Name: assay development for high content quantification of sod1 mutant protein aggregate formation in living cells
Uploaded: 2017-10-04T12:15:00
Description: Watch this Scientific Journal Video about Assay Development for High Content Quantification of Sod1 Mutant Protein Aggregate Formation in Living Cells at JoVE.com

Dette arbeidet ble støttet av en bevilgning finansiert av koreanske regjeringen (MSIP) (NRF-2014K1A4A7A01074642) og National Research Foundation av Korea (NRF) personlige forsker støtteprogrammet (NRF-2013M3A9B5076486/NRF-2015R1D1A1A09057239).

1. lentivirus produksjon Merk: produksjon og manipulering av lentiviral vektorer ble gjennomført i henhold til National Institutes of Health (NIH) retningslinjer for forskning innvolvere rekombinant DNA. Plasmider kodingen av vill-type og A4V mutant SOD1 merket med forbedret YFP (SOD1WT-YFP og SOD1A4V-YFP) er beskrevet i Kim et al. 11 begge genet fusion produktene ble forsterket bruker PCR primer paret 5 &#8242; - ATCGTCTAGACACCATGGCGACGAAGGTCGTGTGC - 3 &#824...

<ol>
	<li>Schulte, J., Sepp, K. J., Wu, C., Hong, P., Littleton, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-content+chemical+and+rnai+screens+for+suppressors+of+neurotoxicity+in+a+huntington's+disease+model.">High-content chemical and rnai screens for suppressors of neurotoxicity in a huntington's disease model.</a> PLoS ONE. 6 (8), e23841 (2011).</li><li>Honarnejad, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+implementation+of+a+high-throughput+compound+screening+assay+for+targeting+disrupted+ER+calcium+homeostasis+in+Alzheimer's+disease.">Development and implementation of a high-throughput compound screening assay for targeting disrupted ER calcium homeostasis in Alzheimer's disease.</a> PLoS ONE. 8 (11), 1-12 (2013).</li><li>Burkhardt, M. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cellular+model+for+sporadic+ALS+using+patient-derived+induced+pluripotent+stem+cells.">A cellular model for sporadic ALS using patient-derived induced pluripotent stem cells.</a> Mol Cell Neurosci. 56, 355-364 (2013).</li><li>Mattiazzi, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-Content+Screening+for+Quantitative+Cell+Biology.">High-Content Screening for Quantitative Cell Biology.</a> Trends Cell Biol. 26 (8), 598-611 (2016).</li><li>Kato, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amyotrophic+lateral+sclerosis+models+and+human+neuropathology:+Similarities+and+differences.">Amyotrophic lateral sclerosis models and human neuropathology: Similarities and differences.</a> Acta Neuropathologica. 115 (1), 97-114 (2008).</li><li>Strong, M. J., Kesavapany, S., Pant, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+pathobiology+of+amyotrophic+lateral+sclerosis:+a+proteinopathy?.">The pathobiology of amyotrophic lateral sclerosis: a proteinopathy?.</a> J neuropathol exp neurol. 64 (8), 649-664 (2005).</li><li>Cleveland, D. W., Rothstein, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+Charcot+to+Lou+Gehrig:+deciphering+selective+motor+neuron+death+in+ALS.">From Charcot to Lou Gehrig: deciphering selective motor neuron death in ALS.</a> Nat rev Neurosci. 2 (11), 806-819 (2001).</li><li>Bruijn, L. I., Miller, T. M., Cleveland, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unraveling+the+Mechanisms+Involved+in+Motor+Neuron+Degeneration+in+Als.">Unraveling the Mechanisms Involved in Motor Neuron Degeneration in Als.</a> Annu Rev Neurosci. 27 (1), 723-749 (2004).</li><li>Vassall, K. a., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decreased+stability+and+increased+formation+of+soluble+aggregates+by+immature+superoxide+dismutase+do+not+account+for+disease+severity+in+ALS.">Decreased stability and increased formation of soluble aggregates by immature superoxide dismutase do not account for disease severity in ALS.</a> Proc Natl Acad Sci USA. 108 (6), 2210-2215 (2011).</li><li>Hwang, Y. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonamyloid+aggregates+arising+from+mature+copper/zinc+superoxide+dismutases+resemble+those+observed+in+amyotrophic+lateral+sclerosis.">Nonamyloid aggregates arising from mature copper/zinc superoxide dismutases resemble those observed in amyotrophic lateral sclerosis.</a> J Biol Chem. 285 (53), 41701-41711 (2010).</li><li>Kim, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimerization,+Oligomerization,+and+Aggregation+of+Human+Amyotrophic+Lateral+Sclerosis+Copper/Zinc+Superoxide+Dismutase+1+Protein+Mutant+Forms+in+Live+Cells.">Dimerization, Oligomerization, and Aggregation of Human Amyotrophic Lateral Sclerosis Copper/Zinc Superoxide Dismutase 1 Protein Mutant Forms in Live Cells.</a> J Biol Chem. 289 (21), 15094-15103 (2014).</li><li>Shaw, B. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detergent-insoluble+aggregates+associated+with+amyotrophic+lateral+sclerosis+in+transgenic+mice+contain+primarily+full-length,+unmodified+superoxide+dismutase-1.">Detergent-insoluble aggregates associated with amyotrophic lateral sclerosis in transgenic mice contain primarily full-length, unmodified superoxide dismutase-1.</a> J Biol Chem. 283 (13), 8340-8350 (2008).</li><li>Banci, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SOD1+and+amyotrophic+lateral+sclerosis:+Mutations+and+oligomerization.">SOD1 and amyotrophic lateral sclerosis: Mutations and oligomerization.</a> PLoS ONE. 3 (2), 1-8 (2008).</li><li>Johnston, J. a., Dalton, M. J., Gurney, M. E., Kopito, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formation+of+high+molecular+weight+complexes+of+mutant+Cu,+Zn-superoxide+dismutase+in+a+mouse+model+for+familial+amyotrophic+lateral+sclerosis.">Formation of high molecular weight complexes of mutant Cu, Zn-superoxide dismutase in a mouse model for familial amyotrophic lateral sclerosis.</a> Proc Natl Acad Sci. 97 (23), 12571-12576 (2000).</li><li>Niwa, J. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disulfide+bond+mediates+aggregation,+toxicity,+and+ubiquitylation+of+familial+amyotrophic+lateral+sclerosis-linked+mutant+SOD1.">Disulfide bond mediates aggregation, toxicity, and ubiquitylation of familial amyotrophic lateral sclerosis-linked mutant SOD1.</a> J Biol Chem. 282 (38), 28087-28095 (2007).</li><li>Juneja, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prognosis+in+familial+amyotrophic+lateral+sclerosis:+progression+and+survival+in+patients+with+glu100gly+and+ala4val+mutations+in+Cu,Zn+superoxide+dismutase.">Prognosis in familial amyotrophic lateral sclerosis: progression and survival in patients with glu100gly and ala4val mutations in Cu,Zn superoxide dismutase.</a> Neurology. 48 (1), 55-57 (1997).</li><li>Kaur, S. J., McKeown, S. R., Rashid, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutant+SOD1+mediated+pathogenesis+of+Amyotrophic+Lateral+Sclerosis.">Mutant SOD1 mediated pathogenesis of Amyotrophic Lateral Sclerosis.</a> Gene. 577 (2), 109-118 (2016).</li><li>de Bruyns, A., Geiling, B., Dankort, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Modular+Lentiviral+Vectors+for+Effective+Gene+Expression+and+Knockdown.">Construction of Modular Lentiviral Vectors for Effective Gene Expression and Knockdown.</a> Methods Mol Biol. 1448, 3-21 (2016).</li><li>Sirven, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+Transgene+Expression+in+Cord+Blood+CD34+-Derived+Hematopoietic+Cells,+Including+Developing+T+Cells+and+NOD/SCID+Mouse+Repopulating+Cells,+Following+Transduction+with+Modified+TRIP+Lentiviral+Vectors.">Enhanced Transgene Expression in Cord Blood CD34+-Derived Hematopoietic Cells, Including Developing T Cells and NOD/SCID Mouse Repopulating Cells, Following Transduction with Modified TRIP Lentiviral Vectors.</a> Mol Ther. 3 (4), 438-448 (2001).</li><li>Wu, C., Lu, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-titre+retroviral+vector+system+for+efficient+gene+delivery+into+human+and+mouse+cells+of+haematopoietic+and+lymphocytic+lineages.">High-titre retroviral vector system for efficient gene delivery into human and mouse cells of haematopoietic and lymphocytic lineages.</a> J gen virol. 91 (Pt 8), 1909-1918 (2010).</li><li>Irshad, H., Veillard, A., Roux, L., Racoceanu, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+for+nuclei+detection,+segmentation,+and+classification+in+digital+histopathology:+A+review-current+status+and+future+potential.">Methods for nuclei detection, segmentation, and classification in digital histopathology: A review-current status and future potential.</a> IEEE Rev Biomed Eng. 7, 97-114 (2014).</li><li>Purschke, M., Rubio, N., Held, K. D., Redmond, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phototoxicity+of+Hoechst+33342+in+time-lapse+fluorescence+microscopy.">Phototoxicity of Hoechst 33342 in time-lapse fluorescence microscopy.</a> Photochem Photobiol Sci. 9 (12), 1634-1639 (2010).</li><li>Jaskova, K., Pavlovicova, M., Jurkovicova, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+transporters+and+their+role+in+the+development+of+neuronal+disease+and+neuronal+damage.">Calcium transporters and their role in the development of neuronal disease and neuronal damage.</a> Gen physiol biophys. 31 (4), 375-382 (2012).</li><li>Kieran, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Treatment+with+arimoclomol,+a+coinducer+of+heat+shock+proteins,+delays+disease+progression+in+ALS+mice.">Treatment with arimoclomol, a coinducer of heat shock proteins, delays disease progression in ALS mice.</a> Nat Med. 10 (4), 402-405 (2004).</li></ol>

Det er to hovedfremgangsmåter for å generere stabil linjer. Først tar flere uker og krever forbigående transfection og motstand utvalg av genomisk integrert plasmider DNA vektorer. Andre tar noen timer ved hjelp av lentivirus, gjør denne protokollen mottakelig for effektiv uttrykket målet protein i flere linjer med begrenset innsats. TUR-CMV vektor19 var en vedvarende vektor å bruke, med bevarte signaltransduksjon effektivitet og stabil transgene uttrykk. Til vår overraskelse viste de tre ...

Protein samling er en biologisk prosess som misfolded proteiner gruppe opp og kan fungere som forårsaker agenter i nevrodegenerative sykdommer (amyloidose). Karakterisere protein samling er viktig i forståelsen av mengdefunksjoner i mobilnettet dysfunction så vel som lette oppdagelsen av nye faktorer som påvirker utbruddet av patologi. Visualisering av fluorescens-merket proteiner i levende celler er en kraftig metode som kan hjelpe til i utviklingen av analyser gjelder for høyt innhold screening (HCS)1,2,3,4.
Amyotrofisk lateral sklerose (ALS) regnes som en proteopathic sykdom forårsaket av tilstedeværelsen av misfolded proteiner med tilbøyelighet til å samle og akkumuleres i motoriske nerveceller i både familiær ALS (fALS) og sporadiske ALS (sALS)5,6 . Et delsett av ~ 20% av fALS tilfeller er forbundet med dominerende mutasjoner i genet koding cytosolic antioksidant enzymet kobber-sink superoxide dismutase type 1 (SOD1)7,8. Flere mulige årsaker til denne genetisk avledede dysfunksjon er foreslått, inkludert endringer i strukturen og funksjonen SOD1 varianter som avvikende stabilitet, økt unfolding rente og tilbøyelighet til samlet9, 10. Spesielt den eneste bekreftede og potensielt giftig egenskapen delt av begge ALS knyttet SOD1 varianter og vill-type (WT) SOD1 er en økt tilbøyelighet til compartmentalized protein tilslag eller proteinaceous Inneslutninger11,12 . Misfolded mutant SOD1, er vedvarende polyubiquitinated og ved ubiquitin-proteasome systemet. Som et resultat, fører et lavt nivå av hemming av proteasome aktivitet til opphopning av mutant SOD1 samler13,14, som skjemaet amorfe strukturer består av løselig komponenter som kan utveksle med løselig mutant SOD1 i stoffer15. I spesielt SOD1 mutant A4V (alanin på codon 4 endret til Valin) er den vanligste ALS-forårsaker mutasjonen, og fører til rask neurodegeneration med en gjennomsnittlig overlevelse tid på mindre enn 2 år etter sykdommen utbruddet16. Biokjemisk, har SOD1 A4V økt tendens til monomerize, samle og danne amyloid porene; sine pore-lignende aggregater er like amyloid porene i andre sykdom knyttet mutant skjemaer, for eksempel α-synuclein og β-amyloid protein17. For å studere dynamikken i SOD1-samlet akkumulering, gjenstår metoder for å kartlegge løselig og uløselig SOD1 samlet skjemaer å bli utviklet.
Vi har tidligere vist, med live-celle imaging og HEK-293 celler transfekterte transiently med fluorescerende protein-merket SOD1, at ALS-assosiert mutasjoner svekke SOD1 dimerization og aggregering11. Selv om forbigående uttrykk systemer kan gi nyttig informasjon om biologiske utfallet av kortsiktige genet overuttrykte, kan metoder gir stabil integrering av ønsket gener bli foretrukket for analysen utvikling. Slik tilbud lentiviral vektorer evnen å konferere langsiktig og regulert genuttrykk pattedyrceller 18. I denne studien vi fokusert på generering av stabil cellelinjer transduced med rekombinant lentivirus bærer WT og mutant SOD1 merket med gult fluorescerende protein (YFP). Bruke live-celle tenkelig mikroskopi og automatisert kvantifisering av SOD1 aggregering, vi utløses og kvantifisert SOD1 aggregering hendelser på hemming av proteasome.

<table>
	<tbody>
		<tr>
			<td>ALLN (C20H37N3O4)</td>
			<td>Millipore</td>
			<td>208719</td>
			<td></td>
		</tr>
		<tr>
			<td>MG132 (C26H41N3O5)</td>
			<td>Sigma-Aldrich</td>
			<td>C2211</td>
			<td></td>
		</tr>
		<tr>
			<td>Epoxomicin (C28H50N4O7)</td>
			<td>Sigma-Aldrich</td>
			<td>E3652</td>
			<td></td>
		</tr>
		<tr>
			<td>Hoechst 33342</td>
			<td>Invitrogen</td>
			<td>H-3570</td>
			<td></td>
		</tr>
		<tr>
			<td>Opera</td>
			<td>Perkin Elmer</td>
			<td>OP-QEHS-01</td>
			<td></td>
		</tr>
		<tr>
			<td>Opera EvoShell software</td>
			<td>Perkin Elmer</td>
			<td>Ver 1.8.1</td>
			<td></td>
		</tr>
		<tr>
			<td>Operetta</td>
			<td>Perkin Elmer</td>
			<td>OPRT1288</td>
			<td></td>
		</tr>
		<tr>
			<td>Harmony Imaging software</td>
			<td>Perkin Elmer</td>
			<td>Ver 3.0.0</td>
			<td></td>
		</tr>
		<tr>
			<td>Columbus Image analysis software</td>
			<td>Perkin Elmer</td>
			<td>Ver 2.3.2</td>
			<td></td>
		</tr>
		<tr>
			<td>CyBi Hummingwell liquid handling</td>
			<td>CyBio AG</td>
			<td>OL 3387 3 0110</td>
			<td></td>
		</tr>
	</tbody>
</table>

assay development for high content quantification of sod1 mutant protein aggregate formation in living cells

Amyotrofisk lateral sklerose (ALS) er en dødelig nevrodegenerative sykdommer som kan være forårsaket av arvede mutasjoner i genet koding kobber-sink superoxide dismutase 1 (SOD1). Strukturelle ustabilitet i SOD1 og gjenkjennelse av SOD1-positive Inneslutninger i familiær-ALS pasienter støtter en potensiell kausale rolle for misfolded og/eller samlede SOD1 i ALS patologi. I denne studien beskrive vi utviklingen av et cellebasert analysen designet å kvantifisere dynamikken i SOD1 samling i levende celler av høyt innhold screening tilnærminger. Bruker lentiviral vektorer, generert vi stabil cellelinjer uttrykker vill-type og mutant A4V SOD1 merket med gult fluorescerende protein og fant at begge proteiner ble uttrykt i stoffer uten noen tegn på aggregering. Interessant, bare SOD1 A4V uttrykt stabilt i HEK-293, men i U2OS eller SH-SY5Y cellelinjer, dannet ikke tilslag på proteasome hemmer behandling. Vi viser at det er mulig å kvantifisere aggregering basert på dose-respons analyse av ulike proteasome hemmere, og å spore samlet-formasjon kinetics ved time-lapse mikroskopi. Vår tilnærming introduserer muligheten for å kvantifisere effekten av ALS mutasjoner rollen av SOD1 i samlet formasjonen samt screening for små molekyler som hindrer SOD1 A4V aggregering.

Generere stabil celle linje med lentivirus: Den generelle strategien for overvåking SOD1 protein aggregater er illustrert i figur 1. I et første skritt genereres vi en lentiviral uttrykk vektor SOD1 stabile gen levering til linjer (trinn 1). To lentiviral vektorer koding YFP-merket SOD1 WT og SOD1 A4V (SOD1WT-YFP og SOD1A4V-YFP, henholdsvis) med pakking og konvolutt plasmider var forberedt (figur 2A). På lenti...

Watch this Scientific Journal Video about Assay Development for High Content Quantification of Sod1 Mutant Protein Aggregate Formation in Living Cells at JoVE.com

Assay Development for High Content Quantification of Sod1 Mutant Protein Aggregate Formation in Living Cells

Vi beskriver en metode for å kvantifisere aggregering av misfolded proteiner. Våre protokollen detaljer lentiviral indusert stabil linje generasjon, automatisert AC confocal imaging og bildeanalyse av protein aggregater. Som en illustrasjon program studerte vi effekten av små molekyler å fremme SOD1 samling i en tid - og doseavhengig måte.

Analysen utvikling for høy innhold kvantifisering av Sod1 Mutant Protein samlet formasjon i levende celler

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease that can be caused by inherited mutations in the gene encoding copper-zinc ...

The overall goal of this experiment is to develop an assay for studying the effect of small molecules in modulating the aggregation of misfolded proteins in a time and dose dependent manner. This method can help answer the key questions for development of cellular assay, and it's use is for high-content screening techniques. The main advantage of this technique is to provide a simple method to detect and quantify protein aggregation occurring in several neurodegenerative disorders.The implication of this technique extends towards potential therapy of neurodegenerative diseases, such as ALS, because it proposes a simple method that allow to develop cellular assay and perform screening for small molecule moderators. To start virus production, prior to plasmid transfection split HEK-293 T-cells at 30 to 40%confluence in a 10 centimeter tissue culture dish and 10 milliliters of cell culture medium. Incubate the culture plate in a 5%carbon dioxide incubator at 37 degrees Celsius overnight.On the following day, prepare DNA transfection solution with packaging plasmids lentiviral vector, 125 microliters of one molar calcium chloride and add distilled water to adjust the volume to 500 microliters. Gently add 500 microliters of 0.05 molar HEPS buffer and incubate for 10 minutes at room temperature. After that, replace HEK-293 T-cell medium with 10 milliliters pre-warmed antibiotic-free fresh culture medium mixed with one milliliter of DNA transfection solution.Incubate at 37 degrees Celsius and 5%carbon dioxide incubator over night. Replace cell supernatent with fresh culture medium on the following day and incubate again overnight. Finally, on the following day harvest the supernatent and transfer to a 15 milliliter tube.To remove the dead cells and debris, centrifuge the tube at 500 times g for five minutes. To further purify the supernatent, pass it through a 0.45 micrometer filter using a 60-milliliter syringe. Then, immediately dispense the filtered supernatent into 300-microliter single use aliquots.To prepare the cells for transduction, split them to be infected at 60%confluence in a six-well tissue culture plate in two milliliters of DMAM supplemented with 10%FBS. Incubate the cells in a 37-degree Celsius incubator at 5%carbon dioxide overnight. On the following day, thaw one aliquot of the frozen lentivirus on ice for each use.Meanwhile, warm the cell culture medium containing the serum compatible with the cell line of interest. Once the virus is fully thawed, dilute it in DMEM in new 1.5 milliliter micro-centrifuge tubes. Then adjust the volume to one milliliter with reduced serum medium.Next, add two microliters of polybrene to one milliliter of virus per medium and mix well by pipetting. Add one milliliter of this mixture to the cells and incubate at 37 degrees Celsius for 24 hours. After incubation, remove the virus containing medium and replace it with normal DMEM supplemented with 10%FBS and return the cells to the incubator.Monitor the cell growth and change the medium every two days When the cells reach confluence, expand each well of the six-well dish into a 10-centimeter tissue culture plate. Move the plates to the incubator. Finally, save 1.5 times 10 to the 4th cells per well and 50 microliters of DMEM on 384 well assay plates.Then check the expression level of the YFP-tagged protein under the microscope. If the expression shows signal-to-noise ratio equal or greater than three, prepare cell stock for the corresponding cell line. For the compound transfer, on a 384-well storage polypropylene plate, add serial dilutions of compounds by the standard one to three dilution series.Then, using a liquid handler equipped with a 384-capillary head, distribute 0.25 microliters of proteasome inhibitors on empty, flat-bottomed black 384-well assay plates. Then seed 1.5 times 10 to the 4th cells on these plates. Incubate at 37 degrees Celsius and 5%carbon dioxide for 24 hours.Prior to imaging the cell line treated with proteasome inhibitors, add 10 microliters of pre-warmed DMEM with staining solution and incubate at room temperature for 10 minutes. After staining, start the automated microscope operating software by selecting the microscope tab. First, select the configuration tab and then select 20 times objective in the correct plate type.To allow proper focus with different plate types, make sure that the caller is set to the correct value on the objective. Next, select exposure one. Set focus height to zero micrometers, then select focus.Once it is focused, expose camera one. To optimize the exposure plane, adjust the focus height and click on take height. Change exposure times and laser power for a maximum pixel intensity of approximately 3000 and save exposure parameters.Select experiment definition tab, create a layout and sublayout. Next, drag and drop the relevant layout exposure, reference image, skew crop file, and sublayout. Then, save the experiment.Finally, select automatic experiment tab and acquire images. For two-channel images, first select the software algorithm to segment the primary objects, such as nuclei, cytosol, and aggregates. First, distribute 0.25 microliters of proteasome inhibitor dissolved in 100%DMSO or DMSO on 384-well flat-bottomed plates.On the same plate, manually seed 1.5 times 10 to the 4th cells per well in 50-microliters of DMEM. Then set up the microscope system environmental control unit to 37 degrees Celsius and 5%carbon dioxide. Operate the microscope in wide-field florescence mode and as software settings, choose LWD 20 times objective non-confocal mode, four fields per well, and capture interval of one hour.Then, select the appropriate algorithm to segment the primary object such as cytosol and aggregates. Adjust background threshold and contrast parameters if required. The tested cell lines transduced with SOD-1 wild type and SOD-1 A4V mutant remained healthy, showed high expression levels, and longterm wide phi-labeling irrespective of the SOD form.Treatment with proteasome inhibitor ALLN for 24 hours promoted the accumulation of SOD-1 A4V YFP aggregates in HEK-293 cells but not in SOD-1 Wild Type YFP transduced cells. Furthermore, there were very low levels of aggregation in U2 OS and SH-SY5Y cell lines SOD-1 A4V YFP transduced with the same vectors. After seeding the cells in the presence or absence of ALLN, they were monitored for aggregate formation for a period of 50 hours.ALLN aggregate formation reached a plateau at 24 hours and remained stable over the next 12 hours. Furthermore, cell density significantly decreased after 28 hours as a result of the cytotoxic effect of ALLN, while cell number increased in the DMSO-treated negative control. SOD-1 A4V YFP cells cultured in the presence of proteasome inhibitors for 24 hours were stained with Hoechst solution.The relative toxicity for three different proteasome inhibitors was quatified by measuring the number of adherent cell lines remaining in the well labeled with Hoechst dye. The total cell number decreased in response to increased dose of protease inhibitors. Inversely, the percentage of cells expressing SOD-1 A4V aggregates increased with the concentration of protease inhibitor.When doing this process it is important to remember that the cell quality will drastically influence your result. So it's important to determine that the cells are microplasma free and are healthy all along the steps. Following this process, another imaging method can be used in order to answer additional questions regarding the degradation of protein or the interaction of the protein with others using resonance energy transfer.After watching this video, you should have a good understanding of how to generate the tools to test the fate of protein in multiple living cells using high-content image analysis. So this method can provide insight into protein aggregation as it occurs in simple cellular models. It can also be applied to other systems such as neuron differentiated from patient specific induced pluripotent stem cells.

Research

JoVE Journal

Neuroscience

High Sensitivity 5-hydroxymethylcytosine Detection in Balb/C Brain Tissue

DNA hydroxymethylation is a long known modification of DNA, but has recently become a focus in epigenetic research.   Mammalian DNA is enzymatically ...

Preparation of Living Isolated Vertebrate Photoreceptor Cells for Fluorescence Imaging

In the vertebrate retina, phototransduction, the conversion of light to an electrical signal, is carried out by the rod and cone photoreceptor cells1-4.  ...

A Quantitative Cell Migration Assay for Murine Enteric Neural Progenitors

En kvantitativ Cell Migration analysen for Murine resistente Neural stamceller

Neural crest cells (NCC) are a transient and multipotent cell population that originates from the dorsal neural tube and migrates extensively throughout ...

A High Content Imaging Assay for Identification of Botulinum Neurotoxin Inhibitors

Et høyt innhold Imaging Assay for Identifisering av botulinumneurotoksin hemmere

Synaptosomal-associated protein-25 (SNAP-25) is a component of the soluble NSF attachment protein receptor (SNARE) complex that is essential for synaptic ...

Straightforward Assay for Quantification of Social Avoidance in Drosophila melanogaster

Straightforward Assay for Quantification of Social Avoidance in Drosophila melanogaster

Enkel analyse for Kvantifisering av Social Avhold i<em&gt; Drosophila melanogaster</em

Drosophila melanogaster is an emerging model to study different aspects of social interactions. For example, flies avoid areas previously occupied by ...

High-resolution Quantification of Odor-guided Behavior in Drosophila melanogaster Using the Flywalk Paradigm

High-resolution Quantification of Odor-guided Behavior in Drosophila melanogaster Using the Flywalk Paradigm

Høyoppløselig Kvantifisering av Lukt styrt Atferd<em&gt; Drosophila melanogaster</em&gt; Bruke<em&gt; Flywalk</em&gt; Paradigm

In their natural environment, insects such as the vinegar fly Drosophila melanogaster are bombarded with a huge amount of chemically distinct odorants. To ...

Novel Assay for Cold Nociception in Drosophila Larvae

Novel Assay for Cold Nociception in Drosophila Larvae

Novel analyse for Cold nociception i<em&gt; Drosophila</em&gt; Larver

How organisms sense and respond to noxious temperatures is still poorly understood. Further, the mechanisms underlying sensitization of the sensory ...

High-throughput Analysis of Locomotor Behavior in the Drosophila Island Assay

High-throughput Analysis of Locomotor Behavior in the Drosophila Island Assay

Høy gjennomstrømming analyse av Locomotor atferd i Drosophila øya analysen

Advances in next-generation sequencing technologies contribute to the identification of (candidate) disease genes for movement disorders and other ...

High-resolution Confocal Imaging of the Blood-brain Barrier: Imaging, 3D Reconstruction, and Quantification of Transcytosis

Høyoppløselig AC Confocal avbildning av blod - hjerne barrieren: bildebehandling, 3D rekonstruksjon og kvantifisering av Transcytosis

The blood-brain barrier (BBB) is a dynamic multicellular interface that regulates the transport of molecules between the circulation and the brain. ...

A Temperature Gradient Assay to Determine Thermal Preferences of Drosophila Larvae

A Temperature Gradient Assay to Determine Thermal Preferences of Drosophila Larvae

En temperaturgradient analysen å bestemme termisk preferanser Drosophila larver

Many animals, including the fruit fly, Drosophila melanogaster, are capable of discriminating minute differences in&#160;environmental temperature, which ...