Name: assembly and purification of prototype foamy virus intasomes
Uploaded: 2018-03-19T15:00:00
Description: Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Ce travail a été soutenu par les NIH AI099854 et AI126742 à clé.

1. recuit de vDNA
<ol><li>Combine 1 X tampon de dix (10 X 10 stock : 100 mM Tris-HCl, pH 8,0, 1 M NaCl, EDTA de 10 mM), 10 µM Oligo 1 (5' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3', 100 µM stock) et 10 µM Oligo 2 (5' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3', 100 µM stock) dans un volume final de 1,5 mL . Aliquote 25 µL dans soixante tubes de 0,2 mL polymérase chain reaction (PCR). Remarque : Selon l’application, oligomères peuvent être modifiées avec des fluorophores ou des balises à l’extrémité ...

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

INs retroviral forment un complexe avec l’ADN génomique viral pour effectuer une intégration et continuer le cycle de vie viral multimère. Le nombre de monomères par intasome peut être tétramères, octamères ou éventuellement plus élevés ordre multimères11,12,13,14. PFV intasomes sont un tétramère de recombinaison avec des oligomères d’ADN double brin qui imitent l’ADN géno...

Intégration du génome viral dans le génome de l’hôte est une étape obligatoire dans le cycle de vie de tous les rétrovirus1. L’intégrase enzyme virale (IN) catalyse covalente par le rattachement de chaque extrémité du génome ADN viral à l’hôte de l’ADN. Au cours d’une infection cellulaire, en fait partie d’un complexe d’intégration préalable qui intervient dans l’intégration. Recombinant IN complexé avec double brin oligomères d’ADN imitant les extrémités de l’ADN virales peut effectuer aussi intégration dans une cible ADN in vitro2. Une commune intégration dosage in vitro utilise un plasmide surenroulé comme l’ADN cible. Intégration des deux oligomères d’ADN virales (vDNA) pour le plasmide donne un produit linéaire et est appelée intégration concertée (Figure 2 a). L’intégration dosage in vitro peut aussi donnent des produits avec vDNA qu’une seule liaison covalente a rejoint pour le plasmide de cible, ce qui entraîne un cercle détendu. Ce produit demi-site intégration semble être un artefact de l' essai in vitro.
Recombinant IN et vDNA peuvent effectuer l’intégration in vitro, mais ils ne sont pas réactifs idéales pour l’étude de la dynamique ou la structure des complexes d’intégration lorsque IN monomère obscurciraient visualisation pertinente. Complexes d’intégration purifiée, ou « intasomes », sont nécessaires pour les études structurelles ou analyse dynamique seule molécule. PFV IN et vDNAs peuvent être assemblés par dialyse d’une mémoire tampon de concentration relativement élevée de sel à une plus faible concentration en sel3,4. Au cours de la dialyse, un précipité formes. Ce précipité est supprimé de la dialyse et la concentration en sel est augmentée. La plus forte concentration de sel solubilise le précipité contenant intasomes PFV. Les intasomes sont ensuite purifiés par chromatographie d’exclusion (s). Recombinant prototype virus spumeux (PFV) IN a démontré d’exister comme monomère en solution, à des concentrations allant jusqu'à 225 µM5. Fractionnement SEC sépare efficacement l’intasomes PFV (225,5 kDa), qui comprend un tétramère de PFV IN et deux vDNAs, de monomère PFV dans (44,4 kDa) et gratuit vDNA (24,0 kDa). La PFV intasomes peuvent être congelés et conserver l’activité d’intégration pendant au moins six mois de stockage à-80 ° c.
Recombinant PFV intasomes peut également être modifiée pour inclure dans les substitutions d’acides aminés ou des mutations de troncature ou vDNAs marquées avec des fluorophores ou biotine4,6. Les intasomes PFV purifiés facilement effectuer une intégration dans une cible de plasmide supercoiled ADN in vitro. Analyses biochimiques intégration en vrac avec intasomes peuvent tester les effets de mutations, inhibiteurs, ou autres additifs chimiques. Intasomes biotinylé peut être utilisé pour sonder les affinités avec les acides nucléiques ou des protéines. PFV intasomes fonctionnent à température ambiante permettant analyse microscopie seule molécule par pince magnétique pour mesurer le temps entre l’assemblage des deux extrémités de la vDNA ou fluorescence de réflexion interne totale de visualiser la recherche intasome sur cible ADN6. En outre, intasomes PFV ont été les premiers à être structurellement caractérisent impactant considérablement le domaine de l’intégration rétrovirale3.

<table>
	<tbody>
		<tr>
			<td>DNA Oligomers</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>Custom DNA Oligos</td>
		</tr>
		<tr>
			<td>Tris Ultra Pure</td>
			<td>Gojira Fine Chemicals</td>
			<td>UTS1003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>P212121</td>
			<td>RP-S23020</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure EDTA</td>
			<td>Invitrogen/Gibco</td>
			<td>15575</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra 0.5 mL centrifugal filters</td>
			<td>Sigma-Aldrich</td>
			<td>Z677094-24EA</td>
			<td>3 kDa MWCO</td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>P212121</td>
			<td>SV-DTT</td>
			<td></td>
		</tr>
		<tr>
			<td>BIS-TRIS propane,&#62;=99.0% (titration)</td>
			<td>Sigma-Aldrich</td>
			<td>B6755-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>ZnCl2</td>
			<td>Sigma-Aldrich</td>
			<td>208086</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>Amresco</td>
			<td>0662</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>G37-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel-loading tips, 1 - 200 &#956;L</td>
			<td>Corning</td>
			<td>CLS4853-400EA</td>
			<td></td>
		</tr>
		<tr>
			<td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td>
			<td>Fisher Scientific</td>
			<td>12-640</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile Disposable Filter Units with PES Membrane &#62; 250mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>568-0020</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis tubing clips</td>
			<td>Spectrum Labs</td>
			<td>132734</td>
			<td></td>
		</tr>
		<tr>
			<td>6-8 kDa 10 mm Dialysis Tubing</td>
			<td>Spectrum Medical</td>
			<td>132645</td>
			<td></td>
		</tr>
		<tr>
			<td>Superose 6 10/300 GL</td>
			<td>GE Healthcare Life Sciences</td>
			<td>17517201</td>
			<td></td>
		</tr>
		<tr>
			<td>Hi-Res Standard Agarose</td>
			<td>AGTC Bioproducts</td>
			<td>AG500D1</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>Thermo Fisher Scientific</td>
			<td>BP1302</td>
			<td></td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Fisher Scientific</td>
			<td>0-267</td>
			<td></td>
		</tr>
		<tr>
			<td>Hyladder 10kb, 500 lanes</td>
			<td>Denville Scientific</td>
			<td>CB4225-4</td>
			<td></td>
		</tr>
	</tbody>
</table>

assembly and purification of prototype foamy virus intasomes

A définition de fonctionnalité et une étape essentielle du cycle de vie rétrovirus est l’intégration du génome viral dans le génome hôte. Tous les rétrovirus encodent une enzyme intégrase (IN) qui catalyse la jonction covalente de virus à ADN, qui est connu comme transfert de brin d’hôte. Intégration peut-être être modélisés dans vitro par recombinaison IN rétrovirale et oligomères d’ADN imitant les extrémités du génome viral. Afin de mieux récapituler la réaction d’intégration qui se produit in vivo, intégration complexes sont assemblés de recombinaison IN et oligomères synthétiques par dialyse dans un tampon de la concentration en sel réduit. L’intégration complexe, appelée un intasome, peut être purifiée par chromatographie d’exclusion. Dans le cas des virus spumeux expérimental (PFV), l’intasome est un tétramère de po et deux ADN oligomères et on sépare facilement de IN monomère et oligomères gratuit ADN. L’efficacité de l’intégration du PFV intasomes peut-être être dosée sous une variété de conditions expérimentales afin de mieux comprendre la dynamique et la mécanique d’intégration rétrovirale.

PFV intasomes sont assemblés à partir de recombinaison IN et vDNA. Après le montage, les intasomes sont purifiés par SEC (Figure 1). Activité d’intégration de chaque fraction est analysée avec une supercoiled l’ADN cible et agarose électrophorèse sur gel (Figure 2). Ce gel est photographié avec un scanner fluorescent défini pour détecter le bromure d’éthidium (et un fluorophore, si vDNA marqués au fluorophore ...

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

Recombinant intégrase rétrovirale et oligomères d’ADN imitant les extrémités de l’ADN virales peuvent former un complexe enzymatiquement actif connu comme un intasome. Intasomes peut être utilisé pour les études cinétiques, structurales et biochimiques. Ce protocole détaille comment assembler et purifier le prototype spumavirus intasomes.

L’Assemblée et la Purification du Prototype spumavirus Intasomes

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

Research

JoVE Journal

Immunology and Infection

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

Simple et robuste In vivo Et In vitro Démarche pour l&#39;étude de l&#39;assemblage du virus

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Recherche

Immunologie et infection

Affinity Purification of Influenza Virus Ribonucleoprotein Complexes from the Chromatin of Infected Cells

Purification par affinité des complexes virus de la grippe ribonucléoprotéiques de la chromatine des cellules infectées

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the ...

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

Purification de vacuoles agent pathogène à partir<em&gt; Legionella</em&gt; Infectées par les phagocytes

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

Sauvetage de virus de la maladie de Newcastle recombinant à partir d&#39;ADNc

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Neutrophiles Isolement et analyse pour déterminer leur rôle dans le lymphome cellulaire Sensibilité aux agents thérapeutiques

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Évaluation de l&#39;efficacité et la toxicité des ARNs Ciblage VIH-1 Production pour utilisation en thérapie génique ou des médicaments

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Le sauvetage et la caractérisation du virus recombinant à partir d&#39;un nouveau clone infectieux du virus Zika du monde

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

Génération des variantes d’évasion de neutraliser les anticorps monoclonaux Influenza Virus

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

Détection et suppression de nucléase Contamination durant la Purification de l’intégrase du Virus spumeux Prototype Recombinant

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

Extraction rapide, sûre et Simple acide nucléique chevet manuelle pour la détection des Virus dans des échantillons de sang total

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...