תוכניות תמלול ספציפיות מסוג תא. = &quot;Jove_content&quot;&gt; כלי הסריקה retroviral מאפשר זיהוי גנום רחב של היזמים ספציפיים ספציפיות תא ב אוכלוסיות תאים היעד פרוספקטיבי. יש לציין, כי סריקה רטרו-ויראלית מייצגת טכניקה אינסטרומנטלית לזיהוי רטרוספקטיבי של אוכלוסיות נדירות ( כגון תאי גזע סומטיים) שאין להן סמנים חזקים לבידוד פוטנציאלי.

זרימת עבודה של הליך הסריקה רטרו-ויראלי זרימת העבודה של הליך הסריקה retroviral הוא schematized באיור 1 . אוכלוסיית תאים היעד מטוהרים transduced עם וקטור retroiral mLV הנגזר להביע גן הכתב eGFP. הטרנסגן מוק...

Watch this Scientific Journal Video about Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions at JoVE.com

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

כאן, אנו מתארים פרוטוקול המיפוי גנום רחב של אתרי אינטגרציה של מולוני Murine לוקמיה וירוס מבוססי וקטורים רטרוביראל בתאים אנושיים.

Retroviral סריקה: מיפוי MLV אתרי אינטגרציה להגדרת אזורים רגולטוריים ספציפיים לתא

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

Research

JoVE Journal

Genetics

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

מיפוי QTL ו CRISPR / Cas9 עריכה לזהות ג &#39;ין ההתנגדות התרופה ב<em&gt; Toxoplasma gondii</em

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the ...

Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen

מיפוי RNA-RNA אינטראקציות גלובלי באמצעות Psoralen Biotinylated

Knowing how RNAs interact with themselves and with others is key to understanding RNA based gene regulation in the cell. While examples of RNA-RNA ...

Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow

דו כיווני Retroviral אינטגרציה אתר PCR מתודולוגיה וניתוח נתונים כמותיים זרימת עבודה

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral ...

G2-seq: A High Throughput Sequencing-based Technique for Identifying Late Replicating Regions of the Genome

G2-seq: תפוקה גבוהה המבוססת על רצף טכניקה לזיהוי מאוחר לבצע שיכפול אזורים בגנום

Numerous techniques have been developed to follow the progress of DNA replication through the S phase of the cell cycle. Most of these techniques have ...

Formaldehyde-assisted Isolation of Regulatory Elements to Measure Chromatin Accessibility in Mammalian Cells

בסיוע פורמלדהיד בידוד של אלמנטים הרגולציה על אמצעי נגישות כרומטין בתאים בתרבית

Appropriate gene expression in response to extracellular cues, that is, tissue- and lineage-specific gene transcription, critically depends on highly ...

A Fast and Quantitative Method for Post-translational Modification and Variant Enabled Mapping of Peptides to Genomes

שיטה כמותית ומהירה השינוי Post-translational וגרסא מופעלת מיפוי של פפטידים כדי הגנום

Cross-talk between genes, transcripts, and proteins is the key to cellular responses; hence, analysis of molecular levels as distinct entities is slowly ...

A Novel Saturation Mutagenesis Approach: Single Step Characterization of Regulatory Protein Binding Sites in RNA Using Phosphorothioates

בגישה מוטגנזה מכוונת רוויה הרומן: אפיון צעד בודד של חלבון תקינה מחייב אתרים ב- RNA באמצעות Phosphorothioates

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to ...

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

זיהוי תפוקה גבוהה של ג'ין רצפים תקינה באמצעות רצף הדור הבא של כרומוזום מעגלי קונפורמציה ללכוד (4C-seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

Droplet יחיד שרשרת התגובה פולימראז דיגיטלי עבור זיהוי מקיף, בו זמנית של מוטציות באזורים חמה

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation ...

Exploring Sequence Space to Identify Binding Sites for Regulatory RNA-Binding Proteins

סיור במרחב הרצף כדי לזהות אתרי כריכה עבור חלבונים כריכת רנ א תקינה

Gene regulation plays an important role in all cells. Transcriptional, post-transcriptional (or RNA processing), translational, and post-translational ...