Name: generation of discriminative human monoclonal antibodies from rare antigen-specific b cells circulating in blood
Uploaded: 2018-02-06T14:00:00
Description: Watch this Scientific Journal Video about Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood at JoVE.com

אנו מודים המתקן Cytometry "CytoCell" (SFR Santé, Biogenouest, נאנט) לקבלת סיוע טכני מומחה. אנו מודים גם כל הצוות של ייצור חלבון רקומביננטי (P2R) ושל ההשפעה פלטפורמות (INSERM 1232, SFR Santé, Biogenouest, נאנט) לתמיכה טכנית שלהם. אנו מודים עמנואל Scotet, ריצ'רד Breathnach להערות בונה על כתב היד. עבודה זו נתמכה כלכלית על ידי הפרויקט IHU-צ'סטי במימון התכנית ממשלת צרפת «Investissements d'Avenir», מנוהל על ידי הצרפתי הלאומי מחקר סוכנות (ANR) (ANR-10-IBHU-005). פרויקט IHU-צ'סטי נתמך גם על ידי נאנט Métropole Région פיי דה לה לואר. עבודה זו מומש בהקשר של התוכנית LabEX IGO הנתמך על-ידי הסוכנות מחקר לאומי באמצעות ההשקעה של התוכנית בעתיד ANR-11-LABX-0016-01.

כל דגימות דם היקפיים אדם התקבלו מתורמים אנונימיים למבוגרים לאחר הסכמה מדעת, על פי ועדת האתיקה המקומית (Etablissement פרנקאיס du שרו, EFS, נאנט, הליך PLER NTS-2016-08).
1. בידוד תאי תאי דם היקפיים אנושי
הערה: החל חומר ניתן הכולל דם היקפיים אנושי או דגימות cytapheresis. לא צריך להיות מבוג?...

<ol>
	<li>Buss, N. A., Henderson, S. J., McFarlane, M., Shenton, J. M., de Haan, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibody+therapeutics:+history+and+future.">Monoclonal antibody therapeutics: history and future.</a> Curr Opin Pharmacol. 12 (5), 615-622 (2012).</li><li>Park, J., Kwon, M., Shin, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+checkpoint+inhibitors+for+cancer+treatment.">Immune checkpoint inhibitors for cancer treatment.</a> Arch Pharm Res. 39 (11), 1577-1587 (2016).</li><li>Pendley, C., Schantz, A., Wagner, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunogenicity+of+therapeutic+monoclonal+antibodies.">Immunogenicity of therapeutic monoclonal antibodies.</a> Curr Opin Mol Ther. 5 (2), 172-179 (2003).</li><li>Kwakkenbos, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+stable+monoclonal+antibody-producing+B+cell+receptor-positive+human+memory+B+cells+by+genetic+programming.">Generation of stable monoclonal antibody-producing B cell receptor-positive human memory B cells by genetic programming.</a> Nat Med. 16 (1), 123-128 (2010).</li><li>Tiller, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+generation+of+monoclonal+antibodies+from+single+human+B+cells+by+single+cell+RT-PCR+and+expression+vector+cloning.">Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning.</a> J Immunol Methods. 329 (1-2), 112-124 (2008).</li><li>Franz, B., May, K. F., Dranoff, G., Wucherpfennig, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ex+vivo+characterization+and+isolation+of+rare+memory+B+cells+with+antigen+tetramers.">Ex vivo characterization and isolation of rare memory B cells with antigen tetramers.</a> Blood. 118 (2), 348-357 (2011).</li><li>Morris, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+a+human+anti-HIV+gp41+membrane+proximal+region+neutralizing+antibody+by+antigen-specific+single+B+cell+sorting.">Isolation of a human anti-HIV gp41 membrane proximal region neutralizing antibody by antigen-specific single B cell sorting.</a> PLoS One. 6 (9), e23532 (2011).</li><li>Iizuka, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+cytomegalovirus+(CMV)pp65+antigen-specific+human+monoclonal+antibodies+using+single+B+cell-based+antibody+gene+cloning+from+melanoma+patients.">Identification of cytomegalovirus (CMV)pp65 antigen-specific human monoclonal antibodies using single B cell-based antibody gene cloning from melanoma patients.</a> Immunol Lett. 135 (1-2), 64-73 (2011).</li><li>Ouisse, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigen-specific+single+B+cell+sorting+and+expression-cloning+from+immunoglobulin+humanized+rats:+a+rapid+and+versatile+method+for+the+generation+of+high+affinity+and+discriminative+human+monoclonal+antibodies.">Antigen-specific single B cell sorting and expression-cloning from immunoglobulin humanized rats: a rapid and versatile method for the generation of high affinity and discriminative human monoclonal antibodies.</a> BMC Biotechnol. 17 (1), 3 (2017).</li><li>Kerkman, P. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterisation+of+citrullinated+antigen-specific+B+cells+in+peripheral+blood+of+patients+with+rheumatoid+arthritis.">Identification and characterisation of citrullinated antigen-specific B cells in peripheral blood of patients with rheumatoid arthritis.</a> Ann Rheum Dis. , (2015).</li><li>Hamilton, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+Approach+for+Tetramer-Based+Identification+of+Autoantigen-Reactive+B+Cells:+Characterization+of+La-+and+snRNP-Reactive+B+Cells+in+Autoimmune+BXD2+Mice.">General Approach for Tetramer-Based Identification of Autoantigen-Reactive B Cells: Characterization of La- and snRNP-Reactive B Cells in Autoimmune BXD2 Mice.</a> J Immunol. 194 (10), 5022-5034 (2015).</li><li>Sanjuan Nandin, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+in+vitro+booster+vaccination+to+rapidly+generate+antigen-specific+human+monoclonal+antibodies.">Novel in vitro booster vaccination to rapidly generate antigen-specific human monoclonal antibodies.</a> J Exp Med. , (2017).</li><li>Bowers, P. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+cell+display+for+the+discovery+and+optimization+of+antibody+therapeutics.">Mammalian cell display for the discovery and optimization of antibody therapeutics.</a> Methods. 65 (1), 44-56 (2014).</li></ol>

הפרוטוקול המוצע היא שיטה חזקה לדור של mAbs האנושי ישירות מתאי B הספציפיים Ag במחזור הדם. היא משלבת שלושה היבטים חשובים: (i) שימוש tetramer-הקשורים מגנטי העשרה, המאפשרת בידוד שמחוץ תאי B Ag מחייב אפילו נדיר; (ii) אסטרטגיה המגביל המשתמשת שלושה Ag tetramers (שני רלבנטיות, אחד לא רלוונטי) מתויג עם שלושה fluorochr...

An erratum was issued for: <a href="https://www.jove.com/video/56508/generation-discriminative-human-monoclonal-antibodies-from-rare">Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood</a>.
The Affiliations section was corrected from:
Marie-Claire Devilder1,2,&#160;M&#233;linda Moyon1,2,&#160;Xavier Saulquin1, Laetitia Gautreau-Rolland1 
1Centre R&#233;gional de Recherche en Canc&#233;rologie et Immunologie Nantes/Angers, INSERM 1232, LabEx IGO, Universit&#233; de Nantes 
2CHU Nantes
to:
Marie-Claire Devilder1,2,3,&#160;M&#233;linda Moyon1,2,3,&#160;Xavier Saulquin1,2, Laetitia Gautreau-Rolland1,2&#160; 
1CRCINA, Inserm, CNRS, Universit&#233; d&#39;Angers, Universit&#233; de Nantes 
2LabEx IGO, &#34;Immunotherapy, Graft, Oncology&#34; 
3CHU, Nantes, France

An erratum was issued for: <a href="https://www.jove.com/video/56508/generation-discriminative-human-monoclonal-antibodies-from-rare">Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood</a>

Erratum: Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

השיטה המתוארת כאן מאפשרת ייצור מהיר ופסיביות של נוגדנים חד-שבטיים אנושית לחלוטין (mAbs) נגד אנטיגן הרצוי (Ag). mAbs הם כלים חיוניים רבים מחקר בסיסי יישומים בתוך חוץ גופית ו ויוו: flow cytometry, היסטולוגיה, ניסויים סופג המערבי, ואת החסימה לדוגמה. יתר על כן, mAbs נמצאים בשימוש יותר תרופות לטיפול במחלות אוטואימוניות, סרטן, וכדי לשלוט דחייה השתלת1. לדוגמה, mAbs אנטי-CTLA-4 ו- anti-PD-1 (או אנטי-PD-L1) לאחרונה שימשו מעכבי המערכת החיסונית מחסום טיפולי סרטן2.
MAbs הראשונה יוצרו על ידי אימונוגלובולין (Ig)-מפריש hybridomas המתקבל תאי הטחול של חיסון עכברים או חולדות. עם זאת, התגובה החיסונית חזקה נגד mAbs מאתר או עכברוש הסלים שלהם לשימוש טיפולית בבני אדם, בשל הסיווג שלהם מהירה של אינדוקציה סביר של רגישות יתר תגובות3. כדי להתמודד עם בעיה זו, פרוטאין מהחי רצפים של mAbs הוחלפו חלקית על-ידי אלה האדם לייצר נוגדנים העכבר-אנושי או humanized chimeric כביכול. עם זאת, אסטרטגיה זו פוחתת באופן חלקי בלבד immunogenicity, תוך הגדלת באופן משמעותי הן את העלות והן ציר-הזמן של ייצור. פתרון טוב יותר היא לייצר mAbs האנושי ישירות מתאי B האנושית, מספר אסטרטגיות זה הינם זמינים. אחד מהם הוא השימוש של תצוגת phage או שמרים. זה כולל הצגת תחומים משתנים מספרייה קומבינטורית של Ig אדם אקראי כבד, אור שרשראות phages או שמרים, ולא בביצוע שלב הבחירה באמצעות אנטיגן ספציפי של עניין. חיסרון גדול של אסטרטגיה זו היא שרשראות קלות וכבדות מקושרים באקראיות, שמוביל עלייה גדולה מאוד הרב-גוניות של נוגדנים שנוצרו. נוגדנים שהושג סביר להניח תואמים לאלה הנובעים מן תגובה חיסונית טבעית נגד Ag מסוים. יתר על כן, קיפול חלבונים האנושית והשינויים post-translational לא באופן שיטתי משוחזרות אאוקריוטים או אפילו בכל שמרים. שיטת הייצור mAb האדם השני הוא immortalization של תאים B אנושי טבעי, על ידי וירוס אפשטיין בר זיהום או ביטוי של גורמים אנטי-מוות BCL-6 ו- BCL-XL4. אולם, שיטה זו ישימה רק לתאי זיכרון B, הוא יעיל, הדורשים הקרנת רבים mAb immortalized B והתאים המייצרים לזהות שיבוטים mAb כמה (אם בכלל) עם יחודיות antigenic הרצוי. השיטה זו וכך גם יקר וגם זמן רב.
פרוטוקול חדש לאחרונה תואר לייצור mAbs אנושית מבודדת אחת B תאים5. זה מסתמך על אופטימיזציה בתא יחיד הפוך תמלול-תגובת שרשרת פולימראזית (RT-PCR) עבור הגברה של שני כבדים - ו אור-שרשרת קידוד מקטעי מתא B ממוינת יחידה. זה מלווה את שיבוט וביטוי של מקטעים אלה במערכת הביטוי האיקריוטים, ובכך לאפשר שחזור של mAb אנושית לחלוטין. פרוטוקול זה שימש בהצלחה מתחיל מתאי B מתורמים שחוסנו. תאים נבצרו מספר שבועות לאחר החיסון כדי להשיג תדרים גבוהים יותר של תאי B נגד היועץ המשפטי לממשלה הרצוי, ואת ובכך להגביל את משך הזמן הדרוש לסינון6. אחרים mAbs אנושית לחלוטין גם הופקו נשאי איידס+ (וירוס הכשל החיסוני האנושי) חולים7 ו מלנומה מטופלים8. למרות ההתפתחויות הללו, יש עדיין אין הליך זמין המאפשר את הבידוד של תאים ספציפיים Ag B עצמאית של פנוטיפ זיכרון או התדירות שלהם.
ההליך שמתואר כאן מוביל בידוד יעיל ex-vivo של תאי B במחזור אדם המבוסס על ירידה לפרטים BCR שלהם, ואחריו את הייצור של mAbs אנטיגן ספציפי אנושית לחלוטין תשואה גבוהה ועם זמן הקרנה נמוכה. השיטה אינה מוגבלת זיכרון B תאים או מפריש נוגדן תאי B המושרה לאחר תגובה חיסונית, אך ניתן להחיל גם על הרפרטואר תא B נאיבי האדם. זה עובד אפילו מתחיל מתאי B הספציפיים Ag, נוכח תדרים נמוכים מאוד היא אינדיקציה טובה של היעילות שלה. העקרון של השיטה הוא כדלקמן: היקפי דם תאי תאים (PBMC) מוכתמים tetramers שני מציג אנטיגן של עניין, כל אחת המסומנת fluorochrome שונים (למשל, Phycoerythrin (PE), Allophycocyanin (APC)), tetramer השלישי מציג אנטיגן הקשורים קשר הדוק מצומדת עם fluorochrome השלישי (למשל, 421 ויולט Brillant (BV421)). להעשיר עבור תאים אנטיגן מחייב, תאים מודגרת ואז עם חרוזים מצופים אנטי-PE ו- Abs אנטי-APC, וממוינות תא ההפרדה עמודות. השבר תא APC PE+ + נבחר, ויטראז'ים עם מגוון רחב של mAbs ספציפיות עבור סוגים שונים של תאים PBMC לאפשר זיהוי של תאי B, ומתן וכפופים לזרום cytometry מיון תא. בתאי B שהן PE+ , APC+, אבל-, ויולט מבריק מבודדים. שלב זה נגד בוחר תאים אשר אינם תאים B או אפשרות לאגד אנטיגן tetramerized, אך לאגד PE או APC (תאים אלו יהיו PE+ APC– או PE– APC+) או לחלק הלא-אנטיגן של tetramers בשימוש (אלה התאים יהיה BV421+). בתאי B לא ספציפי מאוד עבור epitope עניין גם נבחרו נגד בשלב זה (תאים אלה יהיה גם BV421+). לכן, בשיטה זו ניתן לטהר ספציפי מאוד B תאים המבטאים קולטנים B-cell (BCRs) יכול להפלות בין שני אנטיגנים מאוד קרובים. תאים B ספציפיים בודדים נאספים צינורות, שלהם cDNAs Ig מוגבר-PCR (חומצות deoxyribonucleic משלימים) שיכפל והביע על-ידי קו תאים אנושיים כמו המופרש mAbs IgG.
מהווה הוכחה של המושג, מחקר זה מתאר הדור יעיל של mAbs האנושי, אשר מזהה פפטיד שהוצגו על-ידי מחלקה מורכבים histocompatibility הגדולות (MHC-אני) מולקולה, יכול להפלות בין פפטיד זה אחרים פפטידים טעון על אותו MHC-אני אלל. רמת המורכבות של Ag זה אמנם חשוב, שיטה זו מאפשרת (i) תשואה גבוהה שחזור של mAbs Ag ספציפיים; (ii) ייצור mAbs מסוגל להפלות בין שתי Ags קרובים מבחינה מבנית. גישה זו ניתן להרחיב את חוסנו או נגועים המטופלים ללא כל שינוי פרוטוקול, גם כבר בהצלחה הוכרז ב מערכת humanized החולדה9. לפיכך, מחקר זה מתאר בגישה רב תכליתי ויעיל להפקת mAbs אנושית לחלוטין שניתן להשתמש בהם מחקר בסיסי, חיסוני.

<table>
	<tbody>
		<tr>
			<td>HEK 293A cell line</td>
			<td>Thermo Fisher scientific</td>
			<td>R70507</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM (1X) Dulbecco&#39;s Modified Eagle Medium</td>
			<td>Gibco by life technologies</td>
			<td>21969-035</td>
			<td>(+) 4,5g/L D-Glucose 
			0,11g/L Sodium Pyruvate 
			(-) L-Glutmine</td>
		</tr>
		<tr>
			<td>RPMI medium1640 (1X)</td>
			<td>Gibco by life technologies</td>
			<td>31870-025</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumine (BSA)</td>
			<td>PAA</td>
			<td>K45-001</td>
			<td></td>
		</tr>
		<tr>
			<td>Nutridoma-SP</td>
			<td>Roche</td>
			<td>11011375001</td>
			<td>100X Conc</td>
		</tr>
		<tr>
			<td>PBS-Phosphate Buffered Saline (10X) pH 7,4</td>
			<td>Ambion</td>
			<td>AM9624</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA (Ethylenediaminetetraacetic acid) 0,5M pH=8</td>
			<td>Invitrogen by Life Technologies</td>
			<td>15575-020</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine serum (FBS)</td>
			<td>Dominique Dutscher</td>
			<td>S1810-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Ficoll - lymphocytes separation medium</td>
			<td>EuroBio</td>
			<td>CMSMSL01-01</td>
			<td>density 1,0777+/-0,001</td>
		</tr>
		<tr>
			<td>streptavidin R-phycoerythrin conjugate</td>
			<td>Invitrogen by Life Technologies</td>
			<td>S21388</td>
			<td>premiun grade 1mg/ml contains 5mM sodium azide</td>
		</tr>
		<tr>
			<td>Streptavidin, allophycocyanin conjugate</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>S32362</td>
			<td>1mg/ml 
			2mM azide premium grade</td>
		</tr>
		<tr>
			<td>Brilliant violet 421 streptavidin</td>
			<td>Biolegend</td>
			<td>405225</td>
			<td>conc : 0,5mg/ml</td>
		</tr>
		<tr>
			<td>Anti-PE conjugated magnetic MicroBeads</td>
			<td>Miltenyi Biotec</td>
			<td>130-048-801</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-APC conjugated magnetic MicroBeads</td>
			<td>Miltenyi Biotec</td>
			<td>130-090-855</td>
			<td></td>
		</tr>
		<tr>
			<td>MidiMACs or QuadroMACS separotor</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-302/130-090-976</td>
			<td></td>
		</tr>
		<tr>
			<td>LS Columns</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-401</td>
			<td></td>
		</tr>
		<tr>
			<td>CD3 BV510 BD horizon</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>563109</td>
			<td>Used dilution 1:20</td>
		</tr>
		<tr>
			<td>CD19 FITC</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>345788</td>
			<td>Used dilution 1:20</td>
		</tr>
		<tr>
			<td>CD14 PerCPCy5.5</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>561116</td>
			<td>Used dilution 1:50</td>
		</tr>
		<tr>
			<td>CD16 PerCPCy5.5</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>338440</td>
			<td>Used dilution 1:50</td>
		</tr>
		<tr>
			<td>7AAD</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>51-68981E (559925)</td>
			<td>Used dilution 1:1000</td>
		</tr>
		<tr>
			<td>FACS ARIA III Cell Sorter Cytometer</td>
			<td>BD Biosciences</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>8-strip PCR tubes</td>
			<td>Axygen</td>
			<td>321-10-061</td>
			<td></td>
		</tr>
		<tr>
			<td>Racks for 96 microtubes</td>
			<td>Dominique Dutscher</td>
			<td>45476</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAseOUT Ribonuclease Inhibitor (recombinant)</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>10777-019</td>
			<td>qty:5000U (40U/ul)</td>
		</tr>
		<tr>
			<td>Distilled Water Dnase/Rnase Free</td>
			<td>Gibco</td>
			<td>10977-035</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligod(T)18 mRNA Primer</td>
			<td>New England BioLabs</td>
			<td>S1316S</td>
			<td>5.0 A260unit</td>
		</tr>
		<tr>
			<td>Random hexamers</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>N8080127</td>
			<td>qty : 50uM, 5nmoles</td>
		</tr>
		<tr>
			<td>Superscript III Reverse transcriptase</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>18080-044</td>
			<td>qty : 10000U (200U/ul)</td>
		</tr>
		<tr>
			<td>GoTaq G2 Flexi DNA polymerase</td>
			<td>Promega</td>
			<td>M7805</td>
			<td></td>
		</tr>
		<tr>
			<td>dNTP Set, Molecular biology grade</td>
			<td>Thermo Scientific</td>
			<td>R0182</td>
			<td>4*100umol</td>
		</tr>
		<tr>
			<td>5LVH1</td>
			<td>Eurofins</td>
			<td>ACAGGTGCCCACT 
			CCCAGGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>5LVH3</td>
			<td>Eurofins</td>
			<td>AAGGTGTCCAGTG 
			TGARGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>5LVL4_6</td>
			<td>Eurofins</td>
			<td>CCCAGATGGGTCC 
			TGTCCCAGGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>5LVH5</td>
			<td>Eurofins</td>
			<td>CAAGGAGTCTGTT 
			CCGAGGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>3HuIgG_const_anti</td>
			<td>Eurofins</td>
			<td>TCTTGTCCACCTT 
			GGTGTTGCT</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers -Reverse primers for human Ig- Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>3CuCH1</td>
			<td>Eurofins</td>
			<td>GGGAATTCTCACA 
			GGAGACGA</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers -Reverse primers for human Ig</td>
		</tr>
		<tr>
			<td>5AgeIVH1_5_7</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			GAGGTGCAGCTGGTGCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH3</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GAGGTGCAGCTGGTGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH3_23</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GAGGTGCAGCTGTTGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH4</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTGCAGCTGCAGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH4_34</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTGCAGCTACAGCAGTG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH1_18</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTTCAGCTGGTGCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH1_24</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTCCAGCTGGTACAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH3__9_30_33</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GAAGTGCAGCTGGTGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH6_1</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTACAGCTGCAGCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3SalIJH1_2_4_5</td>
			<td>Eurofins</td>
			<td>TGCGAAGTCGACG 
			CTGAGGAGACGGTGACCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td>
		</tr>
		<tr>
			<td>3SalIJH3</td>
			<td>Eurofins</td>
			<td>TGCGAAGTCGACG 
			CTGAAGAGACGGTGACCATTG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td>
		</tr>
		<tr>
			<td>3SalIJH6</td>
			<td>Eurofins</td>
			<td>TGCGAAGTCGACG 
			CTGAGGAGACGGTGACCGTG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td>
		</tr>
		<tr>
			<td>5&#39;LVk1_2</td>
			<td>Eurofins</td>
			<td>ATGAGGSTCCCYG 
			CTCAGCTGCTGG</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVk3</td>
			<td>Eurofins</td>
			<td>CTCTTCCTCCTGC 
			TACTCTGGCTCCCAG</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVk4</td>
			<td>Eurofins</td>
			<td>ATTTCTCTGTTGC 
			TCTGGATCTCTG</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;Ck543_566</td>
			<td>Eurofins</td>
			<td>GTTTCTCGTAGTC 
			TGCTTTGCTCA</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Reverse primers- Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk1</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GACATCCAGATGACCCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk1_9_1&#8211;13</td>
			<td>Eurofins</td>
			<td>TTGTGCTGCAACCGGTGTAC 
			ATTCAGACATCCAGTTGACCCAGTCT</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk1D_43_1_8</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTGT 
			GCCATCCGGATGACCCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk2</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATGGG 
			GATATTGTGATGACCCAGAC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk2_28_2_30</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATGGG 
			GATATTGTGATGACTCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk3_11_3D_11</td>
			<td>Eurofins</td>
			<td>TTGTGCTGCAACCGGTGTAC 
			ATTCAGAAATTGTGTTGACACAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk3_15_3D_15</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCA 
			GAAATAGTGATGACGCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk3_20_3D_20</td>
			<td>Eurofins</td>
			<td>TTGTGCTGCAACCGGTGTAC 
			ATTCAGAAATTGTGTTGACGCAGTCT</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk4_1</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCG 
			GACATCGTGATGACCCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;BsiWIJk1_2_4</td>
			<td>Eurofins</td>
			<td>GCCACCGTACGTT 
			TGATYTCCACCTTGGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;BsiWIJk3</td>
			<td>Eurofins</td>
			<td>GCCACCGTACGTT 
			TGATATCCACTTTGGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;BsiWIJk5</td>
			<td>Eurofins</td>
			<td>GCCACCGTACGTT 
			TAATCTCCAGTCGTGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl1</td>
			<td>Eurofins</td>
			<td>GGTCCTGGGCCCA 
			GTCTGTGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl2</td>
			<td>Eurofins</td>
			<td>GGTCCTGGGCCCA 
			GTCTGCCCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl3</td>
			<td>Eurofins</td>
			<td>GCTCTGTGACCTC 
			CTATGAGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl4_5</td>
			<td>Eurofins</td>
			<td>GGTCTCTCTCSCA 
			GCYTGTGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl6</td>
			<td>Eurofins</td>
			<td>GTTCTTGGGCCAA 
			TTTTATGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl7</td>
			<td>Eurofins</td>
			<td>GGTCCAATTCYCA 
			GGCTGTGGTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5LVl8</td>
			<td>Eurofins</td>
			<td>GAGTGGATTCTCA 
			GACTGTGGTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;Cl</td>
			<td>Eurofins</td>
			<td>CACCAGTGTGGCC 
			TTGTTGGCTTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl1</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCCTGGGCC 
			CAGTCTGTGCTGACKCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl2</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCCTGGGCC 
			CAGTCTGCCCTGACTCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl3</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCTGTGACC 
			TCCTATGAGCTGACWCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl4_5</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCTCTCTCS 
			CAGCYTGTGCTGACTCA</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl6</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCTTGGGCC 
			AATTTTATGCTGACTCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl8</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCCAATTCY 
			CAGRCTGTGGTGACYCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>3&#39;XhoICl</td>
			<td>Eurofins</td>
			<td>CTCCTCACTCGAG 
			GGYGGGAACAGAGTG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -Reverse primers - Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>Ab-vec-sense</td>
			<td>Eurofins</td>
			<td>GCTTCGTTAGAAC 
			GCGGCTAC</td>
			<td>Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>QA Agarose-TM, Molecular Biology Grade</td>
			<td>MP Bio</td>
			<td>AGAH0500</td>
			<td></td>
		</tr>
		<tr>
			<td>NucleoFast 96 PCR Plate</td>
			<td>Macherey Nagel</td>
			<td>743.100.100</td>
			<td></td>
		</tr>
		<tr>
			<td>Enzyme Age I HF</td>
			<td>New England Biolabs</td>
			<td>R3552L</td>
			<td>20000U/ml</td>
		</tr>
		<tr>
			<td>Enzyme SalI HF</td>
			<td>New England Biolabs</td>
			<td>R3138L</td>
			<td>20000U/ml</td>
		</tr>
		<tr>
			<td>Enzyme Xho I</td>
			<td>New England Biolabs</td>
			<td>R0146L</td>
			<td>20000U/ml</td>
		</tr>
		<tr>
			<td>Enzyme BSIWI</td>
			<td>New England Biolabs</td>
			<td>R0553L</td>
			<td>10000U/ml</td>
		</tr>
		<tr>
			<td>HCg1 (Genbank accession number FJ475055)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>LCk (Genbank accession number FJ475056 )</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>LCl (Genbank accession number FJ517647)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>15224.017</td>
			<td>100U (1U/ul)</td>
		</tr>
		<tr>
			<td>2X YT medium</td>
			<td>Sigma Aldrich</td>
			<td>Y1003-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Sigma Aldrich</td>
			<td>10835242001</td>
			<td></td>
		</tr>
		<tr>
			<td>LB (Luria Bertani) Broth (Lennox)</td>
			<td>Sigma Aldrich</td>
			<td>L3022-250G</td>
			<td></td>
		</tr>
		<tr>
			<td>Nucleospin Plasmid DNA, RNA and protein purification</td>
			<td>Macherey Nagel</td>
			<td>740588.250</td>
			<td></td>
		</tr>
		<tr>
			<td>Jet PEI DNA transfection reagent</td>
			<td>PolyPlus</td>
			<td>101-40</td>
			<td></td>
		</tr>
		<tr>
			<td>Flat bottom96-well plate</td>
			<td>Falcon</td>
			<td>353072</td>
			<td></td>
		</tr>
		<tr>
			<td>V-bottom 96-well plate</td>
			<td>Nunc/Thermofisher</td>
			<td>055142</td>
			<td></td>
		</tr>
		<tr>
			<td>Nunc easy 175 cm2 flasks</td>
			<td>Nunc/Thermofisher</td>
			<td>12-562-000</td>
			<td></td>
		</tr>
		<tr>
			<td>ELISA/ELISPOT coating buffer</td>
			<td>eBiosciences</td>
			<td>00-0044-59</td>
			<td></td>
		</tr>
		<tr>
			<td>Nunc maxisorp flat bottom 96 well ELISA plates</td>
			<td>Nunc/Thermofisher</td>
			<td>44-2404-21</td>
			<td>high protein binding</td>
		</tr>
		<tr>
			<td>Anti-human IgG Ab conjugated to horseradish peroxidase (HRP)</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>55788</td>
			<td></td>
		</tr>
		<tr>
			<td>TMB substrate</td>
			<td>BD Biosciences</td>
			<td>555214</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptavidin</td>
			<td>Sigma</td>
			<td>S0677</td>
			<td></td>
		</tr>
		<tr>
			<td>1 mL-HiTrap protein A HP column</td>
			<td>GE Healthcare</td>
			<td>17-0402-01</td>
			<td></td>
		</tr>
		<tr>
			<td>&#196;KTA FPLC</td>
			<td>GE Healthcare</td>
			<td>18190026</td>
			<td></td>
		</tr>
		<tr>
			<td>Superdex 200 10/300 GL column</td>
			<td>GE Healthcare</td>
			<td>17517501</td>
			<td></td>
		</tr>
		<tr>
			<td>NGC Quest 10 Plus Chromatography System</td>
			<td>BioRad</td>
			<td>7880003</td>
			<td></td>
		</tr>
	</tbody>
</table>

generation of discriminative human monoclonal antibodies from rare antigen-specific b cells circulating in blood

נוגדנים חד-שבטיים (mAbs) הינם כלים רבי-עוצמה שימושי עבור שניהם מחקר בסיסי ב וההתערבות. ירידה לפרטים גבוהה שלהם היא הכרחית כאשר הנוגדן צריך להבחין בין מבנים הקשורים במידה רבה (למשל, חלבון רגיל, גרסה מוטציה הימנו). הדרך הנוכחית של יצירת mAbs שמסווגת כזה כרוך ההקרנה נרחב של תאים מייצרי Ab B מרובים, וזה גם יקר וגם זמן רב. אנו מציעים כאן שיטה מהירה וחסכונית לדור של שמסווגת, mAbs אנושית לחלוטין, החל מדם אנושי במחזור B לימפוציטים. מקוריות אסטרטגיה זו נובעת בחירת התאים איגוד B אנטיגן ספציפי בשילוב עם מבחר הנגד של כל התאים האחרים, שימוש זמינים היקפיים דם תאי תאים (PBMC). ברגע מסוים B תאים מבודדים, רצפים cDNA (חומצה deoxyribonucleic משלימים) קידוד mAb המתאימים מתקבלים תא בודד הפוך תמלול-תגובת שרשרת פולימראזית (RT-PCR) בטכנולוגיית והביע לאחר מכן-אנוש תאים. בתוך מעט ככל 1 חודש, זה אפשרי לייצר מיליגרם של mAbs אנושי מאוד שמסווגת נגד כמעט כל אנטיגן הרצוי באופן טבעי שזיהה את הרפרטואר תא B.

החל מ- PBMC מתורמים מאוד בריאים, זה פרויקט המתנות הדור של האדם mAbs, אשר מזהה את פפטיד Pp65495 (Pp65, מן האדם cytomegalovirus) שהוצגו על-ידי המחלקה מורכבת histocompatibility הגדולות אני (MHC-אני) מולקולה (הלע - A * 0201 HLA-A2). MAbs אלה יכול להפלות בין מתחם, מתחמי המייצג אחרים פפטידים מועמסים על MHC אותו זה-א?...

Watch this Scientific Journal Video about Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood at JoVE.com

Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

אנו מתארים שיטה לייצור נוגדנים אנושי ספציפי אנטיגן של עניין, מתחיל מתאי B נדיר במחזור דם אנושי. דור של נוגדנים טבעיים אלה הוא יעיל ומהיר, הנוגדנים שהושג יכול להפלות בין אנטיגנים מאוד קשורות.

דור שמסווגת נוגדנים חד-שבטיים אנושי מתאי B אנטיגן ספציפי נדיר במחזור הדם

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the ...

The overall goal of this procedure is to produce fully human monoclonal antibodies against a desired antigen starting from human B lymphocytes circulating in the blood. This protocol allows the generation of monoclonal antibodies that can discriminate between highly related antigens. For some applications such as immunotherapy, precise targeting of an antigen can be indispensable.The advantages of this technique are that this can be performed starting from the blood of healthy or immunized donors and allows the isolation of even rare antigen-binding B cells. While this method is described starting from human samples, it can also be applied to animals that can be pre-immunized. Visual demonstration of this method is critical as the procedure really is under quite complex multiple analytic gating strategy of discriminated B lymphocytes.The procedure will be performed by Melinda. She is an assistant engineer from our laboratory. First pipette 35 milliliters of diluted cell suspension on 15 milliliters of density gradient in a 50 milliliter conical tube.Then place the conical tube in a swing bucket rotor with brakes off and centrifuge at 1290 times gravity for 25 minutes at room temperature. Next, at the interface of the density gradient medium and plasma layer, carefully aspirate the mononuclear cell layer and transfer it to a new 50 milliliter conical tube. Add the cell suspension to a 15 milliliter conical tube and centrifuge at 460 times gravity for five minutes.Then, resuspend the pellet in 200 microliters of phosphate buffered saline with 2%fetal bovine serum. Add conjugated tetramers to a final concentration of 10 micrograms per milliliter. Mix well and then incubate at room temperature for 30 minutes in the Laminar flow hood, protected from the light.Then add 10 milliliters of ice cold cell separation buffer to the cell suspension. Centrifuge the cell suspension at 460 times gravity for five minutes. To the cell pellet obtained, add 500 microliters of ice cold cell separation buffer and 50 microliters of two variants of magnetic microbeads and incubate the cell suspension for 20 minutes.Next, resuspend the cell pellet in ice cold cell separation buffer. Carefully transfer the cell suspension on the top of an equilibrated column and let it drain completely. Then rinse the tube with three milliliters of cell separation buffer and transfer the buffer to the column.After rinsing the column three times, remove it from the magnet and place on a 25 milliliter conical collecting tube. After adding five milliliters of ice cold separation buffer on top of the column, quickly flush the cells from the column with the help of a plunger. Resuspend the cell pellet with a cocktail of anti-human antibodies and 7AAD in a total volume of 100 microliters of phosphate buffered saline with 2%fetal bovine serum.Then, incubate the cells at four degrees Celsius for 30 minutes. Next, use a cell sorter cytometer to sort specific B cells at the single cell level not exceeding beyond on 1, 000 events per second. Then, collect the single sorted B cells into 8-strip PCR tubes previously filled with 10 microliters of 1X phosphate buffered saline and 10 units of RNAse inhibitor and place on a rack for 96 microtubes.Quickly freeze the tubes at negative 80 degrees Celsius. Heat the frozen samples in a dry bath maintained at 70 degrees Celsius for five minutes to lyse the cells. Then place the strip on ice and start constituting the reverse transcription master-mix.Once the reverse transcription master-mix is prepared, program instruct thermocycler. At the end of the reverse transcription, perform nested PCRs to amplify immunoglobulin genes. Identify the positive clones by visualizing on a 1.5%agarose gel the migration of a 500 base pair PCR product for variable heavy chain and coding segments and 350 base pair PCR product for variable light chain encoding segments.Add one microliter of the cloning product to 45 microliters of electrocompetent TOP10 E.coli cells.Electroporate. Then quickly add 500 microliters of 2X YT medium to the cells and incubate in a water bath at 37 degrees Celsius for 30 minutes. Spread the transformed bacteria on 2X YT ampicillin plate.Then, incubate the plates overnight at 37 degrees Celsius. Next, setup a reaction premix and add 25 microliters of it in per 8-strip PCR tube kept on ice. Then, use a sterile toothpick to pick colonies and streak the colonies on the 2X YT ampicillin plate.Then, dip the toothpicks in the PCR reaction tube. Identify the positive clones by visualizing on a 1.5%agarose gel the migration of an 850 base pair PCR product for the heavy chain vector and a 600 base pair PCR product for the light chain vector. In two milliliters of LB medium, inoculate four positive colonies.Incubate the inoculate at 37 degrees Celsius overnight at 200 revolutions per minute shaking. Seed 15, 000 human embryonic kidney cells in 200 microliters of Dulbecco's Modified Eagle Medium supplemented with 10%fetal bovine serum in each well of a flat bottom 96 well plate a day before the transfection. Then incubate the plate at 37 degrees Celsius overnight at 5%carbon dioxide.Cotransfect the cells using a linear polyethylenimine derivative transfection reagent. Dilute 0.5 microliters of DNA transfection reagent with 10 microliters of 150 millimolar of sodium chloride. Next, dilute 0.125 microgram of each variable heavy and light chain expressing vectors in 10 microliters of 150 millimolar sodium chloride.Vortex all the dilutions for 10 seconds each. Then, mix the previously diluted DNA transfection reagent with 10 microliters of DNA solution. Quickly vortex the DNA transfection mixture for 15 seconds and incubate for 15 minutes at room temperature.Add the DNA transfection mixture drop-wise on the cells and then gently swirl the plate. Replace the medium 16 hours after transfection and culture the cells for five days in serum-free medium at 37 degrees Celsius. Next, use a multichannel pipette, to aspirate the supernatant, and transfer it into the v-bottom 96 well plate.Coat each well in a 96 well ELISA plate with relevant antigen at four degrees Celsius for overnight in 100 microliters of reconstituted ELISA coating buffer at a final concentration of two micrograms per milliliter. Next add 50 microliters of a transfected cell supernatant to the wells of a 96 well ELISA plate and incubate the plate for two hours at room temperature. Then add 100 microliters of antihuman immunoglobulin G antibody conjugated to horseradish peroxidase enzyme at one microgram per milliliter concentration and incubate the well at room temperature for one hour.Finally, add 50 microliters of chromogenic substrate to the well and incubate for another 20 minutes. At the end of incubation, read the optical density at 450 nanometers on a spectrophotometer. To isolate the specific B cells a gating strategy was used that discriminated the B cells expressing receptors against the HLA-A2/Pp65 complex.Initially, the cells were CD19 positive, CD3 negative gated. Finally, cells were stained with both HLA-A2/Pp65PE and HLA-A2/Pp65APC, but not HLA-A2/MelABV421 tetramers, were gated to obtain the highly specific B cells. Using this gating strategy, selective B cells can be isolated, which can differentiate between HLA-A2/Pp65 and other related HLA-A2 peptide complex.Next, to study the presence of PC1.02 antibody against HLA-A2/Pp65 tetramer an ELISA assay was performed. In the bar plot obtained, the y-axis corresponds to the optimal density readings and the x-axis correspond to the HLA-A2 peptides. From the assay, it shows that a monoclonal antibody binds with HLA-A2/Pp65 tetramer in a peptide and major histocompatibility complex dependent manner.Next, surface plasmin residence was used to study the binding affinity of the PC1.02 antibody. Then, a tabular data was obtained to analyze the HLA-A2/Pp65 specific B cells. The impact of the exclusion strategy of unspecific B cells, the yields of immunoglobulin gene amplification, and monoclonal antibody production from HLA-A2/Pp65 specific B cells have been shown.Once mastered, the technique ranging from isolation of antigens specific B cells from human blood to monoclonal antibody production can be done in as little as one month. When performing this procedure, remember go straight from sorting of B cells to RT-PCR without pausing.

Research

JoVE Journal

Immunology and Infection

Antigen Specific In Vivo Killing Assay using CFSE Labeled Target Cells

Antigen Specific In Vivo Killing Assay using CFSE Labeled Target Cells

אנטיגן ספציפי In vivo להרוג Assay באמצעות תווית CFSE תאים היעד

Carboxyfluorescein diacetate succinimidyl ester (CFSE) can be used to easily and quickly label a cell population of interest for in vivo investigation.  ...

Isolation of Precursor B-cell Subsets from Umbilical Cord Blood

בידוד של קבוצות משנה מבשר B-cell מדם טבורים

Umbilical cord blood is highly enriched for hematopoietic progenitor cells at different lineage commitment stages. We have developed a protocol for ...

Killer Artificial Antigen Presenting Cells (KaAPC) for Efficient In Vitro Depletion of Human Antigen-specific T Cells

Killer Artificial Antigen Presenting Cells KaAPC for Efficient In Vitro Depletion of Human Antigen-specific T Cells

תאי מציגי הרוצח המלאכותי Antigen (KaAPC) ליעיל<em&gt; במבחנה</em&gt; דלדול של תאי T אנושי אנטיגן ספציפי

Current treatment of T cell mediated autoimmune diseases relies mostly on strategies of global immunosuppression, which, in the long term, is accompanied ...

Generation of Human Alloantigen-specific T Cells from Peripheral Blood

דור של תאי T האנושי Alloantigen ספציפיים מהדם היקפי

The study of human T lymphocyte biology often involves examination of responses to activating ligands. T cells recognize and respond to processed peptide ...

Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

דור של רקומביננטי אדם IgG נוגדנים חד שבטיים מתאים הממוינים B הונצחו

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, ...

The Isolation, Differentiation, and Quantification of Human Antibody-secreting B Cells from Blood: ELISpot as a Functional Readout of Humoral Immunity

הבידוד, בידול, וכימות של האדם נוגדן מפריש תאים B מדם: ELISPOT בתור Readout פונקציונלי של חסינות הלחות

The hallmark of humoral immunity is to generate functional ASCs, which synthesize and secrete Abs specific to an antigen (Ag), such as a pathogen, and are ...

Generation of Murine Monoclonal Antibodies by Hybridoma Technology

הדור של Murine חד-שבטיים נוגדנים על ידי Hybridoma טכנולוגיה

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding ...

Generation of Human Monocyte-derived Dendritic Cells from Whole Blood

דור של תאי דנדריטים אדם נגזר מונוציטים מן הדם מלא

Dendritic cells (DCs) recognize foreign structures of different pathogens, such as viruses, bacteria, and fungi, via a variety of pattern recognition ...

Dextran Enhances the Lentiviral Transduction Efficiency of Murine and Human Primary NK Cells

לתוספי משפר את היעילות התמרה חושית Lentiviral של תאי NK העיקרי מאתר ואנושי

The efficient transduction of specific genes into natural killer (NK) cells has been a major challenge. Successful transductions are critical to defining ...

Detection and Enrichment of Rare Antigen-specific B Cells for Analysis of Phenotype and Function

איתור והעשרה של נדיר- אנטיגן ספציפי בתאי B עבור ניתוח של הפנוטיפ ותפקוד

B cells reactive with a specific antigen usually occur at a frequency of &lt;0.05% of lymphocytes. For decades researchers have sought methods to isolate ...