Name: retroviral scanning: mapping mlv integration sites to define cell-specific regulatory regions
Uploaded: 2017-05-28T14:00:00
Description: Watch this Scientific Journal Video about Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions at JoVE.com

Este trabajo fue apoyado por subvenciones del Consejo Europeo de Investigación (ERC-2010-AdG, GT-SKIN), el Ministerio Italiano de Educación, Universidades e Investigación (FIRB-Futuro en Ricerca 2010-RBFR10OS4G, FIRB-Futuro en Ricerca 2012-RBFR126B8I_003 , EPIGEN Epigenomics Flagship Project), el Ministerio Italiano de Salud (Jóvenes Investigadores llaman 2011 GR-2011-02352026) y la Imagine Institute Foundation (París, Francia).

1. Transducción MLV de células humanas <ol><li> Aislar las células diana y transducirlos con un vector retroviral derivado de mlV que alberga el gen reportero eGFP y pseudotipado con el virus de la estomatitis vesicular G (VSV-G) o la glicoproteína de la envoltura anfotrópica 16 . <ol><li> Mantenga las células simuladas transducidas como un control negativo para los siguientes análisis. Dado que los vectores retrovirales basados ​​en mLV pueden transducir células qu...

<ol>
	<li>Ernst, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+and+analysis+of+chromatin+state+dynamics+in+nine+human+cell+types.">Mapping and analysis of chromatin state dynamics in nine human cell types.</a> Nature. 473 (7345), 43-49 (2011).</li><li>Shlyueva, D., Stampfel, G., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+enhancers:+from+properties+to+genome-wide+predictions.">Transcriptional enhancers: from properties to genome-wide predictions.</a> Nat Rev Genet. 15 (4), 272-286 (2014).</li><li>Roadmap Epigenomics Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+111+reference+human+epigenomes.">Integrative analysis of 111 reference human epigenomes.</a> Nature. 518 (7539), 317-330 (2015).</li><li>Heintzman, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+modifications+at+human+enhancers+reflect+global+cell-type-specific+gene+expression.">Histone modifications at human enhancers reflect global cell-type-specific gene expression.</a> Nature. 459 (7243), 108-112 (2009).</li><li>Creyghton, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+H3K27ac+separates+active+from+poised+enhancers+and+predicts+developmental+state.">Histone H3K27ac separates active from poised enhancers and predicts developmental state.</a> Proc Natl Acad Sci U S A. 107 (50), 21931-21936 (2010).</li><li>Hnisz, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Super-enhancers+in+the+control+of+cell+identity+and+disease.">Super-enhancers in the control of cell identity and disease.</a> Cell. 155 (4), 934-947 (2013).</li><li>Cattoglio, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-definition+mapping+of+retroviral+integration+sites+identifies+active+regulatory+elements+in+human+multipotent+hematopoietic+progenitors.">High-definition mapping of retroviral integration sites identifies active regulatory elements in human multipotent hematopoietic progenitors.</a> Blood. 116 (25), 5507-5517 (2010).</li><li>Biasco, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+profile+of+retroviral+vector+in+gene+therapy+treated+patients+is+cell-specific+according+to+gene+expression+and+chromatin+conformation+of+target+cell.">Integration profile of retroviral vector in gene therapy treated patients is cell-specific according to gene expression and chromatin conformation of target cell.</a> EMBO Mol Med. 3 (2), 89-101 (2011).</li><li>De Ravin, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancers+are+major+targets+for+murine+leukemia+virus+vector+integration.">Enhancers are major targets for murine leukemia virus vector integration.</a> J Virol. 88 (8), 4504-4513 (2014).</li><li>LaFave, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mLV+integration+site+selection+is+driven+by+strong+enhancers+and+active+promoters.">mLV integration site selection is driven by strong enhancers and active promoters.</a> Nucleic Acids Res. 42 (7), 4257-4269 (2014).</li><li>Gupta, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bromo-+and+extraterminal+domain+chromatin+regulators+serve+as+cofactors+for+murine+leukemia+virus+integration.">Bromo- and extraterminal domain chromatin regulators serve as cofactors for murine leukemia virus integration.</a> J Virol. 87 (23), 12721-12736 (2013).</li><li>Sharma, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BET+proteins+promote+efficient+murine+leukemia+virus+integration+at+transcription+start+sites.">BET proteins promote efficient murine leukemia virus integration at transcription start sites.</a> Proc Natl Acad Sci U S A. 110 (29), 12036-12041 (2013).</li><li>De Rijck, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BET+family+of+proteins+targets+moloney+murine+leukemia+virus+integration+near+transcription+start+sites.">The BET family of proteins targets moloney murine leukemia virus integration near transcription start sites.</a> Cell reports. 5 (4), 886-894 (2013).</li><li>Romano, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional,+epigenetic+and+retroviral+signatures+identify+regulatory+regions+involved+in+hematopoietic+lineage+commitment.">Transcriptional, epigenetic and retroviral signatures identify regulatory regions involved in hematopoietic lineage commitment.</a> Sci Rep. 6, 24724 (2016).</li><li>Cavazza, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+Transcriptional+and+Epigenetic+Regulation+of+Human+Epidermal+Keratinocyte+Differentiation.">Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation.</a> Stem Cell Reports. 6 (4), 618-632 (2016).</li><li>Miller, A. D., Law, M. F., Verma, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+helper-free+amphotropic+retroviruses+that+transduce+a+dominant-acting,+methotrexate-resistant+dihydrofolate+reductase+gene.">Generation of helper-free amphotropic retroviruses that transduce a dominant-acting, methotrexate-resistant dihydrofolate reductase gene.</a> Mol Cell Biol. 5 (3), 431-437 (1985).</li><li>Cattoglio, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-definition+mapping+of+retroviral+integration+sites+defines+the+fate+of+allogeneic+T+cells+after+donor+lymphocyte+infusion.">High-definition mapping of retroviral integration sites defines the fate of allogeneic T cells after donor lymphocyte infusion.</a> PLoS One. 5 (12), e15688 (2010).</li><li>Aiuti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+hematopoietic+stem+cell+gene+therapy+in+patients+with+Wiskott-Aldrich+syndrome.">Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome.</a> Science. 341 (6148), 1233151 (2013).</li><li>Biffi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+hematopoietic+stem+cell+gene+therapy+benefits+metachromatic+leukodystrophy.">Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy.</a> Science. 341 (6148), 1233158 (2013).</li><li>Gabriel, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+genomic+access+to+vector+integration+in+clinical+gene+therapy.">Comprehensive genomic access to vector integration in clinical gene therapy.</a> Nat Med. 15 (12), 1431-1436 (2009).</li><li>Gillet, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+host+genomic+environment+of+the+provirus+determines+the+abundance+of+HTLV-1-infected+T-cell+clones.">The host genomic environment of the provirus determines the abundance of HTLV-1-infected T-cell clones.</a> Blood. 117 (11), 3113-3122 (2011).</li></ol>

Aquí, hemos descrito un protocolo para el genoma de la cartografía de los sitios de integración de mLV, un retrovirus que las regiones de la cromatina objetivo, epigenéticamente marcado como promotores activos y potenciadores. Los pasos críticos y / o limitaciones del protocolo incluyen: (i) transducción mLV de la población de células diana; (Ii) amplificación de las uniones huésped-virus por LM-PCR; (Iii) recuperación de una alta fracción de sitios de integración. Los vectores retrovirales basados ​​en...

La identidad celular se determina mediante la expresión de conjuntos específicos de genes. El papel de los elementos reguladores cis, tales como promotores y potenciadores, es crucial para la activación de programas de transcripción específicos de tipo celular. Estas regiones reguladoras se caracterizan por características específicas de la cromatina, tales como modificaciones peculiares de las histonas, factores de transcripción y unión de co-factores, y accesibilidad a la cromatina, que han sido ampliamente utilizados para su identificación genómica en varios tipos de células 1 , 2 , 3 . En particular, el perfil genómico de la acetilación de histona H3 lisina 27 (H3K27ac) se utiliza comúnmente para definir promotores activos, potenciadores y super-potenciadores 4 , 5 , 6 . El virus de la leucemia murina de Moloney (MLV) es un gamma-retrovirus que es ampliamente utilizado para el genTransferencia en células de mamíferos. Después de infectar una célula diana, el genoma del ARN retroviral se retrotranscribe en una molécula de ADN de doble cadena que se une a las proteínas víricas y celulares para ensamblar el complejo de preinteligencia (PIC). El PIC entra en el núcleo y se une a la cromatina de la célula huésped. En este caso, la integrasa viral, un componente clave de PIC, media la integración del ADN proviral en el genoma de la célula huésped. MlV integración en el ADN genómico no es al azar, pero se produce en elementos activos cis-reguladores, tales como promotores y potenciadores, en una célula de forma específica 7 , 8 , 9 , 10 . Este peculiar perfil de integración está mediada por una interacción directa entre la integrasa mLV y las proteínas celulares de bromodominio y dominio extraterminal (BET) 11 , 12 , 13 . Las proteínas BET (BRD2, BRD3 yBRD4) actúan como puente entre la cromatina del huésped y el PIC mlV: a través de sus bromodominios reconocen regiones cis-reguladoras altamente acetiladas, mientras que el dominio extraterminal interactúa con la integrasa mLV 11 , 12 , 13 . Aquí, describimos el escaneo retroviral, una herramienta novedosa para mapear regiones reguladoras cis-activas basadas en las propiedades de integración de mLV. Brevemente, las células se transducen con el vector retroviral derivado de mlV que expresa el gen indicador de proteína fluorescente verde (eGFP) mejorada. Después de la extracción del ADN genómico, las uniones entre la repetición terminal larga (LTR) de 3 &#39;del vector mlV y el ADN genómico se amplifican mediante PCR (LM-PCR) mediada por enlazadores y se secuencian masivamente. MlV sitios de integración se asignan al genoma humano y las regiones genómicas altamente objetivo de mLV se definen como grupos de mlV sitios de integración. Escaneo retroviralNing se utilizó para definir la célula específica de los elementos reguladores activos en varias células primarias humanas [ 14 , 15] . MlV clusters co-mapeados con epigenéticamente definidos promotores y potenciadores, la mayoría de los cuales albergan histonas marcas activas, como H3K27ac, y fueron específicos de células. El escaneo retroviral permite la identificación en todo el genoma de los elementos reguladores del ADN en poblaciones de células purificadas prospectivamente 7,14 , así como en poblaciones celulares definidas de forma retrospectiva, como las células madre de queratinocitos, que carecen de marcadores efectivos para el aislamiento prospectivo 15 .

<table>
	<tbody>
		<tr>
			<td>PBS, pH 7.4</td>
			<td>ThermoScientific</td>
			<td>10010031</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>ThermoScientific</td>
			<td>16000044</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>0.2 ml tubes</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>1.5 ml tubes</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>QIAGEN QIAmp DNA mini Kit&#160;</td>
			<td>QIAGEN</td>
			<td>51306</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>T4 DNA ligase&#160;</td>
			<td>New England BioLabs</td>
			<td>M0202T</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA Ligase Reaction buffer</td>
			<td>New England BioLabs</td>
			<td>M0202T</td>
			<td></td>
		</tr>
		<tr>
			<td>Linker Plus Strand oligonucleotide</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-PO4-TAGTCCCTTAAGCGGAG-3&#8217;&#160; (Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Linker Minus Strand oligonucleotide</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC-3&#8217; (Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Tru9I</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11464825001</td>
			<td></td>
		</tr>
		<tr>
			<td>SuRE/Cut Buffer M</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11417983001</td>
			<td></td>
		</tr>
		<tr>
			<td>PstI&#160;</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>10798991001</td>
			<td></td>
		</tr>
		<tr>
			<td>SuRE/Cut Buffer H</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11417991001</td>
			<td></td>
		</tr>
		<tr>
			<td>Platinum Taq DNA Polimerase High Fidelity&#160;</td>
			<td>Invitrogen</td>
			<td>11304011</td>
			<td></td>
		</tr>
		<tr>
			<td>10mM dNTP Mix</td>
			<td>Invitrogen</td>
			<td>18427013</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>PCR grade water</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>96-well thermal cycler (with heated lid)</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>linker primer</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GTAATACGACTCACTATAGGGC-3&#8217; (Purification grade: PCR grade)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR primer</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GACTTGTGGTCTCGCTGTTCCTTGG-3&#8217; (Purification grade: PCR grade)</td>
		</tr>
		<tr>
			<td>linker nested primer 454</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GCCTTGCCAGCCCGCTCAG[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR nested primer 454</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GCCTCCCTCGCGCCATCAGTAGC[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>linker nested primer Illumina</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#39;-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR nested primer Illumina</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#39;-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Sodium Acetate Solution (3M) pH 5.2</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol (absolute) for molecular biology</td>
			<td>Sigma-Aldrich</td>
			<td>E7023</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Topo TA Cloning kit (with pCR2.1-TOPO vector)</td>
			<td>Invitrogen</td>
			<td>K4500-01</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction kit</td>
			<td>QIAGEN</td>
			<td>28704</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Sigma-Aldrich</td>
			<td>A9539</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Ethidium bromide&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>E1510</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>100 bp DNA ladder</td>
			<td>Invitrogen</td>
			<td>15628019</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>6X Loading Buffer</td>
			<td>ThermoScientific</td>
			<td>R0611</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>NanoDrop 2000 UV-Vis Spectrophotometer</td>
			<td>ThermoScientific</td>
			<td>ND-2000</td>
			<td></td>
		</tr>
		<tr>
			<td>Nextera XT Index kit</td>
			<td>Illumina</td>
			<td>FC-131-1001 or FC-131-1002</td>
			<td></td>
		</tr>
		<tr>
			<td>2x KAPA HiFi Hot Start Ready Mix&#160;</td>
			<td>KAPA Biosystems</td>
			<td>KK2601</td>
			<td></td>
		</tr>
		<tr>
			<td>Dynal magnetic stand for 2 ml tubes</td>
			<td>Invitrogen</td>
			<td>12321D</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Agencourt AMPure XP 60 ml kit</td>
			<td>Beckman Coulter Genomics</td>
			<td>A63881</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl 10 mM, pH 8.5</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2200 TapeStation system</td>
			<td>Agilent Technologies</td>
			<td>G2964AA</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>D1000 ScreenTape</td>
			<td>Agilent Technologies</td>
			<td>5067-5582</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>D1000 Reagents</td>
			<td>Agilent Technologies</td>
			<td>5067-5583</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>KAPA Library Quantification Kit for Illumina platforms (ABI Prism)</td>
			<td>KAPA Biosystems</td>
			<td>KK4835</td>
			<td></td>
		</tr>
		<tr>
			<td>ABI Prism 7900HT Fast Real-Time PCR System</td>
			<td>Applied Biosystems</td>
			<td>4329003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaOH 1.0 N, molecular biology-grade</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HT1 (Hybridization Buffer)</td>
			<td>Illumina&#160;</td>
			<td>Provided in the MiSeq Reagent Kit</td>
			<td></td>
		</tr>
		<tr>
			<td>MiSeq Reagent Kit v3 (150 cycles)</td>
			<td>Illumina</td>
			<td>MS-102-3001</td>
			<td></td>
		</tr>
		<tr>
			<td>MiSeq System</td>
			<td>Illumina</td>
			<td>SY-410-1003</td>
			<td></td>
		</tr>
		<tr>
			<td>PhiX Control v3</td>
			<td>Illumina</td>
			<td>FC-110-3001</td>
			<td></td>
		</tr>
	</tbody>
</table>

retroviral scanning: mapping mlv integration sites to define cell-specific regulatory regions

Los vectores retrovirales basados ​​en virus de la leucemia murina de Moloney (MLV) se integran predominantemente en potenciadores y promotores acetilados. Por esta razón, los sitios de integración mLV pueden usarse como marcadores funcionales de elementos reguladores activos. Aquí, presentamos una herramienta de exploración retroviral, que permite la identificación a nivel genoma de potenciadores y promotores específicos de células. En resumen, la población de células diana se transduce con un vector derivado de mLV y el ADN genómico se digiere con una enzima de restricción de corte frecuente. Después de la ligación de fragmentos genómicos con un enlazador de ADN compatible, la reacción en cadena de polimerasa mediada por enlazador (LM-PCR) permite la amplificación de las uniones genómicas virus-huésped. La secuenciación masiva de los amplicones se utiliza para definir el perfil de integración de mLV en todo el genoma. Finalmente, se definen grupos de integraciones recurrentes para identificar regiones reguladoras específicas de células, responsables de la activación de programas transcripcionales específicos de tipo celular. <p class= &quot;Jove_content&quot;&gt; La herramienta de exploración retroviral permite la identificación en todo el genoma de promotores y potenciadores específicos de células en poblaciones de células diana prospectivamente aisladas. En particular, el escáner retroviral representa una técnica instrumental para la identificación retrospectiva de poblaciones raras ( por ejemplo, células madre somáticas) que carecen de marcadores robustos para el aislamiento prospectivo.

Flujo de trabajo del procedimiento de exploración retroviral El flujo de trabajo del procedimiento de exploración retroviral se esquematiza en la Figura 1 . La población de células diana se purifica y transduce con un vector retroviral derivado de mlV que expresa un gen informador eGFP. El transgén está flanqueado por las dos repeticiones terminales largas idénticas (5 &#39;y 3&#39; LTR), aseg...

Watch this Scientific Journal Video about Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions at JoVE.com

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

Aquí, describimos un protocolo para el genoma de la cartografía de los sitios de integración Moloney murino leucemia virus basados ​​en retrovirus vectores en células humanas.

Escaneo Retroviral: Mapeo de sitios de integración MLV para definir regiones reguladoras específicas de células

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

Research

JoVE Journal

Genetics

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

QTL Mapping y CRISPR / Cas9 Edición para identificar un gen de resistencia a fármacos en<em&gt; Toxoplasma gondii</em

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the ...

Investigación

Genética

Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen

Mapeo de las interacciones RNA-ARN a nivel mundial usando Psoralen Biotinilado

Knowing how RNAs interact with themselves and with others is key to understanding RNA based gene regulation in the cell. While examples of RNA-RNA ...

Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow

Sitio de Integración Retroviral Bidireccional Metodología de PCR y Flujo de Trabajo de Análisis de Datos Cuantitativos

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral ...

G2-seq: A High Throughput Sequencing-based Technique for Identifying Late Replicating Regions of the Genome

G2-seq: Una alto rendimiento basado en la secuencia técnica para identificar replicación tardía de regiones del genoma

Numerous techniques have been developed to follow the progress of DNA replication through the S phase of the cell cycle. Most of these techniques have ...

Formaldehyde-assisted Isolation of Regulatory Elements to Measure Chromatin Accessibility in Mammalian Cells

Formaldehído-asistida aislamiento de elementos reguladores para medir accesibilidad de la cromatina en células de mamíferos

Appropriate gene expression in response to extracellular cues, that is, tissue- and lineage-specific gene transcription, critically depends on highly ...

A Fast and Quantitative Method for Post-translational Modification and Variant Enabled Mapping of Peptides to Genomes

Un método rápido y cuantitativo para la variante y modificación poste-de translación activado mapeo de péptidos genomas

Cross-talk between genes, transcripts, and proteins is the key to cellular responses; hence, analysis of molecular levels as distinct entities is slowly ...

A Novel Saturation Mutagenesis Approach: Single Step Characterization of Regulatory Protein Binding Sites in RNA Using Phosphorothioates

Un enfoque de mutagénesis de saturación novela: Solo paso caracterización de sitios en el ARN usando fosforotioatos de unión de proteína reguladora

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to ...

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

Captura de alto rendimiento identificación de secuencias reguladoras de genes utilizando secuenciación de próxima generación de conformación Circular cromosoma (4C-seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

Reacción en cadena polimerasa Digital sola gota para la detección integral y simultánea de mutaciones en las regiones de Hotspot

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation ...

Exploring Sequence Space to Identify Binding Sites for Regulatory RNA-Binding Proteins

Explorar el espacio de secuencia para identificar sitios de unión para proteínas reguladoras que unen el ARN

Gene regulation plays an important role in all cells. Transcriptional, post-transcriptional (or RNA processing), translational, and post-translational ...