Name: assembly and purification of prototype foamy virus intasomes
Uploaded: 2018-03-19T15:00:00
Description: Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Dit werk werd gesteund door de NIH AI099854 en de AI126742 sleutel.

1. het gloeien van vDNA
<ol><li>Combineer 1 X tien Buffer (10 X 10 voorraad: 100 mM Tris-HCl, pH 8,0, 1 M NaCl, 10 mM EDTA), 10 µM Oligo 1 (5' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3', 100 µM voorraad) en 10 µM Oligo 2 (5' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3', 100 µM voorraad) in een eindvolume van 1,5 mL . Aliquot 25 µL in zestig 0,2 mL polymerase kettingreactie (PCR) buizen. Opmerking: Afhankelijk van de toepassing, oligomeren kunnen worden gewijzigd met fluorophores of tags aan de 5'-eind van Oligo 2...

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

Retrovirale INs vormen een complex met virale genomic DNA uit te voeren van de integratie en de virale levenscyclus blijven multimeric. Het aantal IN monomeren per intasome kan worden tetramers, octamers of eventueel hogere orde multimeren11,12,13,14. PFV intasomes zijn een tetrameer van recombinant met double-stranded DNA oligomeren, die virale genomic DNA na te bootsen eindigt<sup class="xref...

Integratie van het virale genoom in het genoom van de gastheer is een verplichte stap in de levenscyclus van alle retrovirussen1. Het virale enzym integrase (IN) katalyseert de covalente verbinding van elk uiteinde van het virale genoom van DNA tot de host DNA. Tijdens een cellulaire infectie, is IN onderdeel van een complex van pre integratie die integratie bemiddelt. Integratie in een doel DNA in vitro2kan ook worden uitgevoerd door recombinant IN complexvorm met dubbele gestrande DNA oligomeren nabootsen van de virale DNA-uiteinden. Een gemeenschappelijk integratie assay in vitro maakt gebruik van een supercoiled plasmide als het DNA van het doel. Integratie van beide virale DNA oligomeren (vDNA) naar de plasmide resulteert in een lineair product en gecoördineerde integratie (figuur 2A) wordt genoemd. De integratie assay in vitro kunnen ook producten opleveren met slechts één vDNA covalent toegevoegd aan de doel-plasmide resulterend in een ontspannen cirkel. Dit half-site integratie-product lijkt te zijn van een artefact van de bepaling in vitro.
Recombinant IN en vDNA mogen verrichten integratie in vitro, maar ze zijn niet ideaal reagentia voor de studie van de dynamiek of de structuur van integratie complexen als monomeer IN relevante visualisatie zou verhullen. Gezuiverde integratie complexen, of "intasomes," zijn vereist voor dynamische enkel molecuul analyse of structurele studies. PFV IN en vDNAs kunnen worden geassembleerd door dialyse uit de buffer van een relatief hoge zoutconcentratie aan een lagere zoutconcentratie3,4. Tijdens de dialyse, een neerslag vormen. Deze neerslag wordt verwijderd uit de dialyse en de zoutconcentratie wordt verhoogd. De hogere concentratie van het zout lost de overhaaste met PFV intasomes. De intasomes zijn dan gezuiverd door grootte uitsluiting chromatography (SEC). Recombinante prototype schuimend virus (PFV) IN blijkt te bestaan als een monomeer in oplossing bij concentraties tot 225 µM5. SEC fractionering scheidt effectief de PFV intasomes (225.5 kDa), waaronder een tetrameer van PFV IN en twee vDNAs, monomere PFV IN (44.4 kDa) en gratis vDNA (24.0 kDa). De PFV intasomes kunnen worden bevroren en integratie activiteit behouden gedurende ten minste zes maanden van opslag bij-80 ˚C.
Recombinante PFV intasomes kan ook worden gewijzigd om IN aminozuur vervangingen of afkappen mutaties of vDNAs voorzien van fluorophores of Biotine4,6te nemen. De gezuiverde PFV intasomes uitvoeren gemakkelijk integreren een doelwit supercoiled plasmide DNA in vitro. Bulk biochemische integratie testen met intasomes kunnen de effecten van testen IN mutaties, IN-remmers of andere chemische additieven. Biotinyleerd intasomes kan worden gebruikt om de sonde affiniteit met nucleic zuren of eiwitten. PFV intasomes zijn functioneel bij kamertemperatuur waardoor enkel molecuul microscopie p.a. door magnetische pincet voor het meten van de tijd tussen het verbinden van de twee uiteinden van de vDNA of de totale interne reflectie fluorescentie te visualiseren het intasome zoeken op doel DNA6. Daarnaast waren PFV intasomes de eerste die structureel worden gekenmerkt aanzienlijk invloed op het gebied van retrovirale integratie3.

<table>
	<tbody>
		<tr>
			<td>DNA Oligomers</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>Custom DNA Oligos</td>
		</tr>
		<tr>
			<td>Tris Ultra Pure</td>
			<td>Gojira Fine Chemicals</td>
			<td>UTS1003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>P212121</td>
			<td>RP-S23020</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure EDTA</td>
			<td>Invitrogen/Gibco</td>
			<td>15575</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra 0.5 mL centrifugal filters</td>
			<td>Sigma-Aldrich</td>
			<td>Z677094-24EA</td>
			<td>3 kDa MWCO</td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>P212121</td>
			<td>SV-DTT</td>
			<td></td>
		</tr>
		<tr>
			<td>BIS-TRIS propane,&#62;=99.0% (titration)</td>
			<td>Sigma-Aldrich</td>
			<td>B6755-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>ZnCl2</td>
			<td>Sigma-Aldrich</td>
			<td>208086</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>Amresco</td>
			<td>0662</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>G37-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel-loading tips, 1 - 200 &#956;L</td>
			<td>Corning</td>
			<td>CLS4853-400EA</td>
			<td></td>
		</tr>
		<tr>
			<td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td>
			<td>Fisher Scientific</td>
			<td>12-640</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile Disposable Filter Units with PES Membrane &#62; 250mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>568-0020</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis tubing clips</td>
			<td>Spectrum Labs</td>
			<td>132734</td>
			<td></td>
		</tr>
		<tr>
			<td>6-8 kDa 10 mm Dialysis Tubing</td>
			<td>Spectrum Medical</td>
			<td>132645</td>
			<td></td>
		</tr>
		<tr>
			<td>Superose 6 10/300 GL</td>
			<td>GE Healthcare Life Sciences</td>
			<td>17517201</td>
			<td></td>
		</tr>
		<tr>
			<td>Hi-Res Standard Agarose</td>
			<td>AGTC Bioproducts</td>
			<td>AG500D1</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>Thermo Fisher Scientific</td>
			<td>BP1302</td>
			<td></td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Fisher Scientific</td>
			<td>0-267</td>
			<td></td>
		</tr>
		<tr>
			<td>Hyladder 10kb, 500 lanes</td>
			<td>Denville Scientific</td>
			<td>CB4225-4</td>
			<td></td>
		</tr>
	</tbody>
</table>

assembly and purification of prototype foamy virus intasomes

A het definiëren van functie en noodzakelijke stap in de levenscyclus van retrovirus is de integratie van het virale genoom in het genoom van de gastheer. Alle retrovirussen coderen een integrase (IN)-enzym dat katalyseert de covalente verbinding van virale naar host DNA, die staat bekend als strand overdracht. Integratie kan worden gemodelleerd in vitro met recombinant retrovirale IN en DNA oligomeren nabootsen van de uiteinden van het virale genoom. Om te recapituleren nauwer de integratie-reactie die in vivo, integratie optreedt zijn complexen van recombinante IN en synthetische oligomeren geassembleerd door dialyse in een lagere zoutconcentratie buffer. De integratie complex, een intasome, genaamd kan worden gezuiverd door grootte uitsluiting chromatografie. In het geval van prototype schuimend virus (PFV), de intasome is een tetrameer van IN en twee DNA oligomeren en is gemakkelijk gescheiden van monomeer IN en gratis oligomeren DNA. De efficiëntie van de integratie van PFV intasomes kan worden bepaald onder verschillende experimentele omstandigheden voor een beter begrip van de dynamiek en mechanica van retrovirale integratie.

PFV intasomes zijn samengesteld uit recombinante IN en vDNA. Na montage, zijn intasomes gezuiverd door SEC (Figuur 1). Integratie activiteit van elke breuk is bepaald met een supercoiled DNA target en agarose gelelektroforese (Figuur 2). Deze gel is beeld met een fluorescerende scanner ingesteld op het detecteren van EtBr (en fluorophore, als vDNA met het fluorophore-label wordt gebruikt). Met behulp van de software van de analys...

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

Recombinante retrovirale integrase en DNA oligomeren nabootsen van virale DNA uiteinden kunnen een enzymatisch actieve complex bekend als een intasome vormen. Intasomes kan worden gebruikt voor biochemische, structurele en kinetische studies. Dit protocol detailleert hoe te monteren en te zuiveren van prototype schuimend virus intasomes.

Vergadering en zuivering van Prototype schuimend Virus Intasomes

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

Research

JoVE Journal

Immunology and Infection

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

Eenvoudige en robuuste In vivo En In vitro Aanpak voor het bestuderen van Virus Vergadering

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Affinity Purification of Influenza Virus Ribonucleoprotein Complexes from the Chromatin of Infected Cells

Affiniteit Zuivering van Influenza Virus ribonucleoproteïne Complexen van het chromatine van geïnfecteerde cellen

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the ...

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

Zuivering van Pathogeen vacuolen uit<em&gt; Legionella</em&gt;-Geïnfecteerde Fagocyten

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

Redding van recombinant Newcastle Disease Virus uit cDNA

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Neutrofielen Isolatie en analyse van hun rol in de Lymphoma Cell Gevoeligheid voor therapeutische middelen te bepalen

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Evaluatie van de effectiviteit en toxiciteit van RNA&#39;s Targeting HIV-1 productie voor gebruik in Gene of Drug Therapy

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Redding en karakterisering van het recombinante virus van een nieuwe infectieuze kloon van de Zika Virus

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

Generatie van Escape varianten van het Influenza Virus monoklonale antistoffen neutraliseren

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

Detectie en verwijdering van de Nuclease besmetting tijdens het zuiveringsproces ongehinderd van recombinante Prototype schuimend Virus Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

Snelle, veilige en eenvoudige handleiding bed nucleïnezuur extractie voor de opsporing van Virus in monsters van volbloed

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...