Name: generation of discriminative human monoclonal antibodies from rare antigen-specific b cells circulating in blood
Uploaded: 2018-02-06T14:00:00
Description: Watch this Scientific Journal Video about Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood at JoVE.com

Nous remercions la Cytometry Facility « CytoCell » (SFR Santé, Biogenouest, Nantes) d’assistance technique d’experts. Nous remercions également tout le personnel de production de protéines recombinantes (P2R) et des plates-formes des IMPACT (INSERM 1232, Santé SFR, Biogenouest, Nantes) pour leur soutien technique. Nous remercions Emmanuel Scotet et Richard Breathnach pour des commentaires constructifs sur le manuscrit. Ce travail a été soutenu financièrement par le projet IHU-Cesti, financé par le gouvernement Français « Investissements d’avenir », géré par l’Agence Français de la recherche nationale (ANR) (ANR-10-IBHU-005). Le projet IHU-Cesti est également pris en charge par Nantes Métropole et la Région Pays de la Loire. Ce travail a été réalisé dans le cadre du programme IGO LabEX pris en charge par l’Agence nationale de la recherche par l’intermédiaire de l’investissement du futur programme ANR-11-LABX-0016-01.

Tous les échantillons de sang périphérique humain proviennent de donneurs adultes anonymes après consentement éclairé, selon le Comité d’éthique local (Etablissement Français du Sang, EFS, Nantes, procédure PLER NTS-2016-08).
1. isolement des cellules mononucléaires de sang périphérique humain
Remarque : Matériel de départ peut être du sang périphérique humain total ou échantillons de cytaphérèse. Échantillons ne soient pas plus de 8 h et comp...

<ol>
	<li>Buss, N. A., Henderson, S. J., McFarlane, M., Shenton, J. M., de Haan, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibody+therapeutics:+history+and+future.">Monoclonal antibody therapeutics: history and future.</a> Curr Opin Pharmacol. 12 (5), 615-622 (2012).</li><li>Park, J., Kwon, M., Shin, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+checkpoint+inhibitors+for+cancer+treatment.">Immune checkpoint inhibitors for cancer treatment.</a> Arch Pharm Res. 39 (11), 1577-1587 (2016).</li><li>Pendley, C., Schantz, A., Wagner, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunogenicity+of+therapeutic+monoclonal+antibodies.">Immunogenicity of therapeutic monoclonal antibodies.</a> Curr Opin Mol Ther. 5 (2), 172-179 (2003).</li><li>Kwakkenbos, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+stable+monoclonal+antibody-producing+B+cell+receptor-positive+human+memory+B+cells+by+genetic+programming.">Generation of stable monoclonal antibody-producing B cell receptor-positive human memory B cells by genetic programming.</a> Nat Med. 16 (1), 123-128 (2010).</li><li>Tiller, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+generation+of+monoclonal+antibodies+from+single+human+B+cells+by+single+cell+RT-PCR+and+expression+vector+cloning.">Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning.</a> J Immunol Methods. 329 (1-2), 112-124 (2008).</li><li>Franz, B., May, K. F., Dranoff, G., Wucherpfennig, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ex+vivo+characterization+and+isolation+of+rare+memory+B+cells+with+antigen+tetramers.">Ex vivo characterization and isolation of rare memory B cells with antigen tetramers.</a> Blood. 118 (2), 348-357 (2011).</li><li>Morris, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+a+human+anti-HIV+gp41+membrane+proximal+region+neutralizing+antibody+by+antigen-specific+single+B+cell+sorting.">Isolation of a human anti-HIV gp41 membrane proximal region neutralizing antibody by antigen-specific single B cell sorting.</a> PLoS One. 6 (9), e23532 (2011).</li><li>Iizuka, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+cytomegalovirus+(CMV)pp65+antigen-specific+human+monoclonal+antibodies+using+single+B+cell-based+antibody+gene+cloning+from+melanoma+patients.">Identification of cytomegalovirus (CMV)pp65 antigen-specific human monoclonal antibodies using single B cell-based antibody gene cloning from melanoma patients.</a> Immunol Lett. 135 (1-2), 64-73 (2011).</li><li>Ouisse, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigen-specific+single+B+cell+sorting+and+expression-cloning+from+immunoglobulin+humanized+rats:+a+rapid+and+versatile+method+for+the+generation+of+high+affinity+and+discriminative+human+monoclonal+antibodies.">Antigen-specific single B cell sorting and expression-cloning from immunoglobulin humanized rats: a rapid and versatile method for the generation of high affinity and discriminative human monoclonal antibodies.</a> BMC Biotechnol. 17 (1), 3 (2017).</li><li>Kerkman, P. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterisation+of+citrullinated+antigen-specific+B+cells+in+peripheral+blood+of+patients+with+rheumatoid+arthritis.">Identification and characterisation of citrullinated antigen-specific B cells in peripheral blood of patients with rheumatoid arthritis.</a> Ann Rheum Dis. , (2015).</li><li>Hamilton, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+Approach+for+Tetramer-Based+Identification+of+Autoantigen-Reactive+B+Cells:+Characterization+of+La-+and+snRNP-Reactive+B+Cells+in+Autoimmune+BXD2+Mice.">General Approach for Tetramer-Based Identification of Autoantigen-Reactive B Cells: Characterization of La- and snRNP-Reactive B Cells in Autoimmune BXD2 Mice.</a> J Immunol. 194 (10), 5022-5034 (2015).</li><li>Sanjuan Nandin, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+in+vitro+booster+vaccination+to+rapidly+generate+antigen-specific+human+monoclonal+antibodies.">Novel in vitro booster vaccination to rapidly generate antigen-specific human monoclonal antibodies.</a> J Exp Med. , (2017).</li><li>Bowers, P. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+cell+display+for+the+discovery+and+optimization+of+antibody+therapeutics.">Mammalian cell display for the discovery and optimization of antibody therapeutics.</a> Methods. 65 (1), 44-56 (2014).</li></ol>

Le projet de protocole est une méthode puissante pour la production d’ACM humains directement à partir de cellules spécifiques Ag B circulant dans le sang. Il combine trois aspects importants : (i) l’utilisation d’un enrichissement magnétique tétramère-associés, qui permet une isolation ex vivo des cellules de B de liaison Ag même rares ; (ii) une stratégie de blocage qui utilise trois tétramères Ag (deux des plus pertinentes et un non pertinent) étiquetés avec trois fluorochromes différent...

An erratum was issued for: <a href="https://www.jove.com/video/56508/generation-discriminative-human-monoclonal-antibodies-from-rare">Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood</a>.
The Affiliations section was corrected from:
Marie-Claire Devilder1,2,&#160;M&#233;linda Moyon1,2,&#160;Xavier Saulquin1, Laetitia Gautreau-Rolland1 
1Centre R&#233;gional de Recherche en Canc&#233;rologie et Immunologie Nantes/Angers, INSERM 1232, LabEx IGO, Universit&#233; de Nantes 
2CHU Nantes
to:
Marie-Claire Devilder1,2,3,&#160;M&#233;linda Moyon1,2,3,&#160;Xavier Saulquin1,2, Laetitia Gautreau-Rolland1,2&#160; 
1CRCINA, Inserm, CNRS, Universit&#233; d&#39;Angers, Universit&#233; de Nantes 
2LabEx IGO, &#34;Immunotherapy, Graft, Oncology&#34; 
3CHU, Nantes, France

An erratum was issued for: <a href="https://www.jove.com/video/56508/generation-discriminative-human-monoclonal-antibodies-from-rare">Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood</a>

Erratum: Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

La méthode décrite ici permet la production rapide et versatile de pleinement humains anticorps monoclonaux (ACM) contre un antigène désiré (Ag). mAbs sont des outils essentiels dans beaucoup de demandes de recherche fondamentale in vitro et in vivo: flow cytometry, histologie, expériences western-blot et blocage par exemple. En outre, mAbs sont utilisés plus en médecine pour traiter les maladies auto-immunes, cancer et de contrôler le rejet de greffe1. Par exemple, ACM anti-CTLA-4 et anti-PD-1 (ou anti-PD-L1) ont été récemment utilisés comme inhibiteurs de point de contrôle immunitaire cancer traitements2.
Le mAbs première ont été produit par les immunoglobulines (Ig)-sécrétant des hybridomes obtenus des cellules spléniques de souris immunisées ou de rats. Cependant, la forte réponse immunitaire contre ACM murin ou rat entrave leur utilisation thérapeutique chez l’humain, en raison de leur apurement rapide et l’induction probable d’hypersensibilité réactions3. Pour résoudre ce problème, des séquences de protéines animales du mAbs ont été partiellement remplacées par humain pour produire ce qu’on appelle anticorps chimériques de souris-humain ou humanisés. Toutefois, cette stratégie ne diminue que partiellement immunogénicité, tout en augmentant considérablement le coût et les délais de production. Une meilleure solution consiste à générer le mAbs humaine directement à partir de cellules B humaines et il existe plusieurs stratégies pour cela. L’un d’eux est l’utilisation de l’affichage bactériophage ou de la levure. Cela implique l’affichage variables domaines auprès d’une bibliothèque combinatoire d’aléatoire Ig humaine lourde et des chaînes de lumière sur les phages ou levures et effectuer une étape de sélection à l’aide de l’antigène spécifique d’intérêt. Un inconvénient majeur de cette stratégie est que les chaînes lourdes et légères sont aléatoirement associés, conduisant à une augmentation très importante de la diversité des anticorps générés. Les anticorps obtenus ne devraient pas correspondent à celles qu’induirait une réponse immunitaire naturelle contre une Ag particulier. En outre, le repliement des protéines humaines et modifications post-traductionnelles ne sont pas systématiquement reproduites chez les procaryotes ou même chez les levures. Une deuxième méthode de production de mAb humaine est l’immortalisation des cellules B humaines naturelles, par infection à virus Epstein - Barr ou expression des facteurs anti-apoptotique BCL-6 et BCL-XL4. Toutefois, cette méthode est applicable uniquement aux cellules B mémoire et est inefficace, exigeant que le dépistage des nombreux mAb immortalisées B cellules productrices d’identifier les clones mAb peu (ou pas) avec la spécificité antigénique désirée. La méthode est donc coûteuses et chronophages.
Un nouveau protocole a été décrite récemment pour la production du mAbs humaine de simple isolé de cellules B5. Elle s’appuie sur une optimisée unicellulaires Reverse Transcription-Polymerase Chain Reaction (RT-PCR) pour l’amplification des deux la lourds - et chaînes légères encodage des segments d’une seule cellule B triée. Il est suivi par le clonage et l’expression de ces segments dans un système d’expression eucaryote, permettant ainsi la reconstitution d’un mAb pleinement humain. Ce protocole a été utilisé avec succès à partir de cellules de B de donneurs vaccinés. Les cellules ont été récoltées plusieurs semaines après la vaccination pour obtenir des fréquences plus élevées des lymphocytes B dirigés contre le Ag souhaitée et de limiter ainsi le temps nécessaire pour le dépistage de6. Autres mAbs pleinement humaines ont également été produites de patients7 et mélanome les patients infectés par le VIH+ (Virus de l’immunodéficience humaine)8. Malgré ces avancées, toujours aucune procédure n’est disponible que permet l’isolement Ag spécifiques de cellules de B indépendamment de leur phénotype mémoire ou la fréquence.
La procédure décrite ici conduit à l’isolement efficace ex vivo de cellules B circulantes humaines fondée sur leur spécificité BCR, suivie par la production de pleinement humain mAbs antigène-spécifiques dans le rendement élevé et avec un temps de projection basse. La méthode ne se limite pas aux cellules B mémoire ou les cellules B sécrétant des anticorps induits après une immuno-réaction, mais peut également être appliquée pour le répertoire de cellules B naïves humaines. Qu’il fonctionne même à partir de cellules de B Ag spécifiques présents à très basses fréquences est une bonne indication de son efficacité. Le principe de la méthode est la suivante : les cellules mononucléaires de sang périphérique (PBMC) sont colorées avec deux tétramères présentant l’antigène d’intérêt, chacun marqué avec un fluorochrome différent (p. ex., phycoérythrine (PE) et Allophycocyanin (APC)), et un troisième tétramère présentant un antigène étroitement apparenté conjugué avec un fluorochrome tiers (p. ex., Brillant Violet 421 (BV421)). Pour enrichir pour cellules de liaison de l’antigène, les cellules sont ensuite incubées avec perles recouvertes d’anti-PE et Abs anti-APC et triés dans les colonnes de séparation cellulaire. La fraction de cellules APC PE+ + est sélectionnée, colorées avec une variété de mAbs spécifiques pour différents types de cellules PBMC permettre l’identification des cellules B et soumis à l’écoulement cytometry cellule Tri. Les lymphocytes B qui sont PE+ et APC+, mais brillant Violet-, sont isolés. Cette étape sélectionne dans les cellules qui ne sont pas des cellules B ou ne se lient pas à l’antigène tétramères, mais faire un bind PE ou APC (ces cellules sera PE+ – d’APC ou PE– APC+) ou à la partie non-antigène des tétramères utilisé (ces les cellules seront BV421+). Cellules B pas très spécifiques pour l’épitope d’intérêt sont également Counter-sélectionnés à cette étape (ces cellules seront également BV421+). Ainsi, cette méthode peut purifier hautement spécifique B cellules exprimant des récepteurs de B-cellule (RCO) capables de distinguer les deux antigènes très étroitement apparentées. Des cellules de B spécifiques uniques sont recueillis dans des tubes et leurs ADNc amplifié par PCR Ig (complémentaires acides désoxyribonucléiques) cloné et exprimé par une lignée cellulaire humaine comme sécrétées IgG mAbs.
Comme une preuve de concept, cette étude décrit la génération efficace du mAbs humaine, qui reconnaît un peptide présenté par une classe complexe majeur d’histocompatibilité I (MHC-je) molécule et peut distinguer ce peptide et d’autres peptides chargés sur le même MHC-j’ai allèle. Même si le niveau de complexité de cette Ag est important, cette méthode (i) permet la récupération de rendement élevé du mAbs Ag spécifiques ; (ii) la production du mAbs capables de distinguer deux Ags structurellement proches. Cette approche peut être étendue aux patients vaccinés ou infectés sans aucune modification du protocole et a également déjà été implémentée avec succès dans un système de rat humanisé9. Ainsi, cette étude décrit une approche polyvalente et efficace pour générer des mAbs entièrement humains qui peut être utilisés en immunothérapie et de la recherche fondamentale.

<table>
	<tbody>
		<tr>
			<td>HEK 293A cell line</td>
			<td>Thermo Fisher scientific</td>
			<td>R70507</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM (1X) Dulbecco&#39;s Modified Eagle Medium</td>
			<td>Gibco by life technologies</td>
			<td>21969-035</td>
			<td>(+) 4,5g/L D-Glucose 
			0,11g/L Sodium Pyruvate 
			(-) L-Glutmine</td>
		</tr>
		<tr>
			<td>RPMI medium1640 (1X)</td>
			<td>Gibco by life technologies</td>
			<td>31870-025</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumine (BSA)</td>
			<td>PAA</td>
			<td>K45-001</td>
			<td></td>
		</tr>
		<tr>
			<td>Nutridoma-SP</td>
			<td>Roche</td>
			<td>11011375001</td>
			<td>100X Conc</td>
		</tr>
		<tr>
			<td>PBS-Phosphate Buffered Saline (10X) pH 7,4</td>
			<td>Ambion</td>
			<td>AM9624</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA (Ethylenediaminetetraacetic acid) 0,5M pH=8</td>
			<td>Invitrogen by Life Technologies</td>
			<td>15575-020</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine serum (FBS)</td>
			<td>Dominique Dutscher</td>
			<td>S1810-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Ficoll - lymphocytes separation medium</td>
			<td>EuroBio</td>
			<td>CMSMSL01-01</td>
			<td>density 1,0777+/-0,001</td>
		</tr>
		<tr>
			<td>streptavidin R-phycoerythrin conjugate</td>
			<td>Invitrogen by Life Technologies</td>
			<td>S21388</td>
			<td>premiun grade 1mg/ml contains 5mM sodium azide</td>
		</tr>
		<tr>
			<td>Streptavidin, allophycocyanin conjugate</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>S32362</td>
			<td>1mg/ml 
			2mM azide premium grade</td>
		</tr>
		<tr>
			<td>Brilliant violet 421 streptavidin</td>
			<td>Biolegend</td>
			<td>405225</td>
			<td>conc : 0,5mg/ml</td>
		</tr>
		<tr>
			<td>Anti-PE conjugated magnetic MicroBeads</td>
			<td>Miltenyi Biotec</td>
			<td>130-048-801</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-APC conjugated magnetic MicroBeads</td>
			<td>Miltenyi Biotec</td>
			<td>130-090-855</td>
			<td></td>
		</tr>
		<tr>
			<td>MidiMACs or QuadroMACS separotor</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-302/130-090-976</td>
			<td></td>
		</tr>
		<tr>
			<td>LS Columns</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-401</td>
			<td></td>
		</tr>
		<tr>
			<td>CD3 BV510 BD horizon</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>563109</td>
			<td>Used dilution 1:20</td>
		</tr>
		<tr>
			<td>CD19 FITC</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>345788</td>
			<td>Used dilution 1:20</td>
		</tr>
		<tr>
			<td>CD14 PerCPCy5.5</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>561116</td>
			<td>Used dilution 1:50</td>
		</tr>
		<tr>
			<td>CD16 PerCPCy5.5</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>338440</td>
			<td>Used dilution 1:50</td>
		</tr>
		<tr>
			<td>7AAD</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>51-68981E (559925)</td>
			<td>Used dilution 1:1000</td>
		</tr>
		<tr>
			<td>FACS ARIA III Cell Sorter Cytometer</td>
			<td>BD Biosciences</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>8-strip PCR tubes</td>
			<td>Axygen</td>
			<td>321-10-061</td>
			<td></td>
		</tr>
		<tr>
			<td>Racks for 96 microtubes</td>
			<td>Dominique Dutscher</td>
			<td>45476</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAseOUT Ribonuclease Inhibitor (recombinant)</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>10777-019</td>
			<td>qty:5000U (40U/ul)</td>
		</tr>
		<tr>
			<td>Distilled Water Dnase/Rnase Free</td>
			<td>Gibco</td>
			<td>10977-035</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligod(T)18 mRNA Primer</td>
			<td>New England BioLabs</td>
			<td>S1316S</td>
			<td>5.0 A260unit</td>
		</tr>
		<tr>
			<td>Random hexamers</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>N8080127</td>
			<td>qty : 50uM, 5nmoles</td>
		</tr>
		<tr>
			<td>Superscript III Reverse transcriptase</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>18080-044</td>
			<td>qty : 10000U (200U/ul)</td>
		</tr>
		<tr>
			<td>GoTaq G2 Flexi DNA polymerase</td>
			<td>Promega</td>
			<td>M7805</td>
			<td></td>
		</tr>
		<tr>
			<td>dNTP Set, Molecular biology grade</td>
			<td>Thermo Scientific</td>
			<td>R0182</td>
			<td>4*100umol</td>
		</tr>
		<tr>
			<td>5LVH1</td>
			<td>Eurofins</td>
			<td>ACAGGTGCCCACT 
			CCCAGGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>5LVH3</td>
			<td>Eurofins</td>
			<td>AAGGTGTCCAGTG 
			TGARGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>5LVL4_6</td>
			<td>Eurofins</td>
			<td>CCCAGATGGGTCC 
			TGTCCCAGGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>5LVH5</td>
			<td>Eurofins</td>
			<td>CAAGGAGTCTGTT 
			CCGAGGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>3HuIgG_const_anti</td>
			<td>Eurofins</td>
			<td>TCTTGTCCACCTT 
			GGTGTTGCT</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers -Reverse primers for human Ig- Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>3CuCH1</td>
			<td>Eurofins</td>
			<td>GGGAATTCTCACA 
			GGAGACGA</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers -Reverse primers for human Ig</td>
		</tr>
		<tr>
			<td>5AgeIVH1_5_7</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			GAGGTGCAGCTGGTGCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH3</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GAGGTGCAGCTGGTGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH3_23</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GAGGTGCAGCTGTTGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH4</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTGCAGCTGCAGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH4_34</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTGCAGCTACAGCAGTG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH1_18</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTTCAGCTGGTGCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH1_24</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTCCAGCTGGTACAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH3__9_30_33</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GAAGTGCAGCTGGTGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH6_1</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTACAGCTGCAGCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3SalIJH1_2_4_5</td>
			<td>Eurofins</td>
			<td>TGCGAAGTCGACG 
			CTGAGGAGACGGTGACCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td>
		</tr>
		<tr>
			<td>3SalIJH3</td>
			<td>Eurofins</td>
			<td>TGCGAAGTCGACG 
			CTGAAGAGACGGTGACCATTG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td>
		</tr>
		<tr>
			<td>3SalIJH6</td>
			<td>Eurofins</td>
			<td>TGCGAAGTCGACG 
			CTGAGGAGACGGTGACCGTG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td>
		</tr>
		<tr>
			<td>5&#39;LVk1_2</td>
			<td>Eurofins</td>
			<td>ATGAGGSTCCCYG 
			CTCAGCTGCTGG</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVk3</td>
			<td>Eurofins</td>
			<td>CTCTTCCTCCTGC 
			TACTCTGGCTCCCAG</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVk4</td>
			<td>Eurofins</td>
			<td>ATTTCTCTGTTGC 
			TCTGGATCTCTG</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;Ck543_566</td>
			<td>Eurofins</td>
			<td>GTTTCTCGTAGTC 
			TGCTTTGCTCA</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Reverse primers- Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk1</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GACATCCAGATGACCCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk1_9_1&#8211;13</td>
			<td>Eurofins</td>
			<td>TTGTGCTGCAACCGGTGTAC 
			ATTCAGACATCCAGTTGACCCAGTCT</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk1D_43_1_8</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTGT 
			GCCATCCGGATGACCCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk2</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATGGG 
			GATATTGTGATGACCCAGAC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk2_28_2_30</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATGGG 
			GATATTGTGATGACTCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk3_11_3D_11</td>
			<td>Eurofins</td>
			<td>TTGTGCTGCAACCGGTGTAC 
			ATTCAGAAATTGTGTTGACACAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk3_15_3D_15</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCA 
			GAAATAGTGATGACGCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk3_20_3D_20</td>
			<td>Eurofins</td>
			<td>TTGTGCTGCAACCGGTGTAC 
			ATTCAGAAATTGTGTTGACGCAGTCT</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk4_1</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCG 
			GACATCGTGATGACCCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;BsiWIJk1_2_4</td>
			<td>Eurofins</td>
			<td>GCCACCGTACGTT 
			TGATYTCCACCTTGGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;BsiWIJk3</td>
			<td>Eurofins</td>
			<td>GCCACCGTACGTT 
			TGATATCCACTTTGGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;BsiWIJk5</td>
			<td>Eurofins</td>
			<td>GCCACCGTACGTT 
			TAATCTCCAGTCGTGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl1</td>
			<td>Eurofins</td>
			<td>GGTCCTGGGCCCA 
			GTCTGTGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl2</td>
			<td>Eurofins</td>
			<td>GGTCCTGGGCCCA 
			GTCTGCCCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl3</td>
			<td>Eurofins</td>
			<td>GCTCTGTGACCTC 
			CTATGAGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl4_5</td>
			<td>Eurofins</td>
			<td>GGTCTCTCTCSCA 
			GCYTGTGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl6</td>
			<td>Eurofins</td>
			<td>GTTCTTGGGCCAA 
			TTTTATGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl7</td>
			<td>Eurofins</td>
			<td>GGTCCAATTCYCA 
			GGCTGTGGTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5LVl8</td>
			<td>Eurofins</td>
			<td>GAGTGGATTCTCA 
			GACTGTGGTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;Cl</td>
			<td>Eurofins</td>
			<td>CACCAGTGTGGCC 
			TTGTTGGCTTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl1</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCCTGGGCC 
			CAGTCTGTGCTGACKCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl2</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCCTGGGCC 
			CAGTCTGCCCTGACTCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl3</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCTGTGACC 
			TCCTATGAGCTGACWCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl4_5</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCTCTCTCS 
			CAGCYTGTGCTGACTCA</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl6</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCTTGGGCC 
			AATTTTATGCTGACTCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl8</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCCAATTCY 
			CAGRCTGTGGTGACYCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>3&#39;XhoICl</td>
			<td>Eurofins</td>
			<td>CTCCTCACTCGAG 
			GGYGGGAACAGAGTG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -Reverse primers - Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>Ab-vec-sense</td>
			<td>Eurofins</td>
			<td>GCTTCGTTAGAAC 
			GCGGCTAC</td>
			<td>Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>QA Agarose-TM, Molecular Biology Grade</td>
			<td>MP Bio</td>
			<td>AGAH0500</td>
			<td></td>
		</tr>
		<tr>
			<td>NucleoFast 96 PCR Plate</td>
			<td>Macherey Nagel</td>
			<td>743.100.100</td>
			<td></td>
		</tr>
		<tr>
			<td>Enzyme Age I HF</td>
			<td>New England Biolabs</td>
			<td>R3552L</td>
			<td>20000U/ml</td>
		</tr>
		<tr>
			<td>Enzyme SalI HF</td>
			<td>New England Biolabs</td>
			<td>R3138L</td>
			<td>20000U/ml</td>
		</tr>
		<tr>
			<td>Enzyme Xho I</td>
			<td>New England Biolabs</td>
			<td>R0146L</td>
			<td>20000U/ml</td>
		</tr>
		<tr>
			<td>Enzyme BSIWI</td>
			<td>New England Biolabs</td>
			<td>R0553L</td>
			<td>10000U/ml</td>
		</tr>
		<tr>
			<td>HCg1 (Genbank accession number FJ475055)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>LCk (Genbank accession number FJ475056 )</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>LCl (Genbank accession number FJ517647)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>15224.017</td>
			<td>100U (1U/ul)</td>
		</tr>
		<tr>
			<td>2X YT medium</td>
			<td>Sigma Aldrich</td>
			<td>Y1003-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Sigma Aldrich</td>
			<td>10835242001</td>
			<td></td>
		</tr>
		<tr>
			<td>LB (Luria Bertani) Broth (Lennox)</td>
			<td>Sigma Aldrich</td>
			<td>L3022-250G</td>
			<td></td>
		</tr>
		<tr>
			<td>Nucleospin Plasmid DNA, RNA and protein purification</td>
			<td>Macherey Nagel</td>
			<td>740588.250</td>
			<td></td>
		</tr>
		<tr>
			<td>Jet PEI DNA transfection reagent</td>
			<td>PolyPlus</td>
			<td>101-40</td>
			<td></td>
		</tr>
		<tr>
			<td>Flat bottom96-well plate</td>
			<td>Falcon</td>
			<td>353072</td>
			<td></td>
		</tr>
		<tr>
			<td>V-bottom 96-well plate</td>
			<td>Nunc/Thermofisher</td>
			<td>055142</td>
			<td></td>
		</tr>
		<tr>
			<td>Nunc easy 175 cm2 flasks</td>
			<td>Nunc/Thermofisher</td>
			<td>12-562-000</td>
			<td></td>
		</tr>
		<tr>
			<td>ELISA/ELISPOT coating buffer</td>
			<td>eBiosciences</td>
			<td>00-0044-59</td>
			<td></td>
		</tr>
		<tr>
			<td>Nunc maxisorp flat bottom 96 well ELISA plates</td>
			<td>Nunc/Thermofisher</td>
			<td>44-2404-21</td>
			<td>high protein binding</td>
		</tr>
		<tr>
			<td>Anti-human IgG Ab conjugated to horseradish peroxidase (HRP)</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>55788</td>
			<td></td>
		</tr>
		<tr>
			<td>TMB substrate</td>
			<td>BD Biosciences</td>
			<td>555214</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptavidin</td>
			<td>Sigma</td>
			<td>S0677</td>
			<td></td>
		</tr>
		<tr>
			<td>1 mL-HiTrap protein A HP column</td>
			<td>GE Healthcare</td>
			<td>17-0402-01</td>
			<td></td>
		</tr>
		<tr>
			<td>&#196;KTA FPLC</td>
			<td>GE Healthcare</td>
			<td>18190026</td>
			<td></td>
		</tr>
		<tr>
			<td>Superdex 200 10/300 GL column</td>
			<td>GE Healthcare</td>
			<td>17517501</td>
			<td></td>
		</tr>
		<tr>
			<td>NGC Quest 10 Plus Chromatography System</td>
			<td>BioRad</td>
			<td>7880003</td>
			<td></td>
		</tr>
	</tbody>
</table>

generation of discriminative human monoclonal antibodies from rare antigen-specific b cells circulating in blood

Anticorps monoclonaux (ACM) sont de puissants outils utiles pour les deux la recherche fondamentale et en biomédecine. Leur spécificité élevée est indispensable lorsque l’anticorps doit faire la distinction entre les structures fortement connexes (p. ex., une protéine normale et une version mutée de celle-ci). La façon actuelle de générer ces mAbs discriminatif implique une vaste sélection de multiples cellules productrices de Ab B, qui est coûteux et fastidieux. Nous vous proposons ici une méthode rapide et rentable pour la génération de discriminatoire, mAbs entièrement humain à partir de sang humain, les lymphocytes B circulants. L’originalité de cette stratégie est due à la sélection des cellules de liaison B antigène spécifique combinée à la Counter-sélection de toutes les autres cellules, à l’aide de facilement disponible Peripheral Blood mononucléaires cellules (PBMC). Une fois que les cellules B spécifiques sont isolés, cDNA (l’acide désoxyribonucléique complémentaire) séquences codant pour le mAb correspondant sont obtenus utilisant la technologie de cellule unique Reverse Transcription-Polymerase Chain Reaction (RT-PCR) et par la suite exprimé en homme cellules. Dans aussi peu que 1 mois, il est possible de produire des milligrammes de hautement discriminatoires mAbs humain dirigé contre pratiquement n’importe quel antigène désiré naturellement détectée par le répertoire des cellules B.

À partir de PBMC de donneurs sains, ce présente projet la génération du mAbs humaine, qui reconnaît le peptide Pp65495 (Pp65, du cytomégalovirus humain) présentés par la classe complexe majeur d’histocompatibilité I (MHC-I) molécule HLA - A * 0201 () HLA-A2). Ces mAbs peuvent distinguer entre ce complexe et complexes qui représentent les autres peptides chargés sur le même MHC-I molécule.
PBMC ont ét?...

Watch this Scientific Journal Video about Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood at JoVE.com

Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

Nous décrivons une méthode pour la production d’anticorps humains spécifiques pour un antigène d’intérêt, à partir de rares cellules B circulant dans le sang humain. Génération de ces anticorps naturels est efficace et rapide, et les anticorps obtenus peuvent distinguer les antigènes fortement connexes.

Génération de discriminatif anticorps monoclonaux humains de cellules rares spécifiques de l’antigène B circulant dans le sang

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the ...

The overall goal of this procedure is to produce fully human monoclonal antibodies against a desired antigen starting from human B lymphocytes circulating in the blood. This protocol allows the generation of monoclonal antibodies that can discriminate between highly related antigens. For some applications such as immunotherapy, precise targeting of an antigen can be indispensable.The advantages of this technique are that this can be performed starting from the blood of healthy or immunized donors and allows the isolation of even rare antigen-binding B cells. While this method is described starting from human samples, it can also be applied to animals that can be pre-immunized. Visual demonstration of this method is critical as the procedure really is under quite complex multiple analytic gating strategy of discriminated B lymphocytes.The procedure will be performed by Melinda. She is an assistant engineer from our laboratory. First pipette 35 milliliters of diluted cell suspension on 15 milliliters of density gradient in a 50 milliliter conical tube.Then place the conical tube in a swing bucket rotor with brakes off and centrifuge at 1290 times gravity for 25 minutes at room temperature. Next, at the interface of the density gradient medium and plasma layer, carefully aspirate the mononuclear cell layer and transfer it to a new 50 milliliter conical tube. Add the cell suspension to a 15 milliliter conical tube and centrifuge at 460 times gravity for five minutes.Then, resuspend the pellet in 200 microliters of phosphate buffered saline with 2%fetal bovine serum. Add conjugated tetramers to a final concentration of 10 micrograms per milliliter. Mix well and then incubate at room temperature for 30 minutes in the Laminar flow hood, protected from the light.Then add 10 milliliters of ice cold cell separation buffer to the cell suspension. Centrifuge the cell suspension at 460 times gravity for five minutes. To the cell pellet obtained, add 500 microliters of ice cold cell separation buffer and 50 microliters of two variants of magnetic microbeads and incubate the cell suspension for 20 minutes.Next, resuspend the cell pellet in ice cold cell separation buffer. Carefully transfer the cell suspension on the top of an equilibrated column and let it drain completely. Then rinse the tube with three milliliters of cell separation buffer and transfer the buffer to the column.After rinsing the column three times, remove it from the magnet and place on a 25 milliliter conical collecting tube. After adding five milliliters of ice cold separation buffer on top of the column, quickly flush the cells from the column with the help of a plunger. Resuspend the cell pellet with a cocktail of anti-human antibodies and 7AAD in a total volume of 100 microliters of phosphate buffered saline with 2%fetal bovine serum.Then, incubate the cells at four degrees Celsius for 30 minutes. Next, use a cell sorter cytometer to sort specific B cells at the single cell level not exceeding beyond on 1, 000 events per second. Then, collect the single sorted B cells into 8-strip PCR tubes previously filled with 10 microliters of 1X phosphate buffered saline and 10 units of RNAse inhibitor and place on a rack for 96 microtubes.Quickly freeze the tubes at negative 80 degrees Celsius. Heat the frozen samples in a dry bath maintained at 70 degrees Celsius for five minutes to lyse the cells. Then place the strip on ice and start constituting the reverse transcription master-mix.Once the reverse transcription master-mix is prepared, program instruct thermocycler. At the end of the reverse transcription, perform nested PCRs to amplify immunoglobulin genes. Identify the positive clones by visualizing on a 1.5%agarose gel the migration of a 500 base pair PCR product for variable heavy chain and coding segments and 350 base pair PCR product for variable light chain encoding segments.Add one microliter of the cloning product to 45 microliters of electrocompetent TOP10 E.coli cells.Electroporate. Then quickly add 500 microliters of 2X YT medium to the cells and incubate in a water bath at 37 degrees Celsius for 30 minutes. Spread the transformed bacteria on 2X YT ampicillin plate.Then, incubate the plates overnight at 37 degrees Celsius. Next, setup a reaction premix and add 25 microliters of it in per 8-strip PCR tube kept on ice. Then, use a sterile toothpick to pick colonies and streak the colonies on the 2X YT ampicillin plate.Then, dip the toothpicks in the PCR reaction tube. Identify the positive clones by visualizing on a 1.5%agarose gel the migration of an 850 base pair PCR product for the heavy chain vector and a 600 base pair PCR product for the light chain vector. In two milliliters of LB medium, inoculate four positive colonies.Incubate the inoculate at 37 degrees Celsius overnight at 200 revolutions per minute shaking. Seed 15, 000 human embryonic kidney cells in 200 microliters of Dulbecco's Modified Eagle Medium supplemented with 10%fetal bovine serum in each well of a flat bottom 96 well plate a day before the transfection. Then incubate the plate at 37 degrees Celsius overnight at 5%carbon dioxide.Cotransfect the cells using a linear polyethylenimine derivative transfection reagent. Dilute 0.5 microliters of DNA transfection reagent with 10 microliters of 150 millimolar of sodium chloride. Next, dilute 0.125 microgram of each variable heavy and light chain expressing vectors in 10 microliters of 150 millimolar sodium chloride.Vortex all the dilutions for 10 seconds each. Then, mix the previously diluted DNA transfection reagent with 10 microliters of DNA solution. Quickly vortex the DNA transfection mixture for 15 seconds and incubate for 15 minutes at room temperature.Add the DNA transfection mixture drop-wise on the cells and then gently swirl the plate. Replace the medium 16 hours after transfection and culture the cells for five days in serum-free medium at 37 degrees Celsius. Next, use a multichannel pipette, to aspirate the supernatant, and transfer it into the v-bottom 96 well plate.Coat each well in a 96 well ELISA plate with relevant antigen at four degrees Celsius for overnight in 100 microliters of reconstituted ELISA coating buffer at a final concentration of two micrograms per milliliter. Next add 50 microliters of a transfected cell supernatant to the wells of a 96 well ELISA plate and incubate the plate for two hours at room temperature. Then add 100 microliters of antihuman immunoglobulin G antibody conjugated to horseradish peroxidase enzyme at one microgram per milliliter concentration and incubate the well at room temperature for one hour.Finally, add 50 microliters of chromogenic substrate to the well and incubate for another 20 minutes. At the end of incubation, read the optical density at 450 nanometers on a spectrophotometer. To isolate the specific B cells a gating strategy was used that discriminated the B cells expressing receptors against the HLA-A2/Pp65 complex.Initially, the cells were CD19 positive, CD3 negative gated. Finally, cells were stained with both HLA-A2/Pp65PE and HLA-A2/Pp65APC, but not HLA-A2/MelABV421 tetramers, were gated to obtain the highly specific B cells. Using this gating strategy, selective B cells can be isolated, which can differentiate between HLA-A2/Pp65 and other related HLA-A2 peptide complex.Next, to study the presence of PC1.02 antibody against HLA-A2/Pp65 tetramer an ELISA assay was performed. In the bar plot obtained, the y-axis corresponds to the optimal density readings and the x-axis correspond to the HLA-A2 peptides. From the assay, it shows that a monoclonal antibody binds with HLA-A2/Pp65 tetramer in a peptide and major histocompatibility complex dependent manner.Next, surface plasmin residence was used to study the binding affinity of the PC1.02 antibody. Then, a tabular data was obtained to analyze the HLA-A2/Pp65 specific B cells. The impact of the exclusion strategy of unspecific B cells, the yields of immunoglobulin gene amplification, and monoclonal antibody production from HLA-A2/Pp65 specific B cells have been shown.Once mastered, the technique ranging from isolation of antigens specific B cells from human blood to monoclonal antibody production can be done in as little as one month. When performing this procedure, remember go straight from sorting of B cells to RT-PCR without pausing.

Research

JoVE Journal

Immunology and Infection

Antigen Specific In Vivo Killing Assay using CFSE Labeled Target Cells

Antigen Specific In Vivo Killing Assay using CFSE Labeled Target Cells

Specific Antigen In Vivo</emTuer Assay> en utilisant des cellules CFSE cible marquée

Carboxyfluorescein diacetate succinimidyl ester (CFSE) can be used to easily and quickly label a cell population of interest for in vivo investigation.  ...

Recherche

Immunologie et infection

Isolation of Precursor B-cell Subsets from Umbilical Cord Blood

Isolement des précurseurs des cellules B des sous-ensembles à partir de sang de cordon ombilical

Umbilical cord blood is highly enriched for hematopoietic progenitor cells at different lineage commitment stages. We have developed a protocol for ...

Killer Artificial Antigen Presenting Cells (KaAPC) for Efficient In Vitro Depletion of Human Antigen-specific T Cells

Killer Artificial Antigen Presenting Cells KaAPC for Efficient In Vitro Depletion of Human Antigen-specific T Cells

Tueur antigène artificielle cellules présentatrices (KaAPC) d&#39;utilisation efficace<em&gt; In Vitro</em&gt; L&#39;épuisement des lymphocytes T humains spécifiques de l&#39;antigène

Current treatment of T cell mediated autoimmune diseases relies mostly on strategies of global immunosuppression, which, in the long term, is accompanied ...

Generation of Human Alloantigen-specific T Cells from Peripheral Blood

Génération de cellules T humaines allo-spécifiques du sang périphérique

The study of human T lymphocyte biology often involves examination of responses to activating ligands. T cells recognize and respond to processed peptide ...

Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

Génération de Recombinant Human IgG anticorps monoclonaux à partir de cellules immortalisées Classé B

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, ...

The Isolation, Differentiation, and Quantification of Human Antibody-secreting B Cells from Blood: ELISpot as a Functional Readout of Humoral Immunity

L&#39;isolement, la différenciation, et la quantification des anticorps humain sécrétant des cellules B du sang: ELISpot comme indicateur fonctionnel de humorale Immunité

The hallmark of humoral immunity is to generate functional ASCs, which synthesize and secrete Abs specific to an antigen (Ag), such as a pathogen, and are ...

Generation of Murine Monoclonal Antibodies by Hybridoma Technology

La génération d&#39;anticorps monoclonaux murins par Hybridoma Technology

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding ...

Generation of Human Monocyte-derived Dendritic Cells from Whole Blood

Génération de cellules humaines dérivées de monocytes dendritiques du sang total

Dendritic cells (DCs) recognize foreign structures of different pathogens, such as viruses, bacteria, and fungi, via a variety of pattern recognition ...

Dextran Enhances the Lentiviral Transduction Efficiency of Murine and Human Primary NK Cells

Dextrane augmente l’efficacité de la Transduction des gènes des cellules NK primaires murines et humaines

The efficient transduction of specific genes into natural killer (NK) cells has been a major challenge. Successful transductions are critical to defining ...

Detection and Enrichment of Rare Antigen-specific B Cells for Analysis of Phenotype and Function

Détection et enrichissement des rares cellules B spécifiques de l&#39;antigène pour l&#39;analyse des Phénotype et fonction

B cells reactive with a specific antigen usually occur at a frequency of &lt;0.05% of lymphocytes. For decades researchers have sought methods to isolate ...