Name: mrna interactome capture from plant protoplasts
Uploaded: 2017-07-28T13:00:00
Description: Watch this Scientific Journal Video about mRNA Interactome Capture from Plant Protoplasts at JoVE.com

Reconocemos el laboratorio del Prof. Joris Winderickx, que proporcionó el aparato de reticulación UV equipado con la lámpara UV convencional. KG cuenta con el apoyo del fondo de investigación KU Leuven y reconoce el apoyo de la subvención FWO G065713N.

1. Arabidopsis Leaf Mesophyll Protoplast Aislamiento NOTA: Los protoplastos de mesofilo de hoja de Arabidopsis se aislan esencialmente como se describe en Yoo et al ., 2007, con varias modificaciones 40 . <ol><li> Crecimiento de plantas <ol><li> Remoje aproximadamente 200 semillas de ecotipo Arabidopsis thaliana Col-0 en agua esterilizada durante 2 días a 4 ° C en la oscuridad para estratificación. NOTA:...

Aplicamos con éxito la captura de interactomas de mRNA, desarrollada para levaduras y células humanas, para plantar protoplastos de mesofilo en hojas. Las células del mesófilo de la hoja son el tipo principal de tejido de tierra en hojas de la planta. La principal ventaja de este método es que utiliza reticulación in vivo para descubrir las proteínas de un entorno fisiológico. En este protocolo, presentamos principalmente una serie de condiciones experimentales optimizadas (...

Los eucariotas utilizan múltiples vías reguladoras de la biogénesis del ARN para mantener los procesos biológicos celulares. Entre los tipos conocidos de ARN, el ARNm es muy diverso y lleva la capacidad de codificación de las proteínas y sus isoformas 1. La ruta PTGR dirige los destinos de los pre-mRNAs 2 , 3 . RBPs de diferentes familias de genes controlan la regulación de ARN, y en PTGR, mRBPs específicos guían mRNAs a través de interacciones físicas directas, formando mRNPs funcional. Por lo tanto, la identificación y caracterización de mRBPs y sus mRNPs es fundamental para entender la regulación del metabolismo del mRNA celular 2. Durante las últimas tres décadas, varios métodos in vitro - incluyendo los ensayos de desplazamiento de movilidad electroforética de ARN (REMSA), evolución sistemática de ligandos mediante ensayos de enriquecimiento exponencial (SELEX) basado en constructos derivados de la biblioteca, RNA Bind-n-Seq (RBNS), radiomarcado o cuantitativoEnsayos de unión a ARN de fluorescencia, cristalografía de rayos X y espectroscopia de RMN 4 , 5 , 6 , 7 , 8 , 9 - se han aplicado ampliamente a estudios de RBP, principalmente a partir de células de mamífero. Los resultados de estos estudios de mamíferos RBPs se puede buscar a través de la RNA-binding Protein DataBase (RBPDB), que recoge las observaciones publicadas [ 10] . Aunque estos enfoques in vitro son herramientas de gran alcance, que determinan los motivos de ARN unido de un determinado grupo de RNA de secuencias y por lo tanto, están limitados en su capacidad para descubrir nuevos ARN objetivo. Lo mismo es cierto para las estrategias computacionales para predecir el genoma de todo RBPs, que se basan en la conservación de la secuencia de proteínas y la estructura [ 15] . Para superar esto, un nuevo método experimental haSe ha establecido que permite la identificación de los motivos de ARN que un RBP de interés interactúa con, así como para la determinación de la ubicación precisa de la unión. Este método, denominado &quot;reticulación e inmunoprecipitación&quot; (CLIP), está compuesto de reticulación UV in vivo seguida por inmunoprecipitación 11 . Los primeros estudios han demostrado que la fotoactivación de nucleótidos de ADN y ARN puede ocurrir a una longitud de onda UV de excitación mayor que 245 nm. La reacción a través de la timidina parece ser favorecida (rango en orden de disminución de la fotoreactividad: dT ≥ dC&gt; rU&gt; rC, dA, dG) 12 . Usando luz UV con una longitud de onda de 254 nm (UV-C), se observó que se crean enlaces covalentes entre nucleótidos de ARN y residuos de proteína cuando están en el rango de sólo unos pocos Angstroms (Å). Por lo tanto, el fenómeno se denomina reticulación de &quot;cero longitud&quot; de RNA y RBP. Esto puede ser seguido por un procedimiento de purificación estricto<html> Con poco fondo 13 , 14 . Una estrategia complementaria al CLIP consiste en combinar la reticulación UV in vivo con la identificación de proteínas para describir el paisaje de las RBP. Se han aislado varios proteomas unidos a mRNA de este genoma de células de levadura, células madre embrionarias (ESCs) y líneas celulares humanas ( es decir, HEK293 y HeLa) usando este nuevo enfoque experimental, denominado &quot;captura de interactomas de mRNA&quot; 18 , 19 , 20 , 21 . El método se compone de reticulación UV in vivo seguida por purificación de mRNP y proteómica basada en MS. Mediante la aplicación de esta estrategia, se han descubierto muchas RBP no lineales que contienen RBDs no canónicos y se ha puesto de manifiesto que más proteínas tienen capacidades de unión a ARN de lo que se suponía anteriormente&quot;&gt; 15, 16, 17. El uso de este método permite nuevas aplicaciones y para la capacidad de responder a las nuevas preguntas biológicos en la investigación de las prácticas comerciales restrictivas. Por ejemplo, un estudio reciente ha investigado la conservación del proteoma ARNm unido (el núcleo RBP Proteoma) entre la levadura y las células humanas [ 22] . Se ha descubierto que las RBP de las plantas están implicadas en el crecimiento y desarrollo ( por ejemplo , en la regulación post-transcripcional del tiempo de floración, el reloj circadiano y la expresión génica en mitocondrias y cloroplastos) 24 , 25 , 26 , 27 , 28 , 29 . Además, se piensa que desempeñan funciones en los procesos celulares que responden a tensiones abióticas ( por ejemplo, frío, sequía, saLinidad y ácido abscísico (ABA)) 31 , 32 , 33 , 34 . Existen más de 200 genes RBP predichos en el genoma de Arabidopsis thaliana , basados ​​en motivos de secuencia de dominio de reconocimiento de ARN (RRM) y homología K (KH); En el arroz, aproximadamente 250 se han observado 35 , 36 . Es notable que muchos RBPs predicho parecen ser únicos a las plantas ( por ejemplo, ningún orthologs del metazoan a aproximadamente el 50% de RBP predichas de Arabidopsis que contienen un dominio de RRM) 35 , sugiriendo que muchos pueden servir a nuevas funciones. Las funciones de la mayoría de las RBP predicho siguen sin caracterizar [ 23] . El aislamiento de proteomas unidos a ARNm de plántulas etioladas de Arabidopsis , tejido foliar, células de raíces cultivadas y protoplastos de mesofilo de hoja mediante el uso deMRNA interactome captura se ha informado recientemente 38 , 39 . Estos estudios demuestran el fuerte potencial de catalogar sistemáticamente las RBP funcionales en las plantas en un futuro próximo. Aquí, presentamos un protocolo para mRNA interactome captura de protoplastos de plantas ( es decir, células sin paredes celulares). Los protoplastos de mesofila de la hoja de Arabidopsis thaliana son el tipo principal de células foliares. Los protoplastos aislados permiten el acceso óptimo de la luz UV a las células. Este tipo de células se puede utilizar en ensayos que transitoriamente expresar proteínas para la caracterización funcional [ 40 , 41] . Además, la protoplastía se ha aplicado a varios otros tipos de células vegetales y especies 42 , 43 , 44 ( por ejemplo, Petersson et al ., 2009; Bargmann y Birnbaum, 2010 y Hong et al ., 2012). &lt;P class = &quot;jove_content&quot;&gt; El método abarca un total de 11 pasos ( Figura 1A ). Los protoplastos de mesofilo de hoja de Arabidopsis se aislan primero (etapa 1) y posteriormente se irradian con UV para formar mRNPs reticulados (etapa 2). Cuando los protoplastos se lisan en condiciones desnaturalizantes (etapa 3), los mRNP reticulados se liberan en tampón de lisis / unión y se extraen por perlas de oligo-d (T) 25 (etapa 4). Después de varias rondas de lavados rigurosos, los mRNP se purifican y se analizan adicionalmente. Los péptidos desnaturalizados de mRBPs son digeridos por proteinasa K antes de purificar los ARNm reticulados y la calidad de ARN se verifica mediante qRT-PCR (etapas 5 y 6). Después del tratamiento con RNasa y la concentración de proteína (etapa 7), la calidad de la proteína se controla mediante electroforesis en gel de poliacrilamida SDS (SDS-PAGE) y tinción con plata (etapa 8). La diferencia en los patrones de bandas de proteína puede visualizarse fácilmente entre una muestra reticulada (CL) y una muestra no reticulada (no CL;La muestra de control negativo de protoplastos que no está sometida a irradiación UV). La identificación de proteínas se logra mediante la proteómica basada en la EM. Las proteínas de la muestra de CL se separan mediante electroforesis unidimensional en gel de poliacrilamida (1D-PAGE) para eliminar la posible contaminación de fondo, se digieren en gel en péptidos cortos usando tripsina y se purifican (etapa 9). La cromatografía líquida de fase inversa nanométrica acoplada a espectrometría de masas (nano-LC-MS) permite la determinación de la cantidad de proteínas definitivas en el proteoma ligado al mRNA (paso 10). Finalmente, las mRBPs identificadas se caracterizan y catalogan usando el análisis bioinformático (paso 11).

<table>
	<tbody>
		<tr>
			<td colspan="4">REAGENTS</td>
		</tr>
		<tr>
			<td>0.8 M Mannitol</td>
			<td>Sigma</td>
			<td>M1902-500G</td>
			<td>Primary isotonic Enzyme solution &#38; 
			MMg solution</td>
		</tr>
		<tr>
			<td>2M KCl</td>
			<td>MERCK</td>
			<td>Art. 4935</td>
			<td>Primary isotonic Enzyme solution &#38; 
			W5 buffer</td>
		</tr>
		<tr>
			<td>0.2 M MES (pH 5.7) 
			(4-morpholineethanesulfonic acid)</td>
			<td>Sigma-aldrich</td>
			<td>M2933</td>
			<td>Primary isotonic Enzyme solution, 
			W5 buffer &#38; 
			MMg solution, 
			Filtration sterilization</td>
		</tr>
		<tr>
			<td>Cellulase R10</td>
			<td>Yakult Pharmaceutical Industry Co., Ltd.</td>
			<td>CELLULASE 
			&#8220;ONOZUKA&#8221; 
			R-10, 10 g</td>
			<td>Final isotonic enzyme solution</td>
		</tr>
		<tr>
			<td>Macerozyme R10</td>
			<td>Yakult Pharmaceutical Industry Co., Ltd.</td>
			<td>MACEROZYME R-10, 10g</td>
			<td>Final isotonic enzyme solution</td>
		</tr>
		<tr>
			<td>10% (w/v) BSA 
			(Bovine Serum Albumin)</td>
			<td>Sigma-aldrich</td>
			<td>A7906-100G</td>
			<td>Final isotonic enzyme solution &#38; 
			Filtration sterilization</td>
		</tr>
		<tr>
			<td>1M CaCl2</td>
			<td>Chem-Lab NV</td>
			<td>CL00.0317.1000</td>
			<td>Final isotonic enzyme solution, 
			W5 buffer &#38; 
			Digestion buffer</td>
		</tr>
		<tr>
			<td>1M NaCl</td>
			<td>Fisher Chemical</td>
			<td>S/3160/60</td>
			<td>W5 buffer</td>
		</tr>
		<tr>
			<td>2M MgCl2</td>
			<td>Sigma</td>
			<td>M8266-100G</td>
			<td>MMg solution</td>
		</tr>
		<tr>
			<td>1M LiCl 
			(Lithium Chloride)</td>
			<td>Acros</td>
			<td>199885000</td>
			<td>Lysis/binding buffer, 
			Wash buffer 1, 
			Wash buffer 2 &#38; 
			Low salt buffer</td>
		</tr>
		<tr>
			<td>5% (w/v) LiDS 
			(Lithium Dodecyl Sulphate)</td>
			<td>Sigma-aldrich</td>
			<td>L4632-25G</td>
			<td>Lysis/binding buffer, 
			Wash buffer 1 &#38; 
			Filtration sterilization</td>
		</tr>
		<tr>
			<td>1M DTT 
			(Dithiothreitol)</td>
			<td>Thermo Fisher Scientific 
			Wash buffer 1 &#38; 
			Wash buffer 2</td>
			<td>307866</td>
			<td>Lysis/binding buffer,</td>
		</tr>
		<tr>
			<td>1M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl))</td>
			<td>Acros &#38; 
			Fisher Chemical</td>
			<td>167620010 &#38; 
			H/1200/PB15</td>
			<td>Lysis/binding buffer, 
			Wash buffer 1, 
			Wash buffer 2, 
			Low salt buffer &#38; 
			Elution buffer</td>
		</tr>
		<tr>
			<td>0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid)</td>
			<td>Sigma-aldrich</td>
			<td>ED-500G</td>
			<td>Lysis/binding buffer, 
			Wash buffer 1, 
			Wash buffer 2, 
			Low salt buffer &#38; 
			Elution buffer</td>
		</tr>
		<tr>
			<td>Tween 20</td>
			<td>MERCK</td>
			<td>8.22184.0500</td>
			<td>Regeneration of oligo-d(T)25 beads</td>
		</tr>
		<tr>
			<td>0.1 M NaOH</td>
			<td>VWR PROLABO CHEMICALS</td>
			<td>28244.295</td>
			<td>Regeneration of oligo-d(T)25 beads</td>
		</tr>
		<tr>
			<td>1X PBS (pH 7.4) 
			(Phosphate Buffered Saline) 
			containing 
			(NaCl; KCl; Na2HPO4; KH2PO4)</td>
			<td>Fisher Chemical, MERCK, 
			Sigma-aldrich &#38; SAFC</td>
			<td>S/3160/60, 
			Art. 4935, 
			71640-250G &#38; 
			60230</td>
			<td>Regeneration of oligo-d(T)25 beads</td>
		</tr>
		<tr>
			<td>Proteinase K solution (2 &#956;g/&#956;L)</td>
			<td>Thermo Fisher Scientific</td>
			<td>11789020</td>
			<td>Protein digestion</td>
		</tr>
		<tr>
			<td>Loading dye</td>
			<td>Invitrogen</td>
			<td>LC5925</td>
			<td>SDS-PAGE</td>
		</tr>
		<tr>
			<td>qPCR master mix</td>
			<td>Promega</td>
			<td>A6001</td>
			<td>qRT-PCR assay</td>
		</tr>
		<tr>
			<td>RNase Cocktail</td>
			<td>Thermo Fisher Scientific</td>
			<td>AM2286</td>
			<td>RNA digestion</td>
		</tr>
		<tr>
			<td>Methanol</td>
			<td>Sigma-aldrich</td>
			<td>322415</td>
			<td>Gel fixation and gel destaining</td>
		</tr>
		<tr>
			<td>Acetic acid</td>
			<td>Sigma-aldrich</td>
			<td>537020</td>
			<td>Gel fixation and gel destaining</td>
		</tr>
		<tr>
			<td>Coomassie Brilliant Blue R-250</td>
			<td>Thermo Fisher Scientific</td>
			<td>20278</td>
			<td>Gel staining</td>
		</tr>
		<tr>
			<td>1M NH4HCO3 
			(Ammonium bicarbonate) 
			&#160;</td>
			<td>Sigma-aldrich</td>
			<td>09830-500G</td>
			<td>Gel hydration &#38; 
			Digestion buffer</td>
		</tr>
		<tr>
			<td>CH3CN 
			(Acetonitrile)</td>
			<td>Sigma-aldrich</td>
			<td>34851-100ML</td>
			<td>Gel dehydration &#38; 
			Peptide dissolving solution</td>
		</tr>
		<tr>
			<td>IAA 
			(Iodoacetic acid)</td>
			<td>Sigma-aldrich</td>
			<td>I4386-10G</td>
			<td>Alkylating agent</td>
		</tr>
		<tr>
			<td>TFA 
			(Trifluoroacetic acid)</td>
			<td>Sigma-aldrich</td>
			<td>302031-10X1ML</td>
			<td>Peptide dissolving solution</td>
		</tr>
		<tr>
			<td>FA 
			(Formic acid)</td>
			<td>Sigma-aldrich</td>
			<td>06554-5G</td>
			<td>Peptide extraction</td>
		</tr>
		<tr>
			<td>Trypsin solution (6 ng/&#956;L)</td>
			<td>Promega</td>
			<td>V5280</td>
			<td>Digestion buffer</td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td colspan="4">EQUIPMENT</td>
		</tr>
		<tr>
			<td>Soil</td>
			<td>Peltracom</td>
			<td>LP2D</td>
			<td>Plant growth</td>
		</tr>
		<tr>
			<td>Vermiculite 3</td>
			<td>Sibli AS</td>
			<td>05VERMICULIET</td>
			<td>Plant growth</td>
		</tr>
		<tr>
			<td>Petri dish (150 x 20 mm)</td>
			<td>Sarstedt</td>
			<td>82.1184.500</td>
			<td>Carrier for protoplast suspension</td>
		</tr>
		<tr>
			<td>0.22 &#956;m filter</td>
			<td>Millipore</td>
			<td>SE2M229104</td>
			<td>Homogenization of final isotonic enzyme solution</td>
		</tr>
		<tr>
			<td>Razorblade</td>
			<td>Agar Scientific</td>
			<td>T585</td>
			<td>Rosette leaf strips</td>
		</tr>
		<tr>
			<td>35-75 &#956;m nylon mesh</td>
			<td>SEFAR NITEX</td>
			<td>74010</td>
			<td>Protoplast suspension filtration</td>
		</tr>
		<tr>
			<td>50 mL round bottom tubes</td>
			<td>Sigma-aldrich</td>
			<td>T1918-10EA</td>
			<td>Carrier for protoplast suspension</td>
		</tr>
		<tr>
			<td>Hemocytometer 
			(B&#252;rker hemocytometer)</td>
			<td>MARIENFELD</td>
			<td>650030</td>
			<td>Protoplast cell counting</td>
		</tr>
		<tr>
			<td>UV crosslinking apparatus 
			(HL-2000 HybriLinker)</td>
			<td>UVP, LLC</td>
			<td>UVP95003101</td>
			<td>in vivo UV crosslinking</td>
		</tr>
		<tr>
			<td>UV lamp 
			(Sankyo-Denki G8T5)</td>
			<td>SANKYO 
			DENKI</td>
			<td>SD G8T5</td>
			<td>in vivo UV crosslinking</td>
		</tr>
		<tr>
			<td>50 mL glass syringe</td>
			<td>FORTUNA Optima</td>
			<td>Z314560</td>
			<td>Homogenization of protoplast lysate</td>
		</tr>
		<tr>
			<td>Narrow needle (0.9 x 25 mm)</td>
			<td>Becton Dickinson microlance 3</td>
			<td>2021-04</td>
			<td>Homogenization of protoplast lysate</td>
		</tr>
		<tr>
			<td>Rotator Model L26</td>
			<td>Labinco BV</td>
			<td>26110912</td>
			<td>Sample incubation by rotating</td>
		</tr>
		<tr>
			<td>Oligo-d(T)25 magnetic beads 
			(5 mg/mL)</td>
			<td>New England BioLabs</td>
			<td>S1419S</td>
			<td>mRNPs and mRNAs binding and pull-down</td>
		</tr>
		<tr>
			<td>Magnetic rack</td>
			<td>Invitrogen</td>
			<td>CS15000</td>
			<td>mRNPs and mRNAs binding and pull-down</td>
		</tr>
		<tr>
			<td>Centrifugal filter units 
			(Amicon Ultra-4 centrifugal filter units)</td>
			<td>EMD Millipore</td>
			<td>UFC800308</td>
			<td>mRBP concentration</td>
		</tr>
		<tr>
			<td>Pierce Silver Stain Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>24612</td>
			<td>Silver-staining assay</td>
		</tr>
		<tr>
			<td>RNA purification kit 
			(InviTrap Spin Plant RNA Mini Kit)</td>
			<td>STRATEC Molecular</td>
			<td>1064100300</td>
			<td>RNA purification</td>
		</tr>
		<tr>
			<td>Spectrophotometer device (NanoDrop 1000 Spectrophotometer)</td>
			<td>Thermo Fisher Scientific</td>
			<td>ND-1000</td>
			<td>RNA quality and quantity</td>
		</tr>
		<tr>
			<td>Real-Time PCR cycler 
			(StepOne Real-Time PCR cycler)</td>
			<td>Thermo Fisher Scientific</td>
			<td>4376600</td>
			<td>cDNA quantification</td>
		</tr>
		<tr>
			<td>&#181;-C18 columns 
			(Millipore Zip Tip &#181;-C18 columns)</td>
			<td>Sigma-aldrich</td>
			<td>720046-960EA</td>
			<td>Peptide purification</td>
		</tr>
		<tr>
			<td>Mass spectrometer 
			(Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)</td>
			<td>Thermo Fisher Scientific</td>
			<td>IQLAAEGAAPFALGMAZR</td>
			<td>Mass spectrometry-based proteomics</td>
		</tr>
		<tr>
			<td>Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument)</td>
			<td>Thermo Fisher Scientific</td>
			<td>ULTIM3000RSLCNANO</td>
			<td>Mass spectrometry-based proteomics</td>
		</tr>
		<tr>
			<td>C18 column 
			(Easy Spray Pepmap RSLC C18 column)</td>
			<td>Thermo Fisher Scientific</td>
			<td>ES800</td>
			<td>Mass spectrometry-based proteomics</td>
		</tr>
		<tr>
			<td>C18 precolumn 
			(Acclaim Pepmap 100 C18 precolumn)</td>
			<td>Thermo Fisher Scientific</td>
			<td>160321</td>
			<td>Mass spectrometry-based proteomics</td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Primers for qRT-PCR assay</td>
			<td colspan="3">Sequences</td>
		</tr>
		<tr>
			<td>UBQ10 mRNA 
			(Li et al., 2014)</td>
			<td colspan="3">Fw: AACTTTGGTGGTTTGTGTTTTGG 
			Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA</td>
		</tr>
		<tr>
			<td>18S rRNA 
			(Durut et al., 2014)</td>
			<td colspan="3">Fw: CGTAGTTGAACCTTGGGATG 
			Rv: CACGACCCGGCCAATTA</td>
		</tr>
	</tbody>
</table>

mrna interactome capture from plant protoplasts

Las proteínas de unión a ARN (RBPs) determinan el destino de los ARNs. Participan en todas las vías de la biogénesis del ARN y contribuyen especialmente a la regulación génica post-transcripcional (PTGR) de los ARN mensajeros (mRNAs). En los últimos años, se han aislado con éxito varios proteomas unidos a ARNm a partir de líneas de células de levaduras y mamíferos mediante el uso de un nuevo método denominado &quot;captura de interactomas de mRNA&quot;, que permite la identificación de proteínas mRNA-binding (mRBPs) Directamente desde un entorno fisiológico. El método se compone de reticulación, pull-down y purificación de complejos de ribonucleoproteína mensajera (mRNPs) por bolas de oligo (dT) in vivo , y la posterior identificación de las proteínas reticuladas por espectrometría de masas (MS). Recientemente, aplicando el mismo método, se han reportado simultáneamente varios proteomas vegetales unidos a ARNm de diferentes fuentes de tejido de Arabidopsis : plántulas etioladas, tejido foliar,Protoplastos de mesófilo de hojas y células de raíces cultivadas. Aquí, presentamos el optimizado mRNA interactome método de captura de Arabidopsis thaliana hoja mesofilo protoplastos, un tipo de célula que sirve como una herramienta versátil para los experimentos que incluyen diversos ensayos celulares. Las condiciones para un rendimiento óptimo de la proteína incluyen la cantidad de tejido de partida y la duración de la irradiación UV. En el proteoma unido a ARNm obtenido a partir de un experimento de escala media (10 ^ { 7} células), se encontró que las RBP que tenían capacidad de unión a ARN estaban sobre-representadas y se identificaron muchas RBP nuevas. El experimento se puede ampliar (10 9 células), y el método optimizado se puede aplicar a otros tipos de células vegetales y especies para aislar, catalogar y comparar los proteomas unidos a mRNA en las plantas.

Se observó un halo característico, que rodea el gránulo de gránulo en la muestra de CL, en el paso de lavado 4.3 con tampón de lavado 2 ( Figura 1B ). Aunque no se ha investigado, este fenómeno puede explicarse probablemente por la interferencia de los complejos mRNP reticulados con la agregación de gránulos durante la captura magnética, causando la formación de un agregado más difuso. Indica que la captura de perlas de oligo-d (T) 25 f...

Watch this Scientific Journal Video about mRNA Interactome Capture from Plant Protoplasts at JoVE.com

mRNA Interactome Capture from Plant Protoplasts

Aquí, presentamos un protocolo de captura interactome aplicado a Arabidopsis thaliana protoplastos hoja mesófilo. Este método depende crıticamente de la reticulación UV in vivo y permite el aislamiento e identificación de proteınas de unión a mRNA de plantas desde un entorno fisiológico.

ARNm Interactome Captura de Planta Protoplastos

RNA-binding proteins (RBPs) determine the fates of RNAs. They participate in all RNA biogenesis pathways and especially contribute to post-transcriptional ...

The overall goal of this optimized mRNA interactome capture is to isolate and identify an mRNA-bound proteome from plant cells. This method is applied to arabidopsis thaliana leaf mesophil protoplasts, a cell type used as a versatile tool in various cellular assays. This method can help to answer key questions in the field of post-transcriptional gene regulation implants such as discovering and understanding the role of plant messengers RNA binding proteins.The main advantage of this technique is that it can isolate and identify a plant messenger on a bound proteome directly from the physiological environment. So this method can provide insight into the messenger RNA-bound protein from aribidopsis leaf mesophil protoplasts. It also can be applied to other systems like other plant's protoplasts or tissues.We first had the idea for this method when we noticed that it had been applied successfully to yeast and mammalian cell lines. Isolate arabidopsis leaf mesophil protoplasts for two different samples, as described in the text protocol. Keep the control sample that will not be UV crosslinked, or non-CL sample on ice.Transfer the protoplast suspension to be crosslinked, or CL-sample to a large petri dish. Add 30 milliliters of ice-cold MMG solution to the dish to cover the surface and spread the cells by gentle pipetting. Cover the petri dish with aluminum foil when transported to the UV crosslinking apparatus.Place the opened petri dish in a UV crosslinking apparatus immediately. Make sure that the distance between the dish and the UV lamp is eight centimeters and then irradiate the sample for one minute. After that, quickly aliquot the protoplast suspension from the petri dish into two new 50 milliliter round-bottom tubes.Wash the bottom of the dish with an additional five milliliters of the ice-cold MMG solution to collect the remainder of the protoplasts. Divide the suspension between the two tubes. Next, centrifuge the non-CL and two CL sample tubes at 100 times g at four degrees celsius for five minutes.After discarding the supernatant, place the tube with the non-CL pellet back on ice. Add 10 milliliters of ice-cold MMG solution to each CL sample tube and gently shake the tubes to re-suspend the pellets. After combining the two samples into one 50 milliliter round-bottom tube, centrifuge at 100 times g at four degrees celsius for five minutes.After discarding the supernatant, keep the pellet on ice. Then add nine milliliters of ice-cold lysis binding buffer to the cell pellet of each sample. Lyse the protoplasts by pipetting up and down approximately twenty times, until the solution is a homogenous light green color.For homogenization, pass the protoplast lysate two times through a 50 milliliter glass syringe with a narrow needle, and then incubate the lysate on ice for ten minutes. Freeze the samples in liquid nitrogen and store at minus 80 degrees celsius for up to three weeks. After thawing the tube with frozen protoplast lysate at room temperature, keep the tube on ice.Aliquot 1.8 milliliters of oligo-d(T)magnetic beads into six new two milliliter round-bottom micro centrifuge tubes placed on ice. Wash the bead suspension in each tube with 600 microliters of lysis binding buffer by briefly pipetting up and down and gently rotate the beads on a rotator for two minutes. Keep the beads on ice.Next, place all six tubes containing the beads into a magnetic rack for at least three minutes to allow enough time for the complete magnetic capture. When the beads are completely captured, the suspension will become clear. Then, discard the supernatant from all six tubes and immediately aliquot nine milliliters of protoplast lysate into them.Mix the beads with lysate by pipetting until the suspension appears brown and homogenous. Incubate the tubes at four degrees celsius for one hour with gentle rotation. After incubation, place the tubes back into the magnetic rack for three minutes.When all the beads are captured on the side of the tubes, collect the supernatant containing the protoplast lysate into six new two milliliter round-bottom micro centrifuge tubes. Next, add 1.5 milliliters of ice-cold wash buffer one to each tube containing beads, and resuspend the beads by pipetting. After gentle rotation for one minute, place the tubes back into the magnetic rack for three minutes.Discard the supernatant and repeat this wash step once. Using 1.5 milliliters of ice-cold wash buffer two, repeat the same washing procedure twice. If the mRNP's have been efficiently isolated from the protoplast lysate, there should be a halo visible around the bead pellet in the CL sample.Finally, repeat the washing procedure once with 1.5 milliliters of ice-cold low salt buffer. After washing, add 500 microliters of elution buffer to each tube, and gently re-suspend the beads by pipetting. Incubate at 50 degrees celsius for three minutes to release the poly-A tailed RNA's.Gently re-suspend the beads by pipetting once and place the tubes back into the magnetic rack at four degrees celsius for five minutes. Transfer and combine eluents from all six tubes into a 15 milliliter conical-bottom tube placed on ice. This will yield approximately three millimeters of the eluent.The quality and quantity of RNA can be immediately determined using a spectrophotometer. Prepare the oligo-d(T)beads to be re-used by washing them twice with one milliliter of ice-cold elution buffer. After that, wash them with one milliliter of ice-cold lysis binding buffer to adjust the salt concentration back to 500 millimolar.Use these washed oligo-d(T)beads to repeat the binding, washing, and elution procedures for an additional two rounds. This will deplete the poly-A tailed RNA's from the protoplast lysate and yield a total of nine millimeters of eluent for each sample. Beads can be stored and used for another experiment for a maximum of three times.To test the RNA for quality, digest the UV-crosslinked proteins with proteinase K solution according to the text protocol. Then, purify the RNA using the RNA purification kit to remove any residual contaminates. After purification, the samples are ready for the RNA quality test using qRT-PCR.Begin by treating eight milliliters of each sample with 100 units of RNAse cocktail containing RNAse A and RNAse T1.After brief vortexing, incubate the samples at 37 degrees celsius for one hour. To concentrate mRNA binding proteins, or mRBP's, filter the samples using centrifugal filter units. Each sample will yield 75 microliters with two micrograms of protein.For long-term storage, freeze the samples at minus 80 degrees celsius. To run an SDS-page gel, mix 25 microliters of each concentrated sample with 15 microliters of 2X loading dye and heat the samples at 95 degrees celsius for five minutes. Load the samples in a protein marker on an SDS-page gel with a five percent stacking gel and twelve percent resolving gel.Next, wash the gel twice with ultrapure water for five minutes per wash. Use a commercial silver staining kit to stain the gel. If the sufficient number of starting protoplasts has been used, the protein bands will show within five minutes.To further test the mRBP's, purify the peptides from a second 1D page gel as explained in the text protocol. These purified peptides can now be analyzed by nano reverse-phased liquid chromatography, mass spectrometry, and qualitative and quantitative proteomics. After oligo-d(T)bead capture, qRT-PCR demonstrated significantly higher levels of poly ubiquitin 10 reference mRNA versus 18S rRNA.Since oligo-d(T)beads only bind to poly-A tailed RNA, this suggests that mRNA's are enriched in the eluent. Capture of mRBP's by oligo-d(T)beads is further evaluated by a silver-stained SDS-page gel. The gel shows a significantly higher protein amount in the UV-crosslinked CL sample versus the non-crosslinked non-CL sample.The duration of UV irradiation can influence the efficiency of crosslinking. This silver-stained SDS-page gel confirms that one or three minutes of UV irradiation is the optimal condition, with the strongest band intensities. A total of 325 proteins were identified by quantitative proteomics analysis.225 of these proteins were below the significance level due to low abundant peptides present for each protein, with high variability of peptide intensities. However, because all of them were qualitatively detected only in CL samples, they were all considered positive results. These 325 proteins were further classified into three categories, Ribosomal proteins, main RBP's, and candidate RBP's.The candidate RBP's lack conventional RNA binding domains and most of their roles have not been validated, suggesting possible novel functions in RNA regulation. Once mastered, this technique can be done in one week if performed appropriately. After it's development, this technique paved the way for researchers in the field of molecular regulation pathways in plants to explore genome-wide messenger RNA-bound proteome in dicots and monocots cells and tissues.

Research

JoVE Journal

Biochemistry

Protein Complex Affinity Capture from Cryomilled Mammalian Cells

Complejo de proteínas de captura por afinidad a partir de células de mamífero Cryomilled

Affinity capture is an effective technique for isolating endogenous protein complexes for further study. When used in conjunction with an antibody, this ...

Investigación

Bioquímica

Experimental Design for Laser Microdissection RNA-Seq: Lessons from an Analysis of Maize Leaf Development

Diseño experimental para microdisección láser RNA-Seq: Lecciones de un análisis del desarrollo de la hoja de maíz

Genes with important roles in development frequently have spatially and/or temporally restricted expression patterns. Often these gene transcripts are not ...

A Simple Fractionated Extraction Method for the Comprehensive Analysis of Metabolites, Lipids, and Proteins from a Single Sample

Un método de extracción fraccionada simple para el análisis comprensivo de metabolitos, lípidos y proteínas a partir de una sola muestra

Understanding of complex biological systems requires the measurement, analysis and integration of multiple compound classes of the living cell, usually ...

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

Aislamiento y medidas respiratoria de las mitocondrias de Arabidopsis thaliana

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from ...

Leaf Spray Mass Spectrometry: A Rapid Ambient Ionization Technique to Directly Assess Metabolites from Plant Tissues

Espectrometría de masa de hoja aerosol: Una técnica rápida ionización ambiental evaluar directamente los metabolitos de los tejidos vegetales

Plants produce thousands of small molecules that are diverse in their chemical properties. Mass spectrometry (MS) is a powerful technique for analyzing ...

Caffeine Extraction, Enzymatic Activity and Gene Expression of Caffeine Synthase from Plant Cell Suspensions

Extracción de cafeína, la actividad enzimática y la expresión del gen de la sintasa de cafeína de suspensiones celulares de plantas

Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in popular drinks such as coffee and tea. This secondary metabolite is regarded as a ...

Studying Protein Import into Chloroplasts Using Protoplasts

Estudiando la importación de la proteína en cloroplastos con protoplastos

The chloroplast is an essential organelle that is responsible for various cellular processes in plants, such as photosynthesis and the production of many ...

Capture and Identification of RNA-binding Proteins by Using Click Chemistry-assisted RNA-interactome Capture (CARIC) Strategy

Capture and Identification of RNA-binding Proteins by Using Click Chemistry-assisted RNA-interactome Capture CARIC Strategy

Captura e identificación de proteínas de unión a RNA usando Click química asistida por ARN-interactoma capturan (CARIC) estrategia

A comprehensive identification of RNA-binding proteins (RBPs) is key to understanding the posttranscriptional regulatory network in cells. A widely used ...

Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale

Uso en transferencia de energía de resonancia de la fluorescencia de Vitro para el estudio de la dinámica de los complejos de la proteína en una escala de tiempo de milisegundos

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological ...

Label-Free Immunoprecipitation Mass Spectrometry Workflow for Large-scale Nuclear Interactome Profiling

Flujo de trabajo de espectrometría de masas de inmunoprecipitación sin etiquetas para la generación de perfiles de interactome nuclear a gran escala

Immunoaffinity purification mass spectrometry (IP-MS) has emerged as a robust quantitative method of identifying protein-protein interactions. This ...