Name: retroviral scanning: mapping mlv integration sites to define cell-specific regulatory regions
Uploaded: 2017-05-28T14:00:00
Description: Watch this Scientific Journal Video about Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions at JoVE.com

이 연구는 이탈리아 교육, 대학 및 연구부 (FIRB-Futuro in Ricerca 2010-RBFR10OS4G, FIRB-Futuro in Ricerca 2012-RBFR126B8I_003)의 유럽 연구위원회 (ERC-2010-AdG, GT-SKIN) , EPIGEN Epigenomics 대표 프로젝트), 이탈리아 보건부 (젊은 연구자는 2011 GR-2011-02352026) 및 Imagine Institute Foundation (프랑스, 파리).

1. 인간 세포의 MLV 형질 도입 <ol><li> 대상 세포를 분리하고 eGFP 리포터 유전자를 포함하고 Vesicular Stomatitis Virus G (VSV - G) 또는 amphotropic 봉투 glycoprotein 16 pseudotyped mLV 유래 레트로 바이러스 벡터로 그들을 transduce. <ol><li> 모의 변형 된 세포를 다음 분석을위한 음성 대조군으로 유지하십시오. mLV 기반의 레트로 바이러스 벡터는 효율적으로 분열하는 세포를 형질 도입 할...

<ol>
	<li>Ernst, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+and+analysis+of+chromatin+state+dynamics+in+nine+human+cell+types.">Mapping and analysis of chromatin state dynamics in nine human cell types.</a> Nature. 473 (7345), 43-49 (2011).</li><li>Shlyueva, D., Stampfel, G., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+enhancers:+from+properties+to+genome-wide+predictions.">Transcriptional enhancers: from properties to genome-wide predictions.</a> Nat Rev Genet. 15 (4), 272-286 (2014).</li><li>Roadmap Epigenomics Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+111+reference+human+epigenomes.">Integrative analysis of 111 reference human epigenomes.</a> Nature. 518 (7539), 317-330 (2015).</li><li>Heintzman, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+modifications+at+human+enhancers+reflect+global+cell-type-specific+gene+expression.">Histone modifications at human enhancers reflect global cell-type-specific gene expression.</a> Nature. 459 (7243), 108-112 (2009).</li><li>Creyghton, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+H3K27ac+separates+active+from+poised+enhancers+and+predicts+developmental+state.">Histone H3K27ac separates active from poised enhancers and predicts developmental state.</a> Proc Natl Acad Sci U S A. 107 (50), 21931-21936 (2010).</li><li>Hnisz, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Super-enhancers+in+the+control+of+cell+identity+and+disease.">Super-enhancers in the control of cell identity and disease.</a> Cell. 155 (4), 934-947 (2013).</li><li>Cattoglio, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-definition+mapping+of+retroviral+integration+sites+identifies+active+regulatory+elements+in+human+multipotent+hematopoietic+progenitors.">High-definition mapping of retroviral integration sites identifies active regulatory elements in human multipotent hematopoietic progenitors.</a> Blood. 116 (25), 5507-5517 (2010).</li><li>Biasco, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+profile+of+retroviral+vector+in+gene+therapy+treated+patients+is+cell-specific+according+to+gene+expression+and+chromatin+conformation+of+target+cell.">Integration profile of retroviral vector in gene therapy treated patients is cell-specific according to gene expression and chromatin conformation of target cell.</a> EMBO Mol Med. 3 (2), 89-101 (2011).</li><li>De Ravin, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancers+are+major+targets+for+murine+leukemia+virus+vector+integration.">Enhancers are major targets for murine leukemia virus vector integration.</a> J Virol. 88 (8), 4504-4513 (2014).</li><li>LaFave, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mLV+integration+site+selection+is+driven+by+strong+enhancers+and+active+promoters.">mLV integration site selection is driven by strong enhancers and active promoters.</a> Nucleic Acids Res. 42 (7), 4257-4269 (2014).</li><li>Gupta, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bromo-+and+extraterminal+domain+chromatin+regulators+serve+as+cofactors+for+murine+leukemia+virus+integration.">Bromo- and extraterminal domain chromatin regulators serve as cofactors for murine leukemia virus integration.</a> J Virol. 87 (23), 12721-12736 (2013).</li><li>Sharma, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BET+proteins+promote+efficient+murine+leukemia+virus+integration+at+transcription+start+sites.">BET proteins promote efficient murine leukemia virus integration at transcription start sites.</a> Proc Natl Acad Sci U S A. 110 (29), 12036-12041 (2013).</li><li>De Rijck, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BET+family+of+proteins+targets+moloney+murine+leukemia+virus+integration+near+transcription+start+sites.">The BET family of proteins targets moloney murine leukemia virus integration near transcription start sites.</a> Cell reports. 5 (4), 886-894 (2013).</li><li>Romano, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional,+epigenetic+and+retroviral+signatures+identify+regulatory+regions+involved+in+hematopoietic+lineage+commitment.">Transcriptional, epigenetic and retroviral signatures identify regulatory regions involved in hematopoietic lineage commitment.</a> Sci Rep. 6, 24724 (2016).</li><li>Cavazza, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+Transcriptional+and+Epigenetic+Regulation+of+Human+Epidermal+Keratinocyte+Differentiation.">Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation.</a> Stem Cell Reports. 6 (4), 618-632 (2016).</li><li>Miller, A. D., Law, M. F., Verma, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+helper-free+amphotropic+retroviruses+that+transduce+a+dominant-acting,+methotrexate-resistant+dihydrofolate+reductase+gene.">Generation of helper-free amphotropic retroviruses that transduce a dominant-acting, methotrexate-resistant dihydrofolate reductase gene.</a> Mol Cell Biol. 5 (3), 431-437 (1985).</li><li>Cattoglio, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-definition+mapping+of+retroviral+integration+sites+defines+the+fate+of+allogeneic+T+cells+after+donor+lymphocyte+infusion.">High-definition mapping of retroviral integration sites defines the fate of allogeneic T cells after donor lymphocyte infusion.</a> PLoS One. 5 (12), e15688 (2010).</li><li>Aiuti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+hematopoietic+stem+cell+gene+therapy+in+patients+with+Wiskott-Aldrich+syndrome.">Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome.</a> Science. 341 (6148), 1233151 (2013).</li><li>Biffi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+hematopoietic+stem+cell+gene+therapy+benefits+metachromatic+leukodystrophy.">Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy.</a> Science. 341 (6148), 1233158 (2013).</li><li>Gabriel, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+genomic+access+to+vector+integration+in+clinical+gene+therapy.">Comprehensive genomic access to vector integration in clinical gene therapy.</a> Nat Med. 15 (12), 1431-1436 (2009).</li><li>Gillet, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+host+genomic+environment+of+the+provirus+determines+the+abundance+of+HTLV-1-infected+T-cell+clones.">The host genomic environment of the provirus determines the abundance of HTLV-1-infected T-cell clones.</a> Blood. 117 (11), 3113-3122 (2011).</li></ol>

여기에서 우리는 염색질 부위를 표적으로하는 레트로 바이러스 인 mLV의 통합 사이트의 게놈 - 전체 매핑을위한 프로토콜을 설명했으며, 활성 프로모터 및 인핸서로 후생적으로 표시했습니다. 프로토콜의 중요한 단계 및 / 또는 한계는 다음을 포함합니다 : (i) 표적 세포 집단의 mLV 형질 도입; (ii) LM-PCR에 의한 바이러스 - 숙주 접합부의 증폭; (iii) 통합 사이트의 높은 비율의 검색. mLV- 기반 레트로 ?...

세포 동일성은 특정 유전자 세트의 발현에 의해 결정됩니다. 프로모터 및 인핸서와 같은 시스 조절 요소의 역할은 세포 유형 특이 적 전사 프로그램의 활성화에 결정적이다. 이러한 조절 부위는 특이적인 히스톤 변형, 전사 인자 및 보조 인자 결합, 염색질 접근성과 같은 특이적인 염색질 특징을 특징으로하는데, 이는 여러 세포 유형 1 , 2 , 3 에서 게놈 전체의 식별을 위해 널리 사용되어왔다. 특히 히스톤 H3 라이신 27 (H3K27ac)의 게놈 전체 프로파일은 활성 프로모터, 인핸서 및 슈퍼 인핸서 4 , 5 , 6 을 정의하는 데 일반적으로 사용됩니다. Moloney murine leukemia virus (MLV)는 유전자에 널리 사용되는 감마 - 레트로 바이러스입니다포유 동물 세포에서 전달. 표적 세포를 감염시킨 후 retroviral RNA genome은 pre-integration complex (PIC)를 조립하기 위해 바이러스 및 세포 단백질에 결합하는 이중 가닥의 DNA 분자에서 역전사된다. PIC는 핵을 입력하고 숙주 세포 염색질을 바인딩합니다. 여기에서 중요한 PIC 성분 인 바이러스 인테그라 아제 (viral integrase)는 프로 바이러스 DNA의 숙주 세포 게놈으로의 통합을 매개한다. 게놈 DNA에서의 mLV 통합은 무작위 적이 지 않지만 세포 특이적인 방식으로 활성 cis 조절 요소, 예를 들어 프로모터 및 인핸서에서 일어난다 7 , 8 , 9 , 10 . 이 특이 적 통합 프로파일은 mLV integrase와 세포 bromodomain 및 외쪽 끝 도메인 (BET) 단백질 11 , 12 , 13 사이의 직접적인 상호 작용에 의해 매개됩니다. BET 단백질 (BRD2, BRD3 및BRD4)는 숙주 염색질과 mLV PIC 사이의 가교 역할을한다. 브롬 도메인을 통해 고도로 아세틸 화 된 시스 조절 영역을 인식하고 외측 말단 도메인은 mLV 인테그라 아제 11 , 12 , 13 과 상호 작용한다. 여기에서, 우리는 mLV의 통합 특성에 기초하여 활성 cis- 조절 영역을 매핑하는 새로운 도구 인 레트로 바이러스 스캐닝을 기술한다. 간략하게, 세포는 강화 된 녹색 형광 단백질 (eGFP) 리포터 유전자를 발현하는 mLV 유래 레트로 바이러스 벡터로 형질 도입된다. 게놈 DNA 추출 후, mLV 벡터의 3 &#39;긴 말단 반복 (LTR)과 게놈 DNA 간의 연결 부위는 링커 매개 PCR (LM-PCR)에 의해 증폭되고 대량으로 서열 분석된다. mLV 통합 사이트는 인간 게놈에 매핑되며 mLV에 의해 표적화되는 게놈 영역은 mLV 통합 사이트의 클러스터로 정의됩니다. 레트로 바이러스 검사ning은 여러 인간의 일차 세포에서 세포 특이 적 활성 조절 요소를 정의하는 데 사용되었습니다 14 , 15 . mLV 클러스터는 후생 적으로 정의 된 프로모터 및 인핸서와 함께 매핑되었으며, 대부분은 H3K27ac과 같은 활성 히스톤 마커를 가지며 세포 특이 적이었다. 레트로 바이러스 스캐닝은 전향 적으로 정제 된 세포 집단 7,14뿐 아니라 예비 격리 15 에 효과적인 마커가없는 케라틴 틴틴 줄기 세포와 같은 후 향적으로 정의 된 세포 집단에서 DNA 조절 요소의 게놈 전체 식별을 허용합니다.

<table>
	<tbody>
		<tr>
			<td>PBS, pH 7.4</td>
			<td>ThermoScientific</td>
			<td>10010031</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>ThermoScientific</td>
			<td>16000044</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>0.2 ml tubes</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>1.5 ml tubes</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>QIAGEN QIAmp DNA mini Kit&#160;</td>
			<td>QIAGEN</td>
			<td>51306</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>T4 DNA ligase&#160;</td>
			<td>New England BioLabs</td>
			<td>M0202T</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA Ligase Reaction buffer</td>
			<td>New England BioLabs</td>
			<td>M0202T</td>
			<td></td>
		</tr>
		<tr>
			<td>Linker Plus Strand oligonucleotide</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-PO4-TAGTCCCTTAAGCGGAG-3&#8217;&#160; (Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Linker Minus Strand oligonucleotide</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC-3&#8217; (Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Tru9I</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11464825001</td>
			<td></td>
		</tr>
		<tr>
			<td>SuRE/Cut Buffer M</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11417983001</td>
			<td></td>
		</tr>
		<tr>
			<td>PstI&#160;</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>10798991001</td>
			<td></td>
		</tr>
		<tr>
			<td>SuRE/Cut Buffer H</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11417991001</td>
			<td></td>
		</tr>
		<tr>
			<td>Platinum Taq DNA Polimerase High Fidelity&#160;</td>
			<td>Invitrogen</td>
			<td>11304011</td>
			<td></td>
		</tr>
		<tr>
			<td>10mM dNTP Mix</td>
			<td>Invitrogen</td>
			<td>18427013</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>PCR grade water</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>96-well thermal cycler (with heated lid)</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>linker primer</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GTAATACGACTCACTATAGGGC-3&#8217; (Purification grade: PCR grade)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR primer</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GACTTGTGGTCTCGCTGTTCCTTGG-3&#8217; (Purification grade: PCR grade)</td>
		</tr>
		<tr>
			<td>linker nested primer 454</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GCCTTGCCAGCCCGCTCAG[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR nested primer 454</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GCCTCCCTCGCGCCATCAGTAGC[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>linker nested primer Illumina</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#39;-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR nested primer Illumina</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#39;-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Sodium Acetate Solution (3M) pH 5.2</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol (absolute) for molecular biology</td>
			<td>Sigma-Aldrich</td>
			<td>E7023</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Topo TA Cloning kit (with pCR2.1-TOPO vector)</td>
			<td>Invitrogen</td>
			<td>K4500-01</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction kit</td>
			<td>QIAGEN</td>
			<td>28704</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Sigma-Aldrich</td>
			<td>A9539</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Ethidium bromide&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>E1510</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>100 bp DNA ladder</td>
			<td>Invitrogen</td>
			<td>15628019</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>6X Loading Buffer</td>
			<td>ThermoScientific</td>
			<td>R0611</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>NanoDrop 2000 UV-Vis Spectrophotometer</td>
			<td>ThermoScientific</td>
			<td>ND-2000</td>
			<td></td>
		</tr>
		<tr>
			<td>Nextera XT Index kit</td>
			<td>Illumina</td>
			<td>FC-131-1001 or FC-131-1002</td>
			<td></td>
		</tr>
		<tr>
			<td>2x KAPA HiFi Hot Start Ready Mix&#160;</td>
			<td>KAPA Biosystems</td>
			<td>KK2601</td>
			<td></td>
		</tr>
		<tr>
			<td>Dynal magnetic stand for 2 ml tubes</td>
			<td>Invitrogen</td>
			<td>12321D</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Agencourt AMPure XP 60 ml kit</td>
			<td>Beckman Coulter Genomics</td>
			<td>A63881</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl 10 mM, pH 8.5</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2200 TapeStation system</td>
			<td>Agilent Technologies</td>
			<td>G2964AA</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>D1000 ScreenTape</td>
			<td>Agilent Technologies</td>
			<td>5067-5582</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>D1000 Reagents</td>
			<td>Agilent Technologies</td>
			<td>5067-5583</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>KAPA Library Quantification Kit for Illumina platforms (ABI Prism)</td>
			<td>KAPA Biosystems</td>
			<td>KK4835</td>
			<td></td>
		</tr>
		<tr>
			<td>ABI Prism 7900HT Fast Real-Time PCR System</td>
			<td>Applied Biosystems</td>
			<td>4329003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaOH 1.0 N, molecular biology-grade</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HT1 (Hybridization Buffer)</td>
			<td>Illumina&#160;</td>
			<td>Provided in the MiSeq Reagent Kit</td>
			<td></td>
		</tr>
		<tr>
			<td>MiSeq Reagent Kit v3 (150 cycles)</td>
			<td>Illumina</td>
			<td>MS-102-3001</td>
			<td></td>
		</tr>
		<tr>
			<td>MiSeq System</td>
			<td>Illumina</td>
			<td>SY-410-1003</td>
			<td></td>
		</tr>
		<tr>
			<td>PhiX Control v3</td>
			<td>Illumina</td>
			<td>FC-110-3001</td>
			<td></td>
		</tr>
	</tbody>
</table>

retroviral scanning: mapping mlv integration sites to define cell-specific regulatory regions

Moloney murine leukemia (MLV) 바이러스 기반 레트로 바이러스 벡터는 주로 아세틸 화 된 인핸서와 프로모터에 통합됩니다. 이러한 이유로 mLV 통합 사이트는 능동적 인 규제 요소의 기능적 표지자로 사용될 수 있습니다. 여기에 우리는 세포 특이 적 인핸서 (enhancer)와 프로모터 (promoter)에 대한 게놈 차원의 식별을 가능하게하는 레트로 바이러스 스캐닝 도구를 제시한다. 간단히 말해, 표적 세포 집단은 mLV 유래 벡터로 형질 도입되고 게놈 DNA는 절단 제한 효소로 절단된다. 호환 DNA 링커와 게놈 조각의 연결 후, 링커 중재 폴리머 라제 연쇄 반응 (LM-PCR)은 바이러스 - 호스트 게놈 교차점의 증폭을 허용합니다. amplicons의 대규모 시퀀싱은 게놈 전체 mLV 통합 프로필을 정의하는 데 사용됩니다. 마지막으로, 반복적 통합의 클러스터는 세포 유형 특이적인 전사 프로그램의 활성화를 담당하는 세포 특이 적 조절 영역을 확인하기 위해 정의된다. 예를 들면 체세포 줄기 세포)의 회고 확인을위한 도구 기술을 대표한다.

레트로 바이러스 스캐닝 절차의 워크 플로우 레트로 바이러스 스캐닝 절차의 워크 플로가 그림 1 에 나와 있습니다. 표적 세포 집단을 정제하고 eGFP 리포터 유전자를 발현하는 mLV 유래 레트로 바이러스 벡터로 형질 감염시켰다. 형질 도입 유전자는 2 개의 동일한 긴 말단 반복 (5 &#39;?...

Watch this Scientific Journal Video about Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions at JoVE.com

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

여기, 우리는 인간 세포에서 Moloney 뮤린 백혈병 바이러스 기반의 레트로 바이러스 벡터의 통합 사이트의 게놈 전체 매핑을위한 프로토콜을 설명합니다.

레트로 바이러스 스캐닝 : MLV 통합 사이트 맵핑으로 세포 특정 규제 지역 정의

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

Research

JoVE Journal

Genetics

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

약물 저항 유전자를 확인하기위한 QTL 매핑 및 CRISPR / Cas9 편집<em&gt; Toxoplasma gondii</em

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the ...

연구

유전학

Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen

Biotinylated Psoralen을 사용하여 RNA-RNA 상호 작용을 세계적으로 매핑

Knowing how RNAs interact with themselves and with others is key to understanding RNA based gene regulation in the cell. While examples of RNA-RNA ...

Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow

양방향 레트로 바이러스 통합 사이트 PCR 방법론 및 정량적 데이터 분석 워크 플로

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral ...

G2-seq: A High Throughput Sequencing-based Technique for Identifying Late Replicating Regions of the Genome

G2-seq: 높은 처리량 시퀀싱 기반 기술을 늦게 게놈의 복제 확인

Numerous techniques have been developed to follow the progress of DNA replication through the S phase of the cell cycle. Most of these techniques have ...

Formaldehyde-assisted Isolation of Regulatory Elements to Measure Chromatin Accessibility in Mammalian Cells

포유류 세포에 측정 Chromatin 접근 규제 요소의 포 름 알 데히드 기반 격리

Appropriate gene expression in response to extracellular cues, that is, tissue- and lineage-specific gene transcription, critically depends on highly ...

A Fast and Quantitative Method for Post-translational Modification and Variant Enabled Mapping of Peptides to Genomes

포스트 번역 상 수정 및 변형에 대 한 신속 하 고 양적 방법 사용의 펩 티 드 유전자에 매핑

Cross-talk between genes, transcripts, and proteins is the key to cellular responses; hence, analysis of molecular levels as distinct entities is slowly ...

A Novel Saturation Mutagenesis Approach: Single Step Characterization of Regulatory Protein Binding Sites in RNA Using Phosphorothioates

Phosphorothioates를 사용 하 여 RNA에서 사이트 바인딩 규제 단백질의 소설 포화 Mutagenesis 접근: 단일 단계 특성

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to ...

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

차세대 시퀀싱의 원형 염색체 구조를 사용 하 여 유전자 규제 시퀀스의 높은 처리량 Id (4 C-seq)를 캡처

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

하나의 물방울 디지털 연쇄 반응 핫스팟 지역에서 돌연변이의 포괄적이 고 동시 검색

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation ...

Exploring Sequence Space to Identify Binding Sites for Regulatory RNA-Binding Proteins

규제 RNA 결합 단백질에 대한 결합 부위를 식별하기 위한 서열 공간 탐색

Gene regulation plays an important role in all cells. Transcriptional, post-transcriptional (or RNA processing), translational, and post-translational ...