Name: assembly and purification of prototype foamy virus intasomes
Uploaded: 2018-03-19T15:00:00
Description: Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Dette arbejde blev støttet af NIH AI099854 og AI126742 til nøglen.

1. Udglødning af vDNA
<ol><li>Kombiner 1 X 10 Buffer (10 X 10 lager: 100 mM Tris-HCl, pH 8,0, 1 M NaCl, 10 mM EDTA), 10 µM Oligo 1 (5' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3', 100 µM stock) og 10 µM Oligo 2 (5' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3', 100 µM lager) i en afsluttende bind af 1,5 mL . Alikvot 25 µL til Tres 0,2 mL polymerase kædereaktion (PCR) rør. Bemærk: Afhængigt af programmet, oligomerer kan ændres med fluorophores eller tags ved 5'-enden af Oligo 2 eller som en indre amino-T på b...

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

Retroviral INs danne en multimeriske kompleks med viral genomisk DNA til at udføre integration og fortsætte den virale livscyklus. Antal i monomerer pr. intasome kan være tetramers, octamers eller eventuelt højere orden multimerer11,12,13,14. PFV intasomes er en tetramer af rekombinant med dobbelt-strenget DNA oligomerer, der efterligner viral genomisk DNA slutter3<e...

Integration af det virale genom i vært genom er et obligatorisk trin i livscyklussen for alle retrovira1. Viral enzym integrase (IN) katalyserer den kovalente sammenføjning af hver ende af det virale DNA genom til værten DNA. Under en cellulær infektion, er i en del af en pre integration kompleks, der medierer integration. Rekombinant i kompleksbundet med dobbelt strandede DNA oligomerer efterligne de virale DNA ender kan også udføre integration i en target DNA in vitro-2. En fælles integration assay i vitro udnytter en supercoiled plasmid som mål-DNA. Integration af både virale DNA oligomerer (vDNA) til plasmidet resulterer i en lineær produkt og kaldes samordnet integration (figur 2A). Integration assay in vitro- kan der også fremstilles produkter med kun én vDNA kovalent tilsluttet target plasmid resulterer i en afslappet cirkel. Denne halv-site integration produkt ser ud til at være en artefakt af assay in vitro.
Rekombinant i og vDNA kan udføre integration i vitro, men de er ikke ideel reagenser til undersøgelse af dynamikken eller struktur af integration komplekser når monomere IN ville skjule relevante visualisering. Renset integration komplekser, eller "intasomes," er påkrævet for dynamisk enkelt molekyle analyse eller strukturelle studier. PFV i og vDNAs kan samles ved dialyse fra en relativt høj saltkoncentration buffer til en lavere saltkoncentration3,4. Under dialyse, en bundfaldet former. Denne opløsning er fjernet fra dialyse og salt koncentrationen er øget. Den højere salt koncentration solubilizes bundfald indeholdende PFV intasomes. Intasomes er derefter renset ved størrelse udstødelse kromatografi (sek). Rekombinant prototype skummende virus (PFV) IN har vist sig at eksistere som en monomer i løsning ved koncentrationer op til 225 µM5. SEK fraktionering adskiller effektivt PFV intasomes (225.5 kDa), som omfatter en tetramer af PFV i og to vDNAs, fra monomere PFV i (44,4 kDa) og gratis vDNA (24.0 kDa). PFV intasomes kan fryses og bevare integration aktivitet i mindst seks måneder efter opbevaring på-80 ˚C.
Rekombinante PFV intasomes kan også ændres for at medtage i aminosyre udskiftninger eller trunkering mutationer eller vDNAs mærket med fluorophores eller biotin4,6. De renset PFV intasomes udføre let integration i en mål-supercoiled plasmid DNA i vitro. Bulk biokemiske integration assays med intasomes kan afprøve virkningerne af i mutationer i hæmmere eller andre kemiske tilsætningsstoffer. Biotinylated intasomes kan bruges til at probe affinitet med nukleinsyrer eller proteiner. PFV intasomes er funktionelle ved omgivende temperatur giver mulighed for enkelt molekyle mikroskopi analyse af magnetiske pincet til at måle tid mellem sammenføjning af to vDNA ender eller total interne reflection fluorescens at visualisere intasome søgning på mål DNA6. Desuden var PFV intasomes først til at være strukturelt karakteriseret væsentligt påvirker inden for retroviral integration3.

<table>
	<tbody>
		<tr>
			<td>DNA Oligomers</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>Custom DNA Oligos</td>
		</tr>
		<tr>
			<td>Tris Ultra Pure</td>
			<td>Gojira Fine Chemicals</td>
			<td>UTS1003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>P212121</td>
			<td>RP-S23020</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure EDTA</td>
			<td>Invitrogen/Gibco</td>
			<td>15575</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra 0.5 mL centrifugal filters</td>
			<td>Sigma-Aldrich</td>
			<td>Z677094-24EA</td>
			<td>3 kDa MWCO</td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>P212121</td>
			<td>SV-DTT</td>
			<td></td>
		</tr>
		<tr>
			<td>BIS-TRIS propane,&#62;=99.0% (titration)</td>
			<td>Sigma-Aldrich</td>
			<td>B6755-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>ZnCl2</td>
			<td>Sigma-Aldrich</td>
			<td>208086</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>Amresco</td>
			<td>0662</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>G37-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel-loading tips, 1 - 200 &#956;L</td>
			<td>Corning</td>
			<td>CLS4853-400EA</td>
			<td></td>
		</tr>
		<tr>
			<td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td>
			<td>Fisher Scientific</td>
			<td>12-640</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile Disposable Filter Units with PES Membrane &#62; 250mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>568-0020</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis tubing clips</td>
			<td>Spectrum Labs</td>
			<td>132734</td>
			<td></td>
		</tr>
		<tr>
			<td>6-8 kDa 10 mm Dialysis Tubing</td>
			<td>Spectrum Medical</td>
			<td>132645</td>
			<td></td>
		</tr>
		<tr>
			<td>Superose 6 10/300 GL</td>
			<td>GE Healthcare Life Sciences</td>
			<td>17517201</td>
			<td></td>
		</tr>
		<tr>
			<td>Hi-Res Standard Agarose</td>
			<td>AGTC Bioproducts</td>
			<td>AG500D1</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>Thermo Fisher Scientific</td>
			<td>BP1302</td>
			<td></td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Fisher Scientific</td>
			<td>0-267</td>
			<td></td>
		</tr>
		<tr>
			<td>Hyladder 10kb, 500 lanes</td>
			<td>Denville Scientific</td>
			<td>CB4225-4</td>
			<td></td>
		</tr>
	</tbody>
</table>

assembly and purification of prototype foamy virus intasomes

A definere funktion og nødvendigt skridt af retrovirus livscyklus er integrationen af det virale genom i vært genom. Alle retrovira indkode et integrase (IN) enzym, der katalyserer den kovalente sammenføjning af viral til vært DNA, der er kendt som strand overførsel. Integration kan være modelleret i vitro med rekombinant retroviral IN og DNA oligomerer efterligne enderne af det virale genom. For at sammenfatte tættere integration reaktion, der opstår i vivo, integration er komplekser samlet fra rekombinante IN og syntetiske oligomerer ved dialyse i en reduceret saltkoncentration buffer. At integrere komplekse, kaldes en intasome, kan blive renset ved størrelse udstødelse kromatografi. I tilfælde af prototype skummende virus (PFV), intasome er en tetramer af IN og to DNA oligomerer og er let adskilt fra monomere IN og gratis oligomer DNA. Integration effektiviteten af PFV intasomes kan analyseres under en række forsøgsbetingelser til bedre at forstå dynamikken og mekanik af retroviral integration.

PFV intasomes er samlet fra rekombinante IN og vDNA. Efter samling, er intasomes renset af SEC (figur 1). Integration aktivitet af hver fraktion er analyseret med en supercoiled DNA mål og Agarosen gelelektroforese (figur 2). Denne gel er afbildet med en fluorescerende scanner indstillet til at registrere EtBr (og fluorophore, hvis fluorophore-mærket vDNA bruges). Brug billede analyse software, kan band pixel diskenheder bruges...

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

Rekombinant retroviral integrase og DNA oligomerer efterligne viral DNA ender kan danne en enzymatisk aktive kompleks kendt som en intasome. Intasomes kan anvendes til biokemiske, strukturelle og kinetiske studier. Denne protokol detaljer om, hvordan at samle og rense prototype skummende virus intasomes.

Forsamling og rensning af Prototype skummende Virus Intasomes

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

Research

JoVE Journal

Immunology and Infection

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

Enkel og robust In vivo Og In vitro Fremgangsmåde for at studere Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Affinity Purification of Influenza Virus Ribonucleoprotein Complexes from the Chromatin of Infected Cells

Affinitetsrensning af Influenzavirus ribonukleoprotein komplekser fra kromatin af inficerede celler

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the ...

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

Oprensning af Patogen vakuoler fra<em&gt; Legionella</em&gt;-Inficerede Fagocytter

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

Redning af rekombinant Newcastle Disease-virus fra cDNA

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Neutrofil Isolering og analyse for at fastslå deres rolle i lymfom Cell Følsomhed til terapeutiske midler

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Evaluering af effekt og toksicitet af RNA Målretning HIV-1 Produktion til brug i Gene eller Drug Therapy

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Redning og karakterisering af rekombinant virus fra en ny verden Zika Virus infektiøs klon

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

Generation af undslippe varianter af neutraliserende Influenza Virus monoklonale antistoffer

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

Registrering og fjernelse af nukleasen forurening under oprensning af rekombinante Prototype skummende Virus Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

Hurtig, sikker og simpel manuel sengelamper nukleinsyre udvinding til påvisning af Virus i blodprøver

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...