Name: retroviral scanning: mapping mlv integration sites to define cell-specific regulatory regions
Uploaded: 2017-05-28T14:00:00
Description: Watch this Scientific Journal Video about Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions at JoVE.com

यह काम यूरोपीय रिसर्च काउंसिल (ईआरसी-2010-एडजी, जीटी-स्किन), इतालवी शिक्षा मंत्रालय, विश्वविद्यालयों और अनुसंधान (एफआईआरबी-फ्युटर्स इन रिकारिका 2010-आरबीएफआर 10 ओएस 4 जी, एफआईआरबी-फ़्युटोरो इन रिकारका 2012-आरबीएफआर 126 बी 8-I_003 , एपीआईजीएन एपिगेनोमिक्स फ्लैगशिप प्रोजेक्ट), इटली के स्वास्थ्य मंत्रालय (युवा शोधकर्ताओं को 2011/2011 -2012 -2012352026 को कॉल करें) और इमेजिइन इंस्टीट्यूट फाउंडेशन (पेरिस, फ़्रांस)।

1. मानव कोशिकाओं के एमएलवी ट्रांसडक्शन <ol><li> लक्ष्य कोशिकाओं को अलग करें और उन्हें एमजीएल-व्युत्पन्न रेट्रोवायरल वेक्टर के साथ ईजीएफपी रिपोर्टर जीन को बहाल करने और वैक्सीकुलर स्टेमाटाइटीस वायरस ज?...

<ol>
	<li>Ernst, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+and+analysis+of+chromatin+state+dynamics+in+nine+human+cell+types.">Mapping and analysis of chromatin state dynamics in nine human cell types.</a> Nature. 473 (7345), 43-49 (2011).</li><li>Shlyueva, D., Stampfel, G., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+enhancers:+from+properties+to+genome-wide+predictions.">Transcriptional enhancers: from properties to genome-wide predictions.</a> Nat Rev Genet. 15 (4), 272-286 (2014).</li><li>Roadmap Epigenomics Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+111+reference+human+epigenomes.">Integrative analysis of 111 reference human epigenomes.</a> Nature. 518 (7539), 317-330 (2015).</li><li>Heintzman, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+modifications+at+human+enhancers+reflect+global+cell-type-specific+gene+expression.">Histone modifications at human enhancers reflect global cell-type-specific gene expression.</a> Nature. 459 (7243), 108-112 (2009).</li><li>Creyghton, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+H3K27ac+separates+active+from+poised+enhancers+and+predicts+developmental+state.">Histone H3K27ac separates active from poised enhancers and predicts developmental state.</a> Proc Natl Acad Sci U S A. 107 (50), 21931-21936 (2010).</li><li>Hnisz, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Super-enhancers+in+the+control+of+cell+identity+and+disease.">Super-enhancers in the control of cell identity and disease.</a> Cell. 155 (4), 934-947 (2013).</li><li>Cattoglio, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-definition+mapping+of+retroviral+integration+sites+identifies+active+regulatory+elements+in+human+multipotent+hematopoietic+progenitors.">High-definition mapping of retroviral integration sites identifies active regulatory elements in human multipotent hematopoietic progenitors.</a> Blood. 116 (25), 5507-5517 (2010).</li><li>Biasco, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+profile+of+retroviral+vector+in+gene+therapy+treated+patients+is+cell-specific+according+to+gene+expression+and+chromatin+conformation+of+target+cell.">Integration profile of retroviral vector in gene therapy treated patients is cell-specific according to gene expression and chromatin conformation of target cell.</a> EMBO Mol Med. 3 (2), 89-101 (2011).</li><li>De Ravin, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancers+are+major+targets+for+murine+leukemia+virus+vector+integration.">Enhancers are major targets for murine leukemia virus vector integration.</a> J Virol. 88 (8), 4504-4513 (2014).</li><li>LaFave, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mLV+integration+site+selection+is+driven+by+strong+enhancers+and+active+promoters.">mLV integration site selection is driven by strong enhancers and active promoters.</a> Nucleic Acids Res. 42 (7), 4257-4269 (2014).</li><li>Gupta, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bromo-+and+extraterminal+domain+chromatin+regulators+serve+as+cofactors+for+murine+leukemia+virus+integration.">Bromo- and extraterminal domain chromatin regulators serve as cofactors for murine leukemia virus integration.</a> J Virol. 87 (23), 12721-12736 (2013).</li><li>Sharma, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BET+proteins+promote+efficient+murine+leukemia+virus+integration+at+transcription+start+sites.">BET proteins promote efficient murine leukemia virus integration at transcription start sites.</a> Proc Natl Acad Sci U S A. 110 (29), 12036-12041 (2013).</li><li>De Rijck, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BET+family+of+proteins+targets+moloney+murine+leukemia+virus+integration+near+transcription+start+sites.">The BET family of proteins targets moloney murine leukemia virus integration near transcription start sites.</a> Cell reports. 5 (4), 886-894 (2013).</li><li>Romano, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional,+epigenetic+and+retroviral+signatures+identify+regulatory+regions+involved+in+hematopoietic+lineage+commitment.">Transcriptional, epigenetic and retroviral signatures identify regulatory regions involved in hematopoietic lineage commitment.</a> Sci Rep. 6, 24724 (2016).</li><li>Cavazza, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+Transcriptional+and+Epigenetic+Regulation+of+Human+Epidermal+Keratinocyte+Differentiation.">Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation.</a> Stem Cell Reports. 6 (4), 618-632 (2016).</li><li>Miller, A. D., Law, M. F., Verma, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+helper-free+amphotropic+retroviruses+that+transduce+a+dominant-acting,+methotrexate-resistant+dihydrofolate+reductase+gene.">Generation of helper-free amphotropic retroviruses that transduce a dominant-acting, methotrexate-resistant dihydrofolate reductase gene.</a> Mol Cell Biol. 5 (3), 431-437 (1985).</li><li>Cattoglio, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-definition+mapping+of+retroviral+integration+sites+defines+the+fate+of+allogeneic+T+cells+after+donor+lymphocyte+infusion.">High-definition mapping of retroviral integration sites defines the fate of allogeneic T cells after donor lymphocyte infusion.</a> PLoS One. 5 (12), e15688 (2010).</li><li>Aiuti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+hematopoietic+stem+cell+gene+therapy+in+patients+with+Wiskott-Aldrich+syndrome.">Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome.</a> Science. 341 (6148), 1233151 (2013).</li><li>Biffi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+hematopoietic+stem+cell+gene+therapy+benefits+metachromatic+leukodystrophy.">Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy.</a> Science. 341 (6148), 1233158 (2013).</li><li>Gabriel, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+genomic+access+to+vector+integration+in+clinical+gene+therapy.">Comprehensive genomic access to vector integration in clinical gene therapy.</a> Nat Med. 15 (12), 1431-1436 (2009).</li><li>Gillet, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+host+genomic+environment+of+the+provirus+determines+the+abundance+of+HTLV-1-infected+T-cell+clones.">The host genomic environment of the provirus determines the abundance of HTLV-1-infected T-cell clones.</a> Blood. 117 (11), 3113-3122 (2011).</li></ol>

यहां, हमने एमएलवी के एकीकरण साइटों के जीनोम-विस्तृत मैपिंग के लिए एक प्रोटोकॉल का वर्णन किया है, जो एक रेट्रोवायरस है जो क्रोमेटिन क्षेत्रों को लक्षित करता है, एपिगनेटिक रूप से सक्रिय प्रमोटरों और बढ़?...

सेल की पहचान के विशिष्ट सेटों की अभिव्यक्ति द्वारा निर्धारित किया जाता है। प्रमोटर्स और बढ़ाने वाले सीआईएस-नियामक तत्वों की भूमिका सेल-प्रकार के विशिष्ट ट्रांसक्रिप्शनल कार्यक्रमों के सक्रियण के लिए महत्वपूर्ण है। ये नियामक क्षेत्रों विशिष्ट क्रोमैटाइन विशेषताओं, जैसे अजीब हिस्टोन संशोधनों, प्रतिलेखन कारकों और सह-कारक बाध्यकारी और क्रोमेटिन पहुंच के रूप में विशेषता है, जो कि कई सेल प्रकार 1 , 2 , 3 में उनके जीनोम-व्यापी पहचान के लिए व्यापक रूप से उपयोग किया गया है। विशेष रूप से, हिस्टोन एच 3 लीसेन 27 (एच 3 के 27 एसी) के एसिटिलेशन के जीनोम-व्यापी प्रोफाइल का उपयोग आमतौर पर सक्रिय प्रमोटरों, बढ़ाने वाले और सुपर बढ़ाने वाले 4 , 5 , 6 को परिभाषित करने के लिए किया जाता है। मोलनी मूरेन ल्युकेमिया वायरस (एमएलवी) एक गामा-रेट्रोवायरस है जो व्यापक रूप से जीन के लिए उपयोग किया जाता हैस्तनधारी कोशिकाओं में स्थानांतरण लक्ष्य कोशिका को संक्रमित करने के बाद, रेट्रोवाइरल आरएनए जीनोम दोहरे असहाय डीएनए अणु में रेट्रो-ट्रांसक्रिप्टेड होता है जो वायरल और सेलुलर प्रोटीन को प्री-इंटिग्रेशन कॉम्प्लेक्स (पीआईसी) इकट्ठा करने के लिए बांधता है। पीआईसी नाभिक में प्रवेश करती है और मेजबान सेल क्रोमैटिन को बांधता है। यहां, वायरल इंग्रीज़ेज़, एक प्रमुख पीआईसी घटक, मेजबान सेल जीनोम में प्रांतीय डीएनए के एकीकरण की मध्यस्थता करता है। जीनोमिक डीएनए में एमएलवी एकीकरण यादृच्छिक नहीं है, लेकिन सेल-विशिष्ट फैशन 7 , 8 , 9 , 10 में , सक्रिय सीआईएस-नियामक तत्वों जैसे प्रमोटरों और बढ़ाने के रूप में होता है। यह अजीब एकीकरण प्रोफ़ाइल एमएलवी इंटेग्रज और सेलुलर ब्रोमोडामेन और एक्स्ट्राटार्मिनल डोमेन (बीईटी) प्रोटीन 11 , 12 , 13 के बीच प्रत्यक्ष बातचीत से मध्यस्थता है। बीईटी प्रोटीन (बीआरडी 2, बीआरडी 3, औरबीआरडी 4) मेजबान क्रोमेटिन और एमएलवी पीआईसी के बीच एक पुल के रूप में कार्य करें: अपने ब्रोमोडामों के माध्यम से वे अति एसिटिलेटेड सीआईएस-नियामक क्षेत्रों को पहचानते हैं, जबकि एक्स्ट्राटर्मिननल डोमेन एमएलवी इंटेग्रज 11 , 12 , 13 के साथ संपर्क करता है । यहां, हम रेट्रोवायरल स्कैनिंग, एमएलवी के एकीकरण गुणों के आधार पर सक्रिय सीआईएस-नियामक क्षेत्रों को मैप करने के लिए एक उपन्यास उपकरण का वर्णन करते हैं। संक्षेप में, कोशिकाओं को बढ़ाया हरे फ्लोरोसेंट प्रोटीन (ईजीएफपी) रिपोर्टर जीन को व्यक्त करने वाले एमएलवी-व्युत्पन्न रेट्रोवायरल वेक्टर से ट्रांसड्यूस किया जाता है। जीनोमिक डीएनए निष्कर्षण के बाद, एमएलवी वेक्टर और जीनोमिक डीएनए के 3 &#39;टर्मिनल दोहराव (एलटीआर) के बीच जंक्शनों को लिंकर-मध्यस्थता पीसीआर (एलएम-पीसीआर) और व्यापक रूप से अनुक्रमित किया जाता है। एमएलवी एकीकरण साइटों को मानव जीनोम और जीनोमिक क्षेत्रों के लिए मैप किए जाते हैं जो एमएलवी द्वारा लक्षित हैं जो एमएलवी एकीकरण साइटों के समूह के रूप में परिभाषित होते हैं। रेट्रोवायरल स्कैनएनिंग का इस्तेमाल कई मानव प्राथमिक कोशिकाओं 14 , 15 में सेल-विशिष्ट सक्रिय नियामक तत्वों को परिभाषित करने के लिए किया गया था। एपीआईजीनेटिक रूप से परिभाषित प्रमोटरों और बढ़ाने वाले एमएलवी क्लस्टरों को सह-मैप किया गया था, जिनमें से अधिकांश सक्रिय हिस्टोन अंक जैसे एच 3 के 27 एके, और सेल-विशिष्ट थे। रेट्रोवायरल स्कैनिंग, डीएनए नियामक तत्वों की जीनोम-व्यापी पहचान की संभावनाओं को शुद्ध रूप से शुद्ध कोशिका आबादी 7 , 14 में , साथ ही साथ कैरेटिनोसाइट स्टेम कोशिकाओं जैसे पूर्व आबादी परिभाषित सेल आबादी में, जिससे संभावित भावी अलगाव 15 के लिए प्रभावी मार्करों की कमी है।

<table>
	<tbody>
		<tr>
			<td>PBS, pH 7.4</td>
			<td>ThermoScientific</td>
			<td>10010031</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>ThermoScientific</td>
			<td>16000044</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>0.2 ml tubes</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>1.5 ml tubes</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>QIAGEN QIAmp DNA mini Kit&#160;</td>
			<td>QIAGEN</td>
			<td>51306</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>T4 DNA ligase&#160;</td>
			<td>New England BioLabs</td>
			<td>M0202T</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA Ligase Reaction buffer</td>
			<td>New England BioLabs</td>
			<td>M0202T</td>
			<td></td>
		</tr>
		<tr>
			<td>Linker Plus Strand oligonucleotide</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-PO4-TAGTCCCTTAAGCGGAG-3&#8217;&#160; (Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Linker Minus Strand oligonucleotide</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC-3&#8217; (Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Tru9I</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11464825001</td>
			<td></td>
		</tr>
		<tr>
			<td>SuRE/Cut Buffer M</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11417983001</td>
			<td></td>
		</tr>
		<tr>
			<td>PstI&#160;</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>10798991001</td>
			<td></td>
		</tr>
		<tr>
			<td>SuRE/Cut Buffer H</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11417991001</td>
			<td></td>
		</tr>
		<tr>
			<td>Platinum Taq DNA Polimerase High Fidelity&#160;</td>
			<td>Invitrogen</td>
			<td>11304011</td>
			<td></td>
		</tr>
		<tr>
			<td>10mM dNTP Mix</td>
			<td>Invitrogen</td>
			<td>18427013</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>PCR grade water</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>96-well thermal cycler (with heated lid)</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>linker primer</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GTAATACGACTCACTATAGGGC-3&#8217; (Purification grade: PCR grade)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR primer</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GACTTGTGGTCTCGCTGTTCCTTGG-3&#8217; (Purification grade: PCR grade)</td>
		</tr>
		<tr>
			<td>linker nested primer 454</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GCCTTGCCAGCCCGCTCAG[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR nested primer 454</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GCCTCCCTCGCGCCATCAGTAGC[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>linker nested primer Illumina</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#39;-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR nested primer Illumina</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#39;-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Sodium Acetate Solution (3M) pH 5.2</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol (absolute) for molecular biology</td>
			<td>Sigma-Aldrich</td>
			<td>E7023</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Topo TA Cloning kit (with pCR2.1-TOPO vector)</td>
			<td>Invitrogen</td>
			<td>K4500-01</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction kit</td>
			<td>QIAGEN</td>
			<td>28704</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Sigma-Aldrich</td>
			<td>A9539</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Ethidium bromide&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>E1510</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>100 bp DNA ladder</td>
			<td>Invitrogen</td>
			<td>15628019</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>6X Loading Buffer</td>
			<td>ThermoScientific</td>
			<td>R0611</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>NanoDrop 2000 UV-Vis Spectrophotometer</td>
			<td>ThermoScientific</td>
			<td>ND-2000</td>
			<td></td>
		</tr>
		<tr>
			<td>Nextera XT Index kit</td>
			<td>Illumina</td>
			<td>FC-131-1001 or FC-131-1002</td>
			<td></td>
		</tr>
		<tr>
			<td>2x KAPA HiFi Hot Start Ready Mix&#160;</td>
			<td>KAPA Biosystems</td>
			<td>KK2601</td>
			<td></td>
		</tr>
		<tr>
			<td>Dynal magnetic stand for 2 ml tubes</td>
			<td>Invitrogen</td>
			<td>12321D</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Agencourt AMPure XP 60 ml kit</td>
			<td>Beckman Coulter Genomics</td>
			<td>A63881</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl 10 mM, pH 8.5</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2200 TapeStation system</td>
			<td>Agilent Technologies</td>
			<td>G2964AA</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>D1000 ScreenTape</td>
			<td>Agilent Technologies</td>
			<td>5067-5582</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>D1000 Reagents</td>
			<td>Agilent Technologies</td>
			<td>5067-5583</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>KAPA Library Quantification Kit for Illumina platforms (ABI Prism)</td>
			<td>KAPA Biosystems</td>
			<td>KK4835</td>
			<td></td>
		</tr>
		<tr>
			<td>ABI Prism 7900HT Fast Real-Time PCR System</td>
			<td>Applied Biosystems</td>
			<td>4329003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaOH 1.0 N, molecular biology-grade</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HT1 (Hybridization Buffer)</td>
			<td>Illumina&#160;</td>
			<td>Provided in the MiSeq Reagent Kit</td>
			<td></td>
		</tr>
		<tr>
			<td>MiSeq Reagent Kit v3 (150 cycles)</td>
			<td>Illumina</td>
			<td>MS-102-3001</td>
			<td></td>
		</tr>
		<tr>
			<td>MiSeq System</td>
			<td>Illumina</td>
			<td>SY-410-1003</td>
			<td></td>
		</tr>
		<tr>
			<td>PhiX Control v3</td>
			<td>Illumina</td>
			<td>FC-110-3001</td>
			<td></td>
		</tr>
	</tbody>
</table>

retroviral scanning: mapping mlv integration sites to define cell-specific regulatory regions

मोलिनी मूरीन ल्यूकेमिया (एमएलवी) वायरस-आधारित रेट्रोवायरल वैक्टर एसिटिलेटेड बढ़ाने और प्रमोटरों में मुख्य रूप से एकीकृत होते हैं। इस कारण से, एमएलवी एकीकरण साइटों को सक्रिय नियामक तत्वों के कार्यात्मक मार्कर के रूप में इस्तेमाल किया जा सकता है। यहां, हम एक रेट्रोवायरल स्कैनिंग टूल पेश करते हैं, जो सेल-विशिष्ट बढ़ाने और प्रमोटरों की जीनोम-व्यापी पहचान की अनुमति देता है। संक्षेप में, लक्ष्य सेल आबादी एक एमएलवी-व्युत्पन्न वैक्टर के साथ transduced है और जीनोमिक डीएनए अक्सर काटने प्रतिबंध एंजाइम के साथ पच जाता है एक संगत डीएनए लिंकर के साथ जीनोमिक टुकड़े के बंधन के बाद, लिंकर-मध्यस्थता पोलीमरेज़ चेन रिएक्शन (एलएम-पीसीआर) वायरस-होस्ट जीनोम जंक्शनों के प्रवर्धन की अनुमति देता है। Amplicons के बड़े पैमाने पर अनुक्रमण एमएलवी एकीकरण प्रोफ़ाइल जीनोम चौड़ा परिभाषित करने के लिए प्रयोग किया जाता है। अंत में, आवर्ती एकीकरण के समूहों को सेल-विशिष्ट नियामक क्षेत्रों की पहचान करने के लिए परिभाषित किया जाता है, जो कोशिका-प्रकार विशिष्ट ट्रांसेरल कार्यक्रमों के सक्रियण के लिए जिम्मेदार होते हैं। <p class= &quot;Jove_content&quot;&gt; रेट्रोवायरल स्कैनिंग उपकरण सेल-विशिष्ट प्रमोटरों की जीनोम-व्यापी पहचान और संभावित रूप से पृथक लक्ष्य सेल आबादी में वृद्धि करने की अनुमति देता है। विशेष रूप से, रेट्रोवायरल स्कैनिंग दुर्लभ जनसंख्या ( जैसे, स्नायविक स्टेम सेल) की पूर्वव्यापी पहचान के लिए एक महत्वपूर्ण तकनीक का प्रतिनिधित्व करती है जो संभावित भावी अलगाव के लिए मजबूत मार्करों की कमी करता है।

रेट्रोवायरल स्कैनिंग प्रक्रिया का कार्यप्रवाह रेट्रोवायरल स्कैनिंग प्रक्रिया का कार्यप्रवाह चित्रा 1 में स्कीमाइज्ड किया गया है। लक्ष्य सेल आबादी शु?...

Watch this Scientific Journal Video about Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions at JoVE.com

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

यहां, हम मानव कोशिकाओं में मोलनी मूरेन ल्युकेमिया वायरस-आधारित रेट्रोवायरल वैक्टर के एकीकरण साइटों के जीनोम-विस्तृत मैपिंग के लिए प्रोटोकॉल का वर्णन करते हैं।

रेट्रोवायरल स्कैनिंग: सेल-विशिष्ट विनियामक क्षेत्रों को परिभाषित करने के लिए मानचित्रण एमएलवी एकीकरण साइटें

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

Research

JoVE Journal

Genetics

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

QTL मैपिंग और सीआरआईएसपीआर / सीएस 9 में एक ड्रग प्रतिरोध जीन को पहचानने के लिए संपादन<em&gt; टोक्सोप्लाज्मा गोंडी</em

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the ...

Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen

वैश्विक बायोटिनिलेटेड Psoralen का उपयोग आरएनए-आरएनए अंतरण मैपिंग

Knowing how RNAs interact with themselves and with others is key to understanding RNA based gene regulation in the cell. While examples of RNA-RNA ...

Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow

द्विदिश रेट्रोवायरल इंटीग्रेशन साइट पीसीआर क्रियाविधि और मात्रात्मक डेटा विश्लेषण वर्कफ़्लो

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral ...

G2-seq: A High Throughput Sequencing-based Technique for Identifying Late Replicating Regions of the Genome

G2-seq: जीनोम के देर से नकल क्षेत्रों की पहचान करने के लिए एक उच्च प्रवाह अनुक्रमण आधारित तकनीक

Numerous techniques have been developed to follow the progress of DNA replication through the S phase of the cell cycle. Most of these techniques have ...

Formaldehyde-assisted Isolation of Regulatory Elements to Measure Chromatin Accessibility in Mammalian Cells

स्तनधारी कोशिकाओं में क्रोमेटिन पहुंच मापने के लिए विनियामक तत्वों की Formaldehyde-असिस्टेड आइसोलेशन

Appropriate gene expression in response to extracellular cues, that is, tissue- and lineage-specific gene transcription, critically depends on highly ...

A Fast and Quantitative Method for Post-translational Modification and Variant Enabled Mapping of Peptides to Genomes

एक तेजी से और मात्रात्मक विधि के बाद अनुवाद संशोधन और संस्करण के लिए पेप्टाइड्स की मैपिंग जीनोम के लिए सक्षम

Cross-talk between genes, transcripts, and proteins is the key to cellular responses; hence, analysis of molecular levels as distinct entities is slowly ...

A Novel Saturation Mutagenesis Approach: Single Step Characterization of Regulatory Protein Binding Sites in RNA Using Phosphorothioates

एक उपंयास संतृप्ति Mutagenesis दृष्टिकोण: आरएनए में नियामक प्रोटीन बाध्यकारी साइटों के एकल चरण लक्षण वर्णन Phosphorothioates का उपयोग

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to ...

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

परिपत्र गुणसूत्र अनुरूप कब्जा की अगली पीढ़ी के अनुक्रमण का उपयोग जीन विनियामक अनुक्रम का उच्च प्रवाह पहचान (4c-seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

हॉटस्पॉट क्षेत्रों में उत्परिवर्तनों का व्यापक और एक साथ पता लगाने के लिए एकल छोटी बूंद डिजिटल पोलीमरेज़ चेन रिएक्शन

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation ...

Exploring Sequence Space to Identify Binding Sites for Regulatory RNA-Binding Proteins

विनियामक आरएनए-बाइंडिंग प्रोटीन ्स्स्स के लिए बाइंडिंग साइट्स की पहचान करने के लिए अनुक्रम स्थान की खोज

Gene regulation plays an important role in all cells. Transcriptional, post-transcriptional (or RNA processing), translational, and post-translational ...