Name: generation of discriminative human monoclonal antibodies from rare antigen-specific b cells circulating in blood
Uploaded: 2018-02-06T14:00:00
Description: Watch this Scientific Journal Video about Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood at JoVE.com

Wir danken der Zytometrie Anlage "CytoCell" (SFR Santé, Biogenouest, Nantes) für kompetente technische Unterstützung. Wir danken auch das gesamte Personal der Produktion rekombinanter Proteine (P2R) und der Auswirkungen Plattformen (INSERM 1232, SFR Santé, Biogenouest, Nantes) für ihre technische Unterstützung. Wir danken Emmanuel Scotet und Richard Breathnach für konstruktive Kritik am Manuskript. Diese Arbeit wurde von der IHU-Cesti-Projekt gefördert durch die «Investissements Avenir» französische Regierung Programm, verwaltet von der französischen nationalen Forschung Agentur (ANR) (ANR-10-IBHU-005) finanziell unterstützt. IHU-Cesti-Projekt wird auch von Nantes Métropole und Région Pays De La Loire unterstützt. Diese Arbeit wurde im Rahmen des Programms LabEX IGO unterstützt vom nationalen Institut über die Investition des zukünftigen Programms ANR-11-LABX-0016-01 realisiert.

Alle menschlichen peripheren Blutproben stammen von anonymen Erwachsenen Spendern nach Einwilligung gemäß der lokalen Ethikkommission (Etablissement Français du Sang, EFS, Nantes, Verfahren Les NTS-2016-08).
1. Isolierung der menschlichen peripheren mononukleären Blutzellen
Hinweis: Ausgangsmaterial kann insgesamt menschlichen peripheren Blut oder Cytapheresis Proben sein. Proben sollten nicht älter als 8 h sein und mit Antikoagulantien (z.B. Heparin) er...

<ol>
	<li>Buss, N. A., Henderson, S. J., McFarlane, M., Shenton, J. M., de Haan, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibody+therapeutics:+history+and+future.">Monoclonal antibody therapeutics: history and future.</a> Curr Opin Pharmacol. 12 (5), 615-622 (2012).</li><li>Park, J., Kwon, M., Shin, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+checkpoint+inhibitors+for+cancer+treatment.">Immune checkpoint inhibitors for cancer treatment.</a> Arch Pharm Res. 39 (11), 1577-1587 (2016).</li><li>Pendley, C., Schantz, A., Wagner, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunogenicity+of+therapeutic+monoclonal+antibodies.">Immunogenicity of therapeutic monoclonal antibodies.</a> Curr Opin Mol Ther. 5 (2), 172-179 (2003).</li><li>Kwakkenbos, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+stable+monoclonal+antibody-producing+B+cell+receptor-positive+human+memory+B+cells+by+genetic+programming.">Generation of stable monoclonal antibody-producing B cell receptor-positive human memory B cells by genetic programming.</a> Nat Med. 16 (1), 123-128 (2010).</li><li>Tiller, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+generation+of+monoclonal+antibodies+from+single+human+B+cells+by+single+cell+RT-PCR+and+expression+vector+cloning.">Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning.</a> J Immunol Methods. 329 (1-2), 112-124 (2008).</li><li>Franz, B., May, K. F., Dranoff, G., Wucherpfennig, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ex+vivo+characterization+and+isolation+of+rare+memory+B+cells+with+antigen+tetramers.">Ex vivo characterization and isolation of rare memory B cells with antigen tetramers.</a> Blood. 118 (2), 348-357 (2011).</li><li>Morris, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+a+human+anti-HIV+gp41+membrane+proximal+region+neutralizing+antibody+by+antigen-specific+single+B+cell+sorting.">Isolation of a human anti-HIV gp41 membrane proximal region neutralizing antibody by antigen-specific single B cell sorting.</a> PLoS One. 6 (9), e23532 (2011).</li><li>Iizuka, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+cytomegalovirus+(CMV)pp65+antigen-specific+human+monoclonal+antibodies+using+single+B+cell-based+antibody+gene+cloning+from+melanoma+patients.">Identification of cytomegalovirus (CMV)pp65 antigen-specific human monoclonal antibodies using single B cell-based antibody gene cloning from melanoma patients.</a> Immunol Lett. 135 (1-2), 64-73 (2011).</li><li>Ouisse, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigen-specific+single+B+cell+sorting+and+expression-cloning+from+immunoglobulin+humanized+rats:+a+rapid+and+versatile+method+for+the+generation+of+high+affinity+and+discriminative+human+monoclonal+antibodies.">Antigen-specific single B cell sorting and expression-cloning from immunoglobulin humanized rats: a rapid and versatile method for the generation of high affinity and discriminative human monoclonal antibodies.</a> BMC Biotechnol. 17 (1), 3 (2017).</li><li>Kerkman, P. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterisation+of+citrullinated+antigen-specific+B+cells+in+peripheral+blood+of+patients+with+rheumatoid+arthritis.">Identification and characterisation of citrullinated antigen-specific B cells in peripheral blood of patients with rheumatoid arthritis.</a> Ann Rheum Dis. , (2015).</li><li>Hamilton, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+Approach+for+Tetramer-Based+Identification+of+Autoantigen-Reactive+B+Cells:+Characterization+of+La-+and+snRNP-Reactive+B+Cells+in+Autoimmune+BXD2+Mice.">General Approach for Tetramer-Based Identification of Autoantigen-Reactive B Cells: Characterization of La- and snRNP-Reactive B Cells in Autoimmune BXD2 Mice.</a> J Immunol. 194 (10), 5022-5034 (2015).</li><li>Sanjuan Nandin, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+in+vitro+booster+vaccination+to+rapidly+generate+antigen-specific+human+monoclonal+antibodies.">Novel in vitro booster vaccination to rapidly generate antigen-specific human monoclonal antibodies.</a> J Exp Med. , (2017).</li><li>Bowers, P. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+cell+display+for+the+discovery+and+optimization+of+antibody+therapeutics.">Mammalian cell display for the discovery and optimization of antibody therapeutics.</a> Methods. 65 (1), 44-56 (2014).</li></ol>

Das vorgeschlagene Protokoll ist eine leistungsfähige Methode für die Erzeugung von menschlichen mAbs direkt vom Ag-spezifische B-Zellen im Blut zirkulierenden. Es vereint drei wichtige Aspekte: (i) die Verwendung von ein Tetramer-assoziierte magnetische Anreicherung, wodurch eine ex-Vivo -Isolierung auch seltene Ag-Bindung B-Zellen; (Ii) eine gating Strategie, die drei Ag-Tetramers (zwei relevante und irrelevante eins) beschriftet mit drei verschiedenen Fluorochromes verwendet, um durch Durchflusszytometrie, ...

An erratum was issued for: <a href="https://www.jove.com/video/56508/generation-discriminative-human-monoclonal-antibodies-from-rare">Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood</a>.
The Affiliations section was corrected from:
Marie-Claire Devilder1,2,&#160;M&#233;linda Moyon1,2,&#160;Xavier Saulquin1, Laetitia Gautreau-Rolland1 
1Centre R&#233;gional de Recherche en Canc&#233;rologie et Immunologie Nantes/Angers, INSERM 1232, LabEx IGO, Universit&#233; de Nantes 
2CHU Nantes
to:
Marie-Claire Devilder1,2,3,&#160;M&#233;linda Moyon1,2,3,&#160;Xavier Saulquin1,2, Laetitia Gautreau-Rolland1,2&#160; 
1CRCINA, Inserm, CNRS, Universit&#233; d&#39;Angers, Universit&#233; de Nantes 
2LabEx IGO, &#34;Immunotherapy, Graft, Oncology&#34; 
3CHU, Nantes, France

An erratum was issued for: <a href="https://www.jove.com/video/56508/generation-discriminative-human-monoclonal-antibodies-from-rare">Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood</a>

Erratum: Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

Die hier beschriebene Methode ermöglicht die schnelle und vielseitige Produktion vollständig humaner monoklonaler Antikörper (mAbs) gegen eine gewünschte Antigen (Ag). mAbs sind unverzichtbare Werkzeuge in vielen Grundlagenforschung Anwendungen in Vitro und in Vivo: flow Cytometry, Histologie, Western-Blot und blockierende Experimente zum Beispiel. Darüber hinaus werden mAbs mehr und mehr in der Medizin zur Behandlung von Autoimmunerkrankungen, Krebs und Transplantation Ablehnung1Steuern eingesetzt. Anti-CTLA-4 und Anti-PD-1 (oder Anti-PD-L1) mAbs dienten zum Beispiel kürzlich als immun Checkpoint-Hemmern bei Krebs-Behandlungen2.
Der erste mAbs stammen von Immunglobulin (Ig)-sezernierenden Hybridome aus der Milz Zellen der immunisierten Mäusen oder Ratten gewonnen. Allerdings behindert die starke Immunantwort gegen Murine oder Ratte mAbs ihre therapeutische Anwendung beim Menschen, durch ihre schnelle Abfertigung und die wahrscheinlich Induktion von Überempfindlichkeit Reaktionen3. Um dieses Problem anzugehen, haben teilweise tierisches Eiweiß-Sequenzen von mAbs menschlich, so genannte Chimäre Maus-Mensch oder humanisierte Antikörper erzeugen abgelöst. Diese Strategie verringert sich jedoch nur teilweise Immunogenität, während deutlich erhöht, die Kosten und die Zeit-Skala der Produktion. Eine bessere Lösung besteht darin, menschliche mAbs direkt aus humanen B-Zellen zu generieren und mehrere Strategien hierfür zur Verfügung. Eine davon ist die Verwendung von Phagen oder Hefe Display. Dies umfasst Anzeigen Variable Domänen aus einer kombinatorischen Bibliothek von zufälligen menschlichen Ig schwere und Licht Ketten auf Phagen oder Hefen und Durchführung einer Auswahlschritt mit den spezifischen Antigen des Interesses. Ein großer Nachteil dieser Strategie ist, dass schwere und leichte Kette nach dem Zufallsprinzip verbunden, was zu einer sehr großen Zunahme in der Vielfalt der erzeugten Antikörper sind. Antikörper, die erhalten sind voraussichtlich nicht denen entsprechen, die durch eine natürliche Immunantwort gegen ein bestimmtes Ag entstehen würde. Darüber hinaus sind menschliche Protein-Falte und post-translationalen Modifikationen nicht systematisch in Prokaryoten oder sogar in Hefen reproduziert. Eine zweite menschliche mAb-Produktions-Methode ist die Verewigung der natürlichen menschlichen B-Zellen durch Epstein - Barr-Virus-Infektion oder Ausdruck der Anti-apoptotische Faktoren BCL-6 und BCL-XL4. Allerdings ist diese Methode gilt nur für B-Gedächtniszellen und ist ineffizient, dass Screening von zahlreichen mAb-produzierenden verewigt B-Zellen, die nur wenige (wenn überhaupt) mAb-Klone mit der gewünschten Antigen-Spezifität zu identifizieren. Die Methode ist so teuer und zeitaufwändig.
Vor kurzem wurde ein neues Protokoll für die Produktion von menschlichen mAbs von isolierten einzelnen B Zellen5beschrieben. Es stützt sich auf eine optimierte einzellige Reverse Transkription-Polymerase-Kettenreaktion (RT-PCR) zur Verstärkung der beiden die Heavy - und Lichterkette Codierung Segmente aus einer einzigen sortierten B-Zelle. Darauf folgt das Klonieren und die Expression dieser Segmente in einer eukaryotischen Expressionssystems, wodurch Wiederaufbau vollständig humaner MAB. Dieses Protokoll wurde erfolgreich ausgehend von B-Zellen von geimpften Spendern verwendet. Zellen wurden mehrere Wochen nach der Impfung zu höhere Frequenzen der B-Zellen gerichtet gegen die gewünschte Ag erhalten, und den Zeitaufwand für das screening von6geerntet. Anderen vollständig humaner mAbs wurden auch von+ (Human Immunodeficiency Virus) HIV-infizierten Patienten7 und Melanom Patienten8produziert. Trotz dieser Fortschritte gibt es noch keine Verfahren zur Verfügung, die die Isolation der Ag-spezifische B-Zellen unabhängig von ihrer Erinnerung Phänotyp oder Frequenz ermöglicht.
Hier beschriebenen Verfahrens führt zu effizienten ex Vivo Isolation der menschlichen zirkulierenden B-Zellen basierend auf ihre BCR Spezifität, gefolgt von der Produktion von vollständig humaner antigenspezifischen mAbs in hoher Ausbeute und mit einer niedrigen Screening-Zeit. Die Methode ist nicht zu B-Gedächtniszellen oder Antikörper-sezernierenden B-Zellen nach einer Immunantwort induziert beschränkt, sondern kann auch auf das menschliche naive B-Zelle Repertoire angewendet werden. Es funktioniert sogar ab Ag-spezifische B-Zellen bei sehr tiefen Frequenzen ist ein guter Indikator für die Effizienz. Das Prinzip der Methode ist wie folgt: periphere Blut mononukleären Zellen (PBMC) sind mit zwei Tetramers präsentiert das Antigen des Interesses befleckt, jeder gekennzeichnet mit einem unterschiedlichen Fluorochrom (z. B.Phycoerythrin (PE) und Allophycocyanin (APC)), und eine dritte Tetramer präsentiert eine eng verwandte Antigen konjugiert mit einem dritten Fluorochrom (z. B.Brillant violett 421 (BV421)). Um für Antigen-bindenen Zellen anzureichern, Zellen werden dann mit Perlen mit Anti-PE beschichtet inkubiert und Anti-APC Abs, und in Zelle Trennung Spalten sortiert. Die APC PE+ + Zelle Bruchteil ausgewählt ist, gebeizt mit einer Vielzahl von mAbs spezifisch für verschiedene PBMC Zelltypen zur Identifizierung von B-Zellen und unterworfenen Zytometrie Zellsortierung fließen. B-Zellen sind PE+ und APC+, aber brillant violett-, sind isoliert. Dieser Schritt wählt gegen Zellen, die nicht B-Zellen oder binden Sie nicht an die tetramerized Antigen, sondern binden PE oder APC (diese Zellen werden PE+ APC– oder PE– APC+) oder zum Teil nicht-Antigen der Tetramers verwendet (diese Zellen werden BV421+). B-Zellen nicht hochspezifisch für das Epitop von Interesse sind auch Counter bei diesem Schritt ausgewählt (diese Zellen werden auch BV421+). Somit kann diese Methode hochspezifische B-Zellen, B-Zell-Rezeptoren (BCR) in der Lage ist zu unterscheiden zwischen zwei eng verwandte Antigene ausdrücken reinigen. Einzelne spezifische B-Zellen sind in Tuben gesammelt und ihre PCR verstärkt Ig cDNAs (ergänzende Deoxyribonucleic Säuren) geklont und durch eine menschliche Zelllinie als sekretierten IgG mAbs ausgedrückt.
Diese Studie beschreibt, wie ein Proof of Concept, die effiziente Erzeugung von menschlichen mAbs, die erkennen, eine Peptid mit einem großen Histocompatibility complex-Klasse habe ich vorgelegt (MHC-ich) Molekül und kann unterscheiden dieses Peptid und anderen Peptiden beladen auf dem gleichen MHC-ich Allel. Obwohl der Grad der Komplexität dieser AG wichtig ist, können mit dieser Methode (i) high-Yield-Rückgewinnung von Ag-spezifische mAbs; (Ii) Produktion von mAbs in der Lage, zwischen zwei strukturell enger Ags zu unterscheiden. Dieser Ansatz zu geimpften oder infizierten Patienten ohne jegliche Änderung Protokoll erweitert werden und hat auch bereits in einem humanisierten Ratte System9erfolgreich umgesetzt. Diese Studie beschreibt also, eine vielseitige und effiziente Vorgehensweise um vollständig humaner mAbs, die verwendet werden können in Grundlagenforschung und Immuntherapie zu generieren.

<table>
	<tbody>
		<tr>
			<td>HEK 293A cell line</td>
			<td>Thermo Fisher scientific</td>
			<td>R70507</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM (1X) Dulbecco&#39;s Modified Eagle Medium</td>
			<td>Gibco by life technologies</td>
			<td>21969-035</td>
			<td>(+) 4,5g/L D-Glucose 
			0,11g/L Sodium Pyruvate 
			(-) L-Glutmine</td>
		</tr>
		<tr>
			<td>RPMI medium1640 (1X)</td>
			<td>Gibco by life technologies</td>
			<td>31870-025</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumine (BSA)</td>
			<td>PAA</td>
			<td>K45-001</td>
			<td></td>
		</tr>
		<tr>
			<td>Nutridoma-SP</td>
			<td>Roche</td>
			<td>11011375001</td>
			<td>100X Conc</td>
		</tr>
		<tr>
			<td>PBS-Phosphate Buffered Saline (10X) pH 7,4</td>
			<td>Ambion</td>
			<td>AM9624</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA (Ethylenediaminetetraacetic acid) 0,5M pH=8</td>
			<td>Invitrogen by Life Technologies</td>
			<td>15575-020</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine serum (FBS)</td>
			<td>Dominique Dutscher</td>
			<td>S1810-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Ficoll - lymphocytes separation medium</td>
			<td>EuroBio</td>
			<td>CMSMSL01-01</td>
			<td>density 1,0777+/-0,001</td>
		</tr>
		<tr>
			<td>streptavidin R-phycoerythrin conjugate</td>
			<td>Invitrogen by Life Technologies</td>
			<td>S21388</td>
			<td>premiun grade 1mg/ml contains 5mM sodium azide</td>
		</tr>
		<tr>
			<td>Streptavidin, allophycocyanin conjugate</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>S32362</td>
			<td>1mg/ml 
			2mM azide premium grade</td>
		</tr>
		<tr>
			<td>Brilliant violet 421 streptavidin</td>
			<td>Biolegend</td>
			<td>405225</td>
			<td>conc : 0,5mg/ml</td>
		</tr>
		<tr>
			<td>Anti-PE conjugated magnetic MicroBeads</td>
			<td>Miltenyi Biotec</td>
			<td>130-048-801</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-APC conjugated magnetic MicroBeads</td>
			<td>Miltenyi Biotec</td>
			<td>130-090-855</td>
			<td></td>
		</tr>
		<tr>
			<td>MidiMACs or QuadroMACS separotor</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-302/130-090-976</td>
			<td></td>
		</tr>
		<tr>
			<td>LS Columns</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-401</td>
			<td></td>
		</tr>
		<tr>
			<td>CD3 BV510 BD horizon</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>563109</td>
			<td>Used dilution 1:20</td>
		</tr>
		<tr>
			<td>CD19 FITC</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>345788</td>
			<td>Used dilution 1:20</td>
		</tr>
		<tr>
			<td>CD14 PerCPCy5.5</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>561116</td>
			<td>Used dilution 1:50</td>
		</tr>
		<tr>
			<td>CD16 PerCPCy5.5</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>338440</td>
			<td>Used dilution 1:50</td>
		</tr>
		<tr>
			<td>7AAD</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>51-68981E (559925)</td>
			<td>Used dilution 1:1000</td>
		</tr>
		<tr>
			<td>FACS ARIA III Cell Sorter Cytometer</td>
			<td>BD Biosciences</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>8-strip PCR tubes</td>
			<td>Axygen</td>
			<td>321-10-061</td>
			<td></td>
		</tr>
		<tr>
			<td>Racks for 96 microtubes</td>
			<td>Dominique Dutscher</td>
			<td>45476</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAseOUT Ribonuclease Inhibitor (recombinant)</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>10777-019</td>
			<td>qty:5000U (40U/ul)</td>
		</tr>
		<tr>
			<td>Distilled Water Dnase/Rnase Free</td>
			<td>Gibco</td>
			<td>10977-035</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligod(T)18 mRNA Primer</td>
			<td>New England BioLabs</td>
			<td>S1316S</td>
			<td>5.0 A260unit</td>
		</tr>
		<tr>
			<td>Random hexamers</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>N8080127</td>
			<td>qty : 50uM, 5nmoles</td>
		</tr>
		<tr>
			<td>Superscript III Reverse transcriptase</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>18080-044</td>
			<td>qty : 10000U (200U/ul)</td>
		</tr>
		<tr>
			<td>GoTaq G2 Flexi DNA polymerase</td>
			<td>Promega</td>
			<td>M7805</td>
			<td></td>
		</tr>
		<tr>
			<td>dNTP Set, Molecular biology grade</td>
			<td>Thermo Scientific</td>
			<td>R0182</td>
			<td>4*100umol</td>
		</tr>
		<tr>
			<td>5LVH1</td>
			<td>Eurofins</td>
			<td>ACAGGTGCCCACT 
			CCCAGGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>5LVH3</td>
			<td>Eurofins</td>
			<td>AAGGTGTCCAGTG 
			TGARGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>5LVL4_6</td>
			<td>Eurofins</td>
			<td>CCCAGATGGGTCC 
			TGTCCCAGGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>5LVH5</td>
			<td>Eurofins</td>
			<td>CAAGGAGTCTGTT 
			CCGAGGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>3HuIgG_const_anti</td>
			<td>Eurofins</td>
			<td>TCTTGTCCACCTT 
			GGTGTTGCT</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers -Reverse primers for human Ig- Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>3CuCH1</td>
			<td>Eurofins</td>
			<td>GGGAATTCTCACA 
			GGAGACGA</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers -Reverse primers for human Ig</td>
		</tr>
		<tr>
			<td>5AgeIVH1_5_7</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			GAGGTGCAGCTGGTGCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH3</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GAGGTGCAGCTGGTGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH3_23</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GAGGTGCAGCTGTTGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH4</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTGCAGCTGCAGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH4_34</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTGCAGCTACAGCAGTG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH1_18</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTTCAGCTGGTGCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH1_24</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTCCAGCTGGTACAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH3__9_30_33</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GAAGTGCAGCTGGTGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH6_1</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTACAGCTGCAGCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3SalIJH1_2_4_5</td>
			<td>Eurofins</td>
			<td>TGCGAAGTCGACG 
			CTGAGGAGACGGTGACCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td>
		</tr>
		<tr>
			<td>3SalIJH3</td>
			<td>Eurofins</td>
			<td>TGCGAAGTCGACG 
			CTGAAGAGACGGTGACCATTG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td>
		</tr>
		<tr>
			<td>3SalIJH6</td>
			<td>Eurofins</td>
			<td>TGCGAAGTCGACG 
			CTGAGGAGACGGTGACCGTG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td>
		</tr>
		<tr>
			<td>5&#39;LVk1_2</td>
			<td>Eurofins</td>
			<td>ATGAGGSTCCCYG 
			CTCAGCTGCTGG</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVk3</td>
			<td>Eurofins</td>
			<td>CTCTTCCTCCTGC 
			TACTCTGGCTCCCAG</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVk4</td>
			<td>Eurofins</td>
			<td>ATTTCTCTGTTGC 
			TCTGGATCTCTG</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;Ck543_566</td>
			<td>Eurofins</td>
			<td>GTTTCTCGTAGTC 
			TGCTTTGCTCA</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Reverse primers- Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk1</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GACATCCAGATGACCCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk1_9_1&#8211;13</td>
			<td>Eurofins</td>
			<td>TTGTGCTGCAACCGGTGTAC 
			ATTCAGACATCCAGTTGACCCAGTCT</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk1D_43_1_8</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTGT 
			GCCATCCGGATGACCCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk2</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATGGG 
			GATATTGTGATGACCCAGAC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk2_28_2_30</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATGGG 
			GATATTGTGATGACTCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk3_11_3D_11</td>
			<td>Eurofins</td>
			<td>TTGTGCTGCAACCGGTGTAC 
			ATTCAGAAATTGTGTTGACACAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk3_15_3D_15</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCA 
			GAAATAGTGATGACGCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk3_20_3D_20</td>
			<td>Eurofins</td>
			<td>TTGTGCTGCAACCGGTGTAC 
			ATTCAGAAATTGTGTTGACGCAGTCT</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk4_1</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCG 
			GACATCGTGATGACCCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;BsiWIJk1_2_4</td>
			<td>Eurofins</td>
			<td>GCCACCGTACGTT 
			TGATYTCCACCTTGGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;BsiWIJk3</td>
			<td>Eurofins</td>
			<td>GCCACCGTACGTT 
			TGATATCCACTTTGGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;BsiWIJk5</td>
			<td>Eurofins</td>
			<td>GCCACCGTACGTT 
			TAATCTCCAGTCGTGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl1</td>
			<td>Eurofins</td>
			<td>GGTCCTGGGCCCA 
			GTCTGTGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl2</td>
			<td>Eurofins</td>
			<td>GGTCCTGGGCCCA 
			GTCTGCCCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl3</td>
			<td>Eurofins</td>
			<td>GCTCTGTGACCTC 
			CTATGAGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl4_5</td>
			<td>Eurofins</td>
			<td>GGTCTCTCTCSCA 
			GCYTGTGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl6</td>
			<td>Eurofins</td>
			<td>GTTCTTGGGCCAA 
			TTTTATGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl7</td>
			<td>Eurofins</td>
			<td>GGTCCAATTCYCA 
			GGCTGTGGTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5LVl8</td>
			<td>Eurofins</td>
			<td>GAGTGGATTCTCA 
			GACTGTGGTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;Cl</td>
			<td>Eurofins</td>
			<td>CACCAGTGTGGCC 
			TTGTTGGCTTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl1</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCCTGGGCC 
			CAGTCTGTGCTGACKCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl2</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCCTGGGCC 
			CAGTCTGCCCTGACTCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl3</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCTGTGACC 
			TCCTATGAGCTGACWCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl4_5</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCTCTCTCS 
			CAGCYTGTGCTGACTCA</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl6</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCTTGGGCC 
			AATTTTATGCTGACTCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl8</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCCAATTCY 
			CAGRCTGTGGTGACYCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>3&#39;XhoICl</td>
			<td>Eurofins</td>
			<td>CTCCTCACTCGAG 
			GGYGGGAACAGAGTG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -Reverse primers - Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>Ab-vec-sense</td>
			<td>Eurofins</td>
			<td>GCTTCGTTAGAAC 
			GCGGCTAC</td>
			<td>Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>QA Agarose-TM, Molecular Biology Grade</td>
			<td>MP Bio</td>
			<td>AGAH0500</td>
			<td></td>
		</tr>
		<tr>
			<td>NucleoFast 96 PCR Plate</td>
			<td>Macherey Nagel</td>
			<td>743.100.100</td>
			<td></td>
		</tr>
		<tr>
			<td>Enzyme Age I HF</td>
			<td>New England Biolabs</td>
			<td>R3552L</td>
			<td>20000U/ml</td>
		</tr>
		<tr>
			<td>Enzyme SalI HF</td>
			<td>New England Biolabs</td>
			<td>R3138L</td>
			<td>20000U/ml</td>
		</tr>
		<tr>
			<td>Enzyme Xho I</td>
			<td>New England Biolabs</td>
			<td>R0146L</td>
			<td>20000U/ml</td>
		</tr>
		<tr>
			<td>Enzyme BSIWI</td>
			<td>New England Biolabs</td>
			<td>R0553L</td>
			<td>10000U/ml</td>
		</tr>
		<tr>
			<td>HCg1 (Genbank accession number FJ475055)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>LCk (Genbank accession number FJ475056 )</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>LCl (Genbank accession number FJ517647)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>15224.017</td>
			<td>100U (1U/ul)</td>
		</tr>
		<tr>
			<td>2X YT medium</td>
			<td>Sigma Aldrich</td>
			<td>Y1003-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Sigma Aldrich</td>
			<td>10835242001</td>
			<td></td>
		</tr>
		<tr>
			<td>LB (Luria Bertani) Broth (Lennox)</td>
			<td>Sigma Aldrich</td>
			<td>L3022-250G</td>
			<td></td>
		</tr>
		<tr>
			<td>Nucleospin Plasmid DNA, RNA and protein purification</td>
			<td>Macherey Nagel</td>
			<td>740588.250</td>
			<td></td>
		</tr>
		<tr>
			<td>Jet PEI DNA transfection reagent</td>
			<td>PolyPlus</td>
			<td>101-40</td>
			<td></td>
		</tr>
		<tr>
			<td>Flat bottom96-well plate</td>
			<td>Falcon</td>
			<td>353072</td>
			<td></td>
		</tr>
		<tr>
			<td>V-bottom 96-well plate</td>
			<td>Nunc/Thermofisher</td>
			<td>055142</td>
			<td></td>
		</tr>
		<tr>
			<td>Nunc easy 175 cm2 flasks</td>
			<td>Nunc/Thermofisher</td>
			<td>12-562-000</td>
			<td></td>
		</tr>
		<tr>
			<td>ELISA/ELISPOT coating buffer</td>
			<td>eBiosciences</td>
			<td>00-0044-59</td>
			<td></td>
		</tr>
		<tr>
			<td>Nunc maxisorp flat bottom 96 well ELISA plates</td>
			<td>Nunc/Thermofisher</td>
			<td>44-2404-21</td>
			<td>high protein binding</td>
		</tr>
		<tr>
			<td>Anti-human IgG Ab conjugated to horseradish peroxidase (HRP)</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>55788</td>
			<td></td>
		</tr>
		<tr>
			<td>TMB substrate</td>
			<td>BD Biosciences</td>
			<td>555214</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptavidin</td>
			<td>Sigma</td>
			<td>S0677</td>
			<td></td>
		</tr>
		<tr>
			<td>1 mL-HiTrap protein A HP column</td>
			<td>GE Healthcare</td>
			<td>17-0402-01</td>
			<td></td>
		</tr>
		<tr>
			<td>&#196;KTA FPLC</td>
			<td>GE Healthcare</td>
			<td>18190026</td>
			<td></td>
		</tr>
		<tr>
			<td>Superdex 200 10/300 GL column</td>
			<td>GE Healthcare</td>
			<td>17517501</td>
			<td></td>
		</tr>
		<tr>
			<td>NGC Quest 10 Plus Chromatography System</td>
			<td>BioRad</td>
			<td>7880003</td>
			<td></td>
		</tr>
	</tbody>
</table>

generation of discriminative human monoclonal antibodies from rare antigen-specific b cells circulating in blood

Monoklonale Antikörper (mAbs) sind mächtige Werkzeuge nützlich für beide Grundlagenforschung und in der Biomedizin. Ihre hohe Spezifität ist unverzichtbar, wenn der Antikörper sehr ähnliche Strukturen (z.B., ein normales Protein und eine mutierte Version davon) unterscheiden muss. Der aktuelle Weg erzeugen solche diskriminierenden mAbs beinhaltet umfangreiche Screening von mehreren Ab-produzierenden B-Zellen, ist kostspielig und zeitaufwendig. Wir schlagen hier eine schnelle und kostengünstige Methode zur Erzeugung von diskriminierendem, vollständig humaner mAbs ausgehend von menschlichem Blut zirkulierenden B-Lymphozyten. Die Originalität dieser Strategie ist durch die Auswahl der spezifischen Antigen Bindung B Zellen kombiniert mit dem Counter Auswahl aller anderen Zellen, mit leicht verfügbaren peripheren Blut mononukleären Zellen (PBMC). Sobald bestimmte B-Zellen isoliert sind, stammen cDNA (ergänzende Desoxyribonukleinsäure) Sequenzen Codierung für die entsprechenden mAb Einzelzelle Reverse Transkription-Polymerase-Kettenreaktion (RT-PCR) Technologie und anschließend ausgedrückt in der Human- Zellen. Innerhalb von weniger als 1 Monat ist es möglich, Milligramm hochgradig diskriminierend menschlichen mAbs gegen nahezu jede gewünschte Antigen natürlich erkannt durch die B-Zell-Repertoires zu produzieren.

Ausgehend von PBMC von gesunden Spendern dieses Projekt stellt die Erzeugung von menschlichen mAbs, die das Peptid Pp65495 erkennen (Pp65, von menschlichen Zytomegalievirus) durch die großen Histocompatibility complex-Klasse habe ich vorgelegt (MHC-ich) Molekül HLA - A * 0201 () HLA-A2). Diese mAbs können zwischen diesem Komplex und aus anderen Peptiden verladen der gleichen MHC-komplexe unterscheiden-ich Molekül.
<p class="jove_content" fo:keep-together.within-page="1"...

Watch this Scientific Journal Video about Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood at JoVE.com

Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

Wir beschreiben eine Methode zur Herstellung von menschlichen Antikörpern, die spezifisch für ein Antigen des Interesses, ausgehend von seltenen B-Zellen im menschlichen Blut zirkulieren. Generation dieser natürliche Antikörper ist rasch und effizient, und die Antikörper erhalten können sehr ähnliche Antigene unterscheiden.

Generation von diskriminierendem menschlichen monoklonalen Antikörpern aus seltenen Antigen-spezifische B-Zellen im Blut zirkulierenden

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the ...

The overall goal of this procedure is to produce fully human monoclonal antibodies against a desired antigen starting from human B lymphocytes circulating in the blood. This protocol allows the generation of monoclonal antibodies that can discriminate between highly related antigens. For some applications such as immunotherapy, precise targeting of an antigen can be indispensable.The advantages of this technique are that this can be performed starting from the blood of healthy or immunized donors and allows the isolation of even rare antigen-binding B cells. While this method is described starting from human samples, it can also be applied to animals that can be pre-immunized. Visual demonstration of this method is critical as the procedure really is under quite complex multiple analytic gating strategy of discriminated B lymphocytes.The procedure will be performed by Melinda. She is an assistant engineer from our laboratory. First pipette 35 milliliters of diluted cell suspension on 15 milliliters of density gradient in a 50 milliliter conical tube.Then place the conical tube in a swing bucket rotor with brakes off and centrifuge at 1290 times gravity for 25 minutes at room temperature. Next, at the interface of the density gradient medium and plasma layer, carefully aspirate the mononuclear cell layer and transfer it to a new 50 milliliter conical tube. Add the cell suspension to a 15 milliliter conical tube and centrifuge at 460 times gravity for five minutes.Then, resuspend the pellet in 200 microliters of phosphate buffered saline with 2%fetal bovine serum. Add conjugated tetramers to a final concentration of 10 micrograms per milliliter. Mix well and then incubate at room temperature for 30 minutes in the Laminar flow hood, protected from the light.Then add 10 milliliters of ice cold cell separation buffer to the cell suspension. Centrifuge the cell suspension at 460 times gravity for five minutes. To the cell pellet obtained, add 500 microliters of ice cold cell separation buffer and 50 microliters of two variants of magnetic microbeads and incubate the cell suspension for 20 minutes.Next, resuspend the cell pellet in ice cold cell separation buffer. Carefully transfer the cell suspension on the top of an equilibrated column and let it drain completely. Then rinse the tube with three milliliters of cell separation buffer and transfer the buffer to the column.After rinsing the column three times, remove it from the magnet and place on a 25 milliliter conical collecting tube. After adding five milliliters of ice cold separation buffer on top of the column, quickly flush the cells from the column with the help of a plunger. Resuspend the cell pellet with a cocktail of anti-human antibodies and 7AAD in a total volume of 100 microliters of phosphate buffered saline with 2%fetal bovine serum.Then, incubate the cells at four degrees Celsius for 30 minutes. Next, use a cell sorter cytometer to sort specific B cells at the single cell level not exceeding beyond on 1, 000 events per second. Then, collect the single sorted B cells into 8-strip PCR tubes previously filled with 10 microliters of 1X phosphate buffered saline and 10 units of RNAse inhibitor and place on a rack for 96 microtubes.Quickly freeze the tubes at negative 80 degrees Celsius. Heat the frozen samples in a dry bath maintained at 70 degrees Celsius for five minutes to lyse the cells. Then place the strip on ice and start constituting the reverse transcription master-mix.Once the reverse transcription master-mix is prepared, program instruct thermocycler. At the end of the reverse transcription, perform nested PCRs to amplify immunoglobulin genes. Identify the positive clones by visualizing on a 1.5%agarose gel the migration of a 500 base pair PCR product for variable heavy chain and coding segments and 350 base pair PCR product for variable light chain encoding segments.Add one microliter of the cloning product to 45 microliters of electrocompetent TOP10 E.coli cells.Electroporate. Then quickly add 500 microliters of 2X YT medium to the cells and incubate in a water bath at 37 degrees Celsius for 30 minutes. Spread the transformed bacteria on 2X YT ampicillin plate.Then, incubate the plates overnight at 37 degrees Celsius. Next, setup a reaction premix and add 25 microliters of it in per 8-strip PCR tube kept on ice. Then, use a sterile toothpick to pick colonies and streak the colonies on the 2X YT ampicillin plate.Then, dip the toothpicks in the PCR reaction tube. Identify the positive clones by visualizing on a 1.5%agarose gel the migration of an 850 base pair PCR product for the heavy chain vector and a 600 base pair PCR product for the light chain vector. In two milliliters of LB medium, inoculate four positive colonies.Incubate the inoculate at 37 degrees Celsius overnight at 200 revolutions per minute shaking. Seed 15, 000 human embryonic kidney cells in 200 microliters of Dulbecco's Modified Eagle Medium supplemented with 10%fetal bovine serum in each well of a flat bottom 96 well plate a day before the transfection. Then incubate the plate at 37 degrees Celsius overnight at 5%carbon dioxide.Cotransfect the cells using a linear polyethylenimine derivative transfection reagent. Dilute 0.5 microliters of DNA transfection reagent with 10 microliters of 150 millimolar of sodium chloride. Next, dilute 0.125 microgram of each variable heavy and light chain expressing vectors in 10 microliters of 150 millimolar sodium chloride.Vortex all the dilutions for 10 seconds each. Then, mix the previously diluted DNA transfection reagent with 10 microliters of DNA solution. Quickly vortex the DNA transfection mixture for 15 seconds and incubate for 15 minutes at room temperature.Add the DNA transfection mixture drop-wise on the cells and then gently swirl the plate. Replace the medium 16 hours after transfection and culture the cells for five days in serum-free medium at 37 degrees Celsius. Next, use a multichannel pipette, to aspirate the supernatant, and transfer it into the v-bottom 96 well plate.Coat each well in a 96 well ELISA plate with relevant antigen at four degrees Celsius for overnight in 100 microliters of reconstituted ELISA coating buffer at a final concentration of two micrograms per milliliter. Next add 50 microliters of a transfected cell supernatant to the wells of a 96 well ELISA plate and incubate the plate for two hours at room temperature. Then add 100 microliters of antihuman immunoglobulin G antibody conjugated to horseradish peroxidase enzyme at one microgram per milliliter concentration and incubate the well at room temperature for one hour.Finally, add 50 microliters of chromogenic substrate to the well and incubate for another 20 minutes. At the end of incubation, read the optical density at 450 nanometers on a spectrophotometer. To isolate the specific B cells a gating strategy was used that discriminated the B cells expressing receptors against the HLA-A2/Pp65 complex.Initially, the cells were CD19 positive, CD3 negative gated. Finally, cells were stained with both HLA-A2/Pp65PE and HLA-A2/Pp65APC, but not HLA-A2/MelABV421 tetramers, were gated to obtain the highly specific B cells. Using this gating strategy, selective B cells can be isolated, which can differentiate between HLA-A2/Pp65 and other related HLA-A2 peptide complex.Next, to study the presence of PC1.02 antibody against HLA-A2/Pp65 tetramer an ELISA assay was performed. In the bar plot obtained, the y-axis corresponds to the optimal density readings and the x-axis correspond to the HLA-A2 peptides. From the assay, it shows that a monoclonal antibody binds with HLA-A2/Pp65 tetramer in a peptide and major histocompatibility complex dependent manner.Next, surface plasmin residence was used to study the binding affinity of the PC1.02 antibody. Then, a tabular data was obtained to analyze the HLA-A2/Pp65 specific B cells. The impact of the exclusion strategy of unspecific B cells, the yields of immunoglobulin gene amplification, and monoclonal antibody production from HLA-A2/Pp65 specific B cells have been shown.Once mastered, the technique ranging from isolation of antigens specific B cells from human blood to monoclonal antibody production can be done in as little as one month. When performing this procedure, remember go straight from sorting of B cells to RT-PCR without pausing.

Research

JoVE Journal

Immunology and Infection

Antigen Specific In Vivo Killing Assay using CFSE Labeled Target Cells

Antigen Specific In Vivo Killing Assay using CFSE Labeled Target Cells

Antigen-spezifische In Vivo Killing-Assay mit CFSE markierten Zielzellen

Carboxyfluorescein diacetate succinimidyl ester (CFSE) can be used to easily and quickly label a cell population of interest for in vivo investigation.  ...

Forschung

Immunologie und Infektion

Isolation of Precursor B-cell Subsets from Umbilical Cord Blood

Isolierung von Precursor B-Zell-Subsets aus Nabelschnurblut

Umbilical cord blood is highly enriched for hematopoietic progenitor cells at different lineage commitment stages. We have developed a protocol for ...

Killer Artificial Antigen Presenting Cells (KaAPC) for Efficient In Vitro Depletion of Human Antigen-specific T Cells

Killer Artificial Antigen Presenting Cells KaAPC for Efficient In Vitro Depletion of Human Antigen-specific T Cells

Killer Künstliche Antigen-präsentierenden Zellen (KaAPC) für effiziente<em&gt; In-vitro-</em&gt; Depletion von humanen Antigen-spezifischen T-Zellen

Current treatment of T cell mediated autoimmune diseases relies mostly on strategies of global immunosuppression, which, in the long term, is accompanied ...

Generation of Human Alloantigen-specific T Cells from Peripheral Blood

Generation of Human Alloantigen-spezifischen T-Zellen aus peripherem Blut

The study of human T lymphocyte biology often involves examination of responses to activating ligands. T cells recognize and respond to processed peptide ...

Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

Erzeugung von rekombinanten humanen IgG monoklonalen Antikörpern aus Immortalisierte Sortiert B Cells

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, ...

The Isolation, Differentiation, and Quantification of Human Antibody-secreting B Cells from Blood: ELISpot as a Functional Readout of Humoral Immunity

Die Isolation, Differenzierung und Quantifizierung von Human-Antikörper-sezernierenden B-Zellen aus Blut: ELISpot als Functional Readout der humoralen Immunität

The hallmark of humoral immunity is to generate functional ASCs, which synthesize and secrete Abs specific to an antigen (Ag), such as a pathogen, and are ...

Generation of Murine Monoclonal Antibodies by Hybridoma Technology

Generation of Murine Monoclonal Antibodies by Hybridomtechnologie

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding ...

Generation of Human Monocyte-derived Dendritic Cells from Whole Blood

Herstellung von menschlichen Monozyten abgeleiteten Dendritischen Zellen aus Vollblut

Dendritic cells (DCs) recognize foreign structures of different pathogens, such as viruses, bacteria, and fungi, via a variety of pattern recognition ...

Dextran Enhances the Lentiviral Transduction Efficiency of Murine and Human Primary NK Cells

Dextran erhöht die Effizienz der Lentivirale Transduktion von murinen und menschliche primäre NK-Zellen

The efficient transduction of specific genes into natural killer (NK) cells has been a major challenge. Successful transductions are critical to defining ...

Detection and Enrichment of Rare Antigen-specific B Cells for Analysis of Phenotype and Function

Detektion und Anreicherung von Rare Antigen-spezifische B-Zellen für die Analyse von Phänotypen und Funktion

B cells reactive with a specific antigen usually occur at a frequency of &lt;0.05% of lymphocytes. For decades researchers have sought methods to isolate ...